Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “PATERNITY”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 181 records · Page 10Linked to original sources
PubMed2004

Late paternity and stillbirth risk.

BACKGROUND: The role of paternal ageing on the incidence of some genetic diseases in offspring depends on the hypothesis that spontaneous mutations accumulate due to continuous cell divisions during spermatogenesis. We examined the effect of paternal age on the complex multifactorial character, stillbirth. METHODS: In 3,619,647 Italian singletons born in 1990-1996 we evaluated stillbirth risk as a function of paternal ageing by means of multiple logistic regression models, which included maternal age and family education, as categorical covariates and interactions. The categorical risk was estimated for mothers and fathers beyond threshold ages of 35 and 40 years, respectively. RESULTS: Stillbirth risk increases with paternal ageing in mothers > or =30 years old, and maternal age and family education modify the impact. In families with low education, the risk accounts for odds ratio (OR) 1.015 [95% confidence interval (CI) 1.01-1.02] in mothers aged 30-34 years, and for OR 1.032 (95% CI 1.02-1.04) in mothers aged > or =35 years; in families with higher education the risk accounts for OR 1.008 (95% CI 1.00-1.02) and OR 1.025 (95% CI 1.01-1.04), respectively, in mothers aged 30-34 and > or =35 years. In these latter families, for mothers aged <35 and fathers > or =40 years the risk accounts for OR 1.12 (95% CI 1.00-1.25). CONCLUSIONS: The effect of paternal ageing on stillbirth risk is revealed in mothers aged > or =30 years and is modified by family education. In mothers aged 30-34 years from families with high education, the increase imputable to paternal ageing might be indicative of a genetic component.

Adult↗
PubMed2005

Paternal involvement in the management of pediatric chronic diseases: associations with adherence, quality of life, and health status.

OBJECTIVES: This article reports associations among paternal involvement in pediatric chronic disease management and child outcomes. METHODS: The Dads' Active Disease Support scale (DADS) and measures of treatment adherence, quality of life, health status, and health care utilization were obtained for youths with six chronic diseases, with complete data sets obtained from 190 couples. RESULTS: Paternal involvement was not associated with these outcomes among younger children. Among adolescents, mother-reported and father-reported DADS scores indicating more paternal involvement were associated with maintenance, rather than deterioration, of treatment adherence and more favorable quality of life. Youths' health status and health care utilization were not related significantly to paternal involvement. CONCLUSIONS: More paternal involvement was associated with more favorable adherence and quality of life among adolescents but not associated with health status or health care utilization. Longitudinal studies could verify whether paternal involvement merits clinical intervention.

Adaptation, Psychological↗
PubMed2002

Germline drift in chimeric male mice possessing an F2 component with a paternal F0 radiation history.

In earlier work using mouse chimeric embryos we have shown that pre-implantation embryonic cells with a history of paternal gamma-irradiation (1 Gy) 6 weeks prior to conception demonstrated a competitive cell proliferation disadvantage when challenged by direct cell-cell contact with control pre-implantation embryos in chimeras even two generations after paternal irradiation. This effect on embryonic cell proliferation was associated with paternal irradiation of sensitive type A/B spermatogonia 6 weeks prior to conception but not from irradiation 5 weeks prior to conception. The purpose of this new study is to test the hypothesis that germ cell lines with a history of acute irradiation may also exhibit a selection disadvantage or germline chimeric drift over time in adult male mice two generations after paternal irradiation in chimeric mice. F(0) male CD1 mice received a 1.0 Gy whole body absorbed dose of attenuated (137)Cs gamma-rays and were mated at post-irradiation weeks 5 and 6. Chimeric XY<---->XY male CD1 mice were constructed with F(2) embryos from the F(1) offspring and with control embryos. To distinguish the control germline cells, the control embryos were heterozygous for the neo transgene, which served as a cell lineage marker. To test for germline chimeric drift, each XY<---->XY chimera was mated periodically from age 7 to 21 weeks with a different CD1 female. The fraction of offspring from each liter with the neo marker was used to quantify the relative contribution of the control germ cell lineage to the fertilizing sperm population. The results showed that there was a significant selection against germ cells with the paternal F(0) post-irradiation week 6 history. In contrast, there was a very small but significant selection in favor of the germ cells with the paternal F(0) post-irradiation week 5 history. These results indicate that the effects of a relatively non-toxic dose of radiation (1 Gy) on cell proliferation transmitted by ancestral type B spermatogonia to the embryo are manifested in the germline of the adult male mice even after two generations.

Animals↗
PubMed2002

Combination of DNA-based and conventional methods to detect human leukocyte antigen polymorphism and its use for paternity testing.

In cases of disputed paternity, the scientific goal is to promote either the exclusion of a falsely accused man or the affiliation of the alleged father. Until now, in addition to anthropologic characteristics, the determination of genetic markers included human leukocyte antigen gene variants; erythrocyte antigens and serum proteins were used for that reason. Recombinant DNA techniques provided a new set of highly variable genetic markers based on DNA nucleotide sequence polymorphism. From the practical standpoint, the application of these techniques to paternity testing provides greater versatility than do conventional genetic marker systems. The use of methods to detect the polymorphism of human leukocyte antigen loci significantly increases the chance of validation of ambiguous results in paternity testing. The outcome of 2384 paternity cases investigated by serologic and/or DNA-based human leukocyte antigen typing was statistically analyzed. Different cases solved by DNA typing are presented involving cases with one or two accused men, exclusions and nonexclusions, and tests of the paternity of a deceased man. The results provide evidence for the advantage of the combined application of various techniques in forensic diagnostics and emphasizes the outstanding possibilities of DNA-based assays. Representative examples demonstrate the strength of combined techniques in paternity testing.

Adult↗
PubMed2006

Paternal age and preterm birth in Italy, 1990 to 1998.

BACKGROUND: Advanced paternal age has been reported to impair pregnancy outcome. Here, we investigated the association of advanced paternal age with preterm birth by using a very large national data set. METHODS: We analyzed data from 1990 to 1998 on Italian firstborn singletons to mothers 20-24 and 25-29 years of age (n = 1,510,823). Odds ratios for overall preterm (<37 weeks' gestation), very preterm (<32 weeks), and moderate preterm (32-36 weeks) births were evaluated through logistic regression models in paternal age classes (20-24, 25-29, 30-34, 35-39, 40-44, 45-49, 50+ years) after adjustment for confounders. Nonparametric regression models were used to fit the effect of paternal ageing on the incidence of very preterm births. RESULTS: Odds ratios increased with paternal age more rapidly for very preterm than for moderate preterm births; among 45- to 49-year-old fathers, odds ratios for very preterm births reached 1.91 (95% confidence interval = 1.08-3.38) and 1.72 (1.25-2.36), respectively, in 20- to 24- and 25- to 29-year-old mothers. CONCLUSIONS: This study confirms that paternal age contributes to the risk of preterm birth. The effect is stronger on very preterm births but also influences moderate preterm births.

Adult↗
PubMed2000

Does multiple paternity improve fitness of the frog Crinia georgiana?

In the Australian myobatrachid frog Crinia georgiana simultaneous polyandry occurs in about half of all matings, which leads to multiple paternity, but reduced fertilization success and occasional female mortality. Multiple paternity may provide benefits to females that compensate for these costs, for example, through enhanced genetic diversity of a clutch. In nature, embryos and tadpoles of C. georgiana develop in shallow, temporary pools and may be exposed to fluctuating water levels and the risk of desiccation between rain events. Fertilization by genetically diverse sires may act as a bet hedge against these conditions. To evaluate this hypothesis, females were artificially mated with one or two males in the field and eggs and larvae reared in the laboratory under constant or fluctuating developmental conditions. Experiment 1 exposed embryos from single- and multiple-paternity clutches to conditions where eggs were completely covered during development or eggs sat in air on a moist substrate. Experiment 2 exposed freshly hatched larvae from single- and multiple-paternity clutches to constant wet conditions, where larvae were completely covered, or fluctuating wet conditions, where larvae ranged from being completely submersed to partially exposed over a 13-day cycle. We measured mean performance and best performance as alternate measures of genetic benefits. There were no effects of paternity on percent survival to hatching, time to hatching, body size at hatching, percent survival to metamorphosis, time to metamorphosis, or body size at metamorphosis. We also analyzed variance within clutches as a measure of genetic diversity. Again there were no predictable effects of multiple paternity. Polyandry does not appear to provide any genetic benefits that compensate for the high costs of polyandry in this species.

Animals↗
PubMed1978

Down syndrome, paternal age, maternal age and birth order.

Recent cytogenetic evidence has shown that trisomy 21 can arise, perphaps even in substantial proportion, from paternal nondisjunction. The statistical association between Down syndrome incidence and maternal age, paternal age and birth order has been studied in a sample of over 4000 cases. The size of this sample made it possible to control for the effect of maternal age by single years of age during the search for a paternal age effect and vice versa, and the importance of such stringent control is emphasized. The maternal age association was confirmed with an extremely high degree of statistical significance while no independent effect of paternal age was found; indeed, the rates at paternal ages over 45 years appear to be nearly constant. After adjusting for the effects of parental age, a significant inverse association of birth order with incidence was noted. It also appears that the incidence among very young mothers may be high: for maternal ages 15 years and less the rates seem to be equivalent to those found at 30 or 35 years. In order to help answer the question of whether the maternal age association is the result of increasing rates of nondisjunction or of some other mechanism (for example, an age related defect in a spontaneous abortion screening mechanism), the proportion of cases due to maternal and paternal nondisjunction at different parental ages must be determined.

Adolescent↗
PubMed2026

Risk of neurodevelopmental disorders associated with paternal use of valproate during spermatogenesis: a living meta-analysis-version 1.

OBJECTIVE: To evaluate the association of paternal use of valproate during spermatogenesis compared with paternal use of lamotrigine or levetiracetam on offspring risk of neurodevelopmental disorders (NDDs). METHODS: Eligibility criteria: observational, peer-reviewed studies reporting neurodevelopmental outcomes of children exposed to paternal monotherapy use of valproate vs lamotrigine or levetiracetam during spermatogenesis. INFORMATION SOURCES: the databases PubMed, Embase, Cochrane Library and Web of Science were systematically searched from January 1995 to October 2025.Synthesis of results and risk of bias: a random-effects model was used to estimate pooled HRs and 95%&#x2009;CI, with heterogeneity assessed using I2 statistic for any NDD.We present a meta-analysis of observational, peer-reviewed studies reporting neurodevelopmental outcomes of children exposed to paternal monotherapy use of valproate versus lamotrigine or levetiracetam during spermatogenesis. Given the major regulatory implications of paternal valproate safety, the recent emergence of new population-based data, and the expectation of further large studies, we designed this work as a living systematic review and meta-analysis that will be updated as new eligible evidence becomes available. RESULTS: We identified three eligible studies based on data from (1) Norway and Sweden, (2) Norway and Taiwan and (3) Denmark. As two studies included Norwegian data, their results are referred to as 'Norway 1' and 'Norway 2' for clarity. In the meta-analysis of data from Denmark, Sweden and Norway 1, the pooled HR of offspring NDDs was 1.05 (95% CI 0.87 to 1.27; I2=0.0%), and in meta-analysis of data from Denmark, Sweden and Norway 2, it was 1.03 (95% CI 0.85 to 1.24; I2=0.0%).In the meta-analysis including Taiwan, Denmark, Sweden and Norway 1, the pooled HR was 1.06 (95% CI 0.88 to 1.27; I2=0.0%), and when including data from Taiwan, Denmark, Sweden and Norway 2, the pooled HR was 1.04 (95% CI 0.87 to 1.25; I2=0.0%). CONCLUSIONS: In this living meta-analysis, we found no evidence that paternal exposure to valproate compared with lamotrigine/levetiracetam during spermatogenesis was associated with increased risk of NDDs in offspring.

Humans↗
PubMed2001

Fertility after unilateral cryptorchidism. Paternity, time to conception, pretreatment testicular location and size, hormone and sperm parameters.

OBJECTIVE: To further evaluate whether fertility is decreased among a cohort of men with previous unilateral cryptorchidism as compared with a control group of men. SUBJECTS AND METHODS: Formerly unilateral cryptorchid men who had undergone orchiopexy between the years of 1955 and 1975 at the Children's Hospital of Pittsburgh and a control group of men who were matched for age of an unrelated surgery at the same institution were evaluated by review of medical records and by completion of a questionnaire. 359 previously cryptorchid men were identified as having attempted paternity. Of these men, 320 had information concerning preoperative testicular location and 163 for preoperative testicular size. 106 of these men had levels of testosterone, inhibin B, FSH, and LH measured, while 95 of the men had semen analyses. RESULTS: Among men who had attempted paternity, there was no statistical difference in success of paternity between the previously unilateral group (89.7%) and the control group (93.7%). There was no difference in the mean time to conception (7.1 +/- 0.7 months for the unilateral group vs. 6.9 +/- 2.3 for the control group). Within the unilateral group in regard to success at paternity, no difference was found compared with the age of orchiopexy, preoperative testicular location, or preoperative testicular size. Inhibin B levels were lower among the unilateral group. FSH, LH, testosterone, sperm density, motility and morphology were not different, but considerable variation was noted within the cryptorchid group. CONCLUSIONS: In this continued evaluation of a cohort of previously cryptorchid men who had undergone unilateral orchiopexy, paternity does not appear to be significantly compromised after unilateral cryptorchidism. Unilateral cryptorchidism appears to be one of several factors contributing to infertility, similar to those found in the general population. No correlation was found between success at paternity and the age of orchiopexy, preoperative testicular size or preoperative testicular location. Inhibin B levels were lower while FSH, LH, T and sperm parameters did not differ.

Adult↗
PubMed2003

Variation in aromatase activity in the medial preoptic area and plasma progesterone is associated with the onset of paternal behavior.

The effects of aromatase within the brain on sexual behavior have been studied in a wide variety of species. Relatively few non-mating behaviors have been considered, despite evidence that estrogen affects many social behaviors. Testosterone promotes paternal behavior in California mouse (Peromyscus californicus) fathers, acting primarily via aromatization to estradiol. Virgin male California mice rarely exhibit paternal behavior, so we investigated whether aromatase in the brain changed with the onset of paternal behavior in California mouse fathers. In the medial preoptic area (MPOA), a brain area known to regulate parental behavior in rodents, we found that fathers had significantly more aromatase activity than mated males without pups, suggesting that an increase in estrogen production in this brain area contributes to the onset of paternal behavior. We also found that progesterone (P(4)) levels were lower in fathers compared to sexually inexperienced males and that P(4) was negatively correlated with aromatase activity in the MPOA. These P(4) findings agree with a recent study that found an inhibitory effect of P(4) on paternal behavior. Overall, we found that aromatase activity and P(4) levels change in association with an important life history transition, and may provide a mechanistic basis for plasticity in paternal behavior.

Animals↗
PubMedDate not supplied

Application of DNA profiling to paternity testing during early pregnancy.

Four probes that recognize D2S44, D17S79, D4S163 and D18S27 loci, were used to produce DNA profiles of 8- to 10-week-old chorionic villus samples and from blood samples of their respective parents. A total of 30 pedigrees were analyzed. The results showed strict Mendelian inheritance. The cumulative paternity index (PI) and probability of paternity (W) obtained with D2S44, D17S79 and D4S163 loci were sufficient to exceed the required standard (PI > 369, W > 99.73) for assertion of paternity for all pedigrees tested. Therefore, these three loci are likely to satisfy the paternity test requirements in the majority of paternity cases, involving unrelated individuals, in the Chinese Han population. The other combinations of three loci did not produce high enough values for all cases, but all W values were > 98%. The results show that, using DNA from chorionic villi, these polymorphic loci can resolve cases of disputed paternity during early pregnancy.

China↗
PubMed2005

Association of paternal age at birth and the risk of breast cancer in offspring: a case control study.

BACKGROUND: Older paternal age may increase the germ cell mutation rate in the offspring. Maternal age may also mediate in utero exposure to pregnancy hormones in the offspring. To evaluate the association between paternal and maternal age at birth with the risk of breast cancer in female offspring, a case-control study was conducted in Korea. METHODS: Histologically confirmed breast cancer cases (n = 1,011) and controls (n = 1,011) with no present or previous history of cancer, matched on year of birth and menopausal status, were selected from several teaching hospitals and community in Seoul during 1995-2003. Information on paternal and maternal ages and other factors was collected by interviewed questionnaire. Odds ratio (OR) and 95% confidence interval (95% CI) were estimated by unconditional logistic regression model adjusting for family history of breast cancer in 1st or 2nd degree relatives, and lifetime estrogen exposure duration. RESULTS: The risk of breast cancer significantly increased as the paternal age increased (p for trend = 0.025). The association was stronger after controlling for maternal age; women whose fathers were aged >or=40 years at their birth had 1.6-fold increased risk of breast cancer compared with fathers aged <30 years. This association was profound in breast cancer cases in premenopausal women (OR = 1.9, 95% CI = 1.12-3.26, for paternal aged >or=40 vs. <30) (p for trend = 0.031). Although the risk of breast cancer increased as maternal age increased up to the intermediate, and then reduced; the risks in women whose mother were aged 25-29, 30-34, and >or=35 yrs at birth compared to women whose mothers were aged <25 years, were 1.2, 1.4, and 0.8, respectively, the trend was not significant (p for trend = 0.998). CONCLUSION: These findings suggest that older paternal age increases the risk of breast cancer in their female offspring.

Adult↗
PubMed2003

Paternal age and risk for schizophrenia.

BACKGROUND: Previously reported associations between advancing paternal age and schizophrenia could be due to an increase in paternal germ cell mutations or be confounded by heritable personality traits associated with schizophrenia that result in delayed parenthood. AIMS: To investigate this association while adjusting for personality traits related to poor social integration in the subjects. METHOD: A cohort of 50,087 adolescent males was followed up by record linkage to determine hospital admissions for schizophrenia between 1970 and 1996. RESULTS: Advancing paternal age was associated with an increased risk of developing schizophrenia in a 'dose-dependent' manner. The adjusted odds ratio for each 10-year increase in paternal age was 1.3 (95% CI 1.0-1.5; P=0.015). CONCLUSIONS: Advancing paternal age is an independent risk factor for schizophrenia. Adjusting for social integration in subjects made little difference to this association, consistent with the hypothesis that advancing paternal age may increase liability to schizophrenia owing to accumulating germ cell mutations.

Adolescent↗
PubMed1989

Paternity testing.

There is evidence that parentage determination was a problem even in biblical times. The most significant developments in resolving these problems occurred in the 20th century starting with Landsteiner's description of the ABO blood group system in 1900. The utility of paternity testing increased as new blood group systems were identified. Major advances occurred between 1940 and 1970, starting with the discovery of the Rh system and reaching a highpoint with the application of HLA typing to paternity studies. Although the exclusion of falsely accused alleged fathers continues as the primary focus of paternity testing, statistical analysis has contributed significantly to the information that can be gleaned from the test results when exclusion has not been demonstrated. Paternal inclusion still cannot be conclusively proven but a mathematical estimation of the likelihood of paternity has found legal acceptance. New technology is now being directed toward identifying inherited DNA markers through the use of genetic probes. Segregation of restriction fragment length polymorphisms (RFLP) may provide the near ultimate test for paternity as it may supply indisputable evidence of family relationships.

Biometry↗
PubMed2002

[Analysis of duo paternity testing].

OBJECTIVE: The study was carried out on application of 13 to 15 STR loci in duo paternity test. METHODS: The value of PE and CPE were caculated depending on the gene frequency of those STR loci in chinese population. The STR loci imcopatibilities were analyzed in 104 cases of paternity exclusion. RESULTS: CPE of 13 to 15 STR loci could reach 0.9805 to 0.9906. the RCP was over 99.73%. In 104 cases of paternity exclusion, less than 2 loci imcompetibilities were only found in two cases. CONCLUSION: There was a low risky of false paternity inclusion in duo paternity test by using of 13 STR loci. If necessary, the genetic markers should be added. The RCP of those cases without imcompatibilities could all reach paternity inclusion stardand.

Analysis of Variance↗
PubMed1990

Paternity testing: blood group systems and DNA analysis by variable number of tandem repeat markers.

Two recent paternity cases are reported. In the first case of paternity exclusion, deoxyribonucleic acid (DNA) restriction fragment length polymorphisms (RFLPs) on variable number of tandem repeat (VNTR) loci with multiple alleles were informative, as well as established systems of red blood antigens, red cell enzymes, serum proteins, and human leukocyte antigens. In the second case, in which both the alleged father and the first wife were deceased, the paternal genotype was determined by using genetic markers from the second wife and four children, which then were compared with the paternal alleles of the child in question, the plaintiff in this case. The high probability of paternity (0.999,998,7) made us conclude that the man probably was the actual father. The DNA analysis by VNTR probes appears to be quite valuable in the study of paternity cases.

Alleles↗
PubMedDate not supplied

Predictors of paternal role competence by risk status.

One hundred seventeen men whose partners had experienced a low-risk pregnancy (LRM) and 61 men whose partners had been hospitalized during pregnancy for an obstetrical risk (HRM) were studied to determine whether they differed in paternal role competence from the time of their partners' early postpartal hospitalization to 1, 4, and 8 months after birth. No differences were found between LRM and HRM in paternal role competence, and their trajectory of paternal competence did not differ. During the 1-month and 8-month postpartal period, paternal competence increased from 76.07 to 77.14 for HRM and from 77.21 to 78.29 for LRM. From 15% to 34% of the variance in paternal competence was explained among HRM, and from 41% to 44% was explained among LRM. Anxiety was the major predictor of paternal role competence for HRM, and sense of mastery and depression were major predictors for LRM.

Adolescent↗
PubMed1993

[ABO genotyping by polymerase chain reaction (PCR) and its application to paternity testing].

The authors describe the usefulness of ABO genotyping by polymerase chain reaction (PCR) in paternity testing. Blood samples were obtained from 80 unrelated Japanese (20 samples in each of phenotypes of the ABO blood group system) and 13 cases of disputed paternity. PCR amplification of DNA extracted from blood by a conventional extraction procedure was carried out using the primers (primer 1: CACCGTGGAAGGATGTCCTC; primer 2: AATGTCCACAGTCACTCGCC; primer 3: TGGAGATCCTGACTCCGCTG; primer 4: GTAGAAATCGCCCTCGTCCTT) described by Lee and Chang (J Forensic Sci, Vol. 37). The amplified DNA products using primer 1 and 2 and the amplified DNA products using primer 3 and 4 were digested with Kpn I and Alu I, respectively. The amplified and digested DNA products were then analysed by electrophoresis on polyacrylamide gels. The bands on gels stained with ethidium bromide were observed with UV light and with silver staining. In 20 samples of phenotype A, genotype AA was recognized in five samples and the others were genotype AO. In 20 samples of phenotype B, three samples were genotype BB and the others were genotype BO. According to this procedure, genotypes of phenotype AB and O were clearly and consistently confirmed. In 13 cases of disputed paternity, the paternity of six cases was excluded with some of red cell, serum protein, enzyme genetic markers and HLA systems except ABO phenotype. However, the paternity of three cases out of these six cases was excluded with ABO genotype. This study seems to support the usefulness of ABO genotyping by PCR in paternity testing.

ABO Blood-Group System↗