Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Somatic mutation”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 793 records · Page 44Linked to original sources
PubMed1992

Detection of somatic mutations in vivo in lung fibroblasts, I. Spontaneous frequencies in Chinese hamsters and F344 rats.

The frequency of mutant cells observed in a series of experiments in which primary cells were isolated from untreated or solvent control animals are reported. The mutants detected are thioguanine-resistant lung fibroblasts isolated de novo from Chinese hamsters or Fischer 344 rats. The results in the two species were very similar. The distribution of mutant colonies in cells isolated from untreated animals is not random (Poissonian) but rather shows an excess of mutant clusters. No significant difference was detected between males and females. The results provide the information necessary to define the appropriate conditions for the negative controls for a routine assay for mutations induced in vivo.

Animals↗
PubMed1994

Somatically mutated member of the human V lambda VIII gene family encodes anti-myelin-associated glycoprotein (MAG) activity.

A highly conserved small family of human V lambda genes was identified by DNA homology to a V lambda gene isolated from a patient with demyelinating peripheral neuropathy, and which encodes an autoantibody with anti-MAG activity. Comparison of the genes indicates that the patient V lambda gene was derived from one of the germline genes. Together with published analyses of other anti-MAG IgM antibodies, which also appear to be mutated in comparison to known germline V genes, these results suggest that development of these pathogenic antibodies may reflect an antigen-driven, T cell-dependent process.

Autoantibodies↗
PubMed1995

The induction of dominant somatic mutations at the Dlb-1 locus.

In the small intestine of heterozygous mice (Dlb-1b/Dlb-1a), the Dlb-1b allele results in a stainable epithelium. The mutation or loss of the dominant Dlb-1b allele in a stem cell results in a non-staining ribbon of cells on a villus of the small intestine. To determine if dominant mutations resulting in the gain of staining--the induction of a Dlb-1b-like allele--could also be detected, we examined Dlb-1a homozygous mice (SWR) 2 weeks after a single treatment with 250 mg/kg ethylnitrosourea. Mutations to the dominant allele should appear as brown ribbons on unstained villi. Such ribbons were observed in the treated group but not in controls. The mutant frequency was low compared to the frequency of Dlb-1a-like mutations reported at the Dlb-1b allele in heterozygous mice.

Animals↗
PubMed1993

Somatic mutation and memory.

The germinal center plays a crucial role in the development of the memory B cell. The repertoire of the antigen-specific B cell is shaped in this microenvironment. Self-specific B cells escaping normal regulation may develop into high affinity pathogenic Ig-producing cells.

Animals↗
PubMed2004

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.

Adult↗