Search PubMedSearch

SEARCH · Search PubMed

Results for “redundancy”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2Linked to original sources

Proviruses of avian sarcoma virus are terminally redundant, co-extensive with unintegrated linear DNA and integrated at many sites.

We have analyzed the DNA from 15 clones of avian sarcoma virus (ASV)-transformed rat cells with restriction endonucleases and molecular hybridization techniques to determine the location and structure of proviral DNA. All twenty units of proviral DNA identified in these 15 clones appear to be inserted at different sites in host DNA. In each of the ten cases that could be sufficiently well mapped, entirely different regions of cellular DNA were involved. Thus ASV DNA can be accommodated at many positions in cellular DNA, but the existence of preferred sites has not been excluded. Six of the 15 clones carry only one normal provirus, two contain two normal proviruses, and seven harbor either one or two proviruses that appear anomalous in physical mapping tests. Both ends of at least 18 proviruses, however, were found to contain sequences specific to both the 3' and 5' termini of viral RNA. The organization of these terminally redundant sequences appeared identical to that of the 300 base pair (bp) repeats found at the ends of unintegrated linear DNA (Shank et al., 1978). Proviral DNA is therefore co-extensive, or nearly co-extensive, with unintegrated linear DNA and has a structure we denote as CELL DNA-3'5'----------3'5'-CELL DNA. Three of the four anomalous proviruses which were fully analyzed were deletion mutants lacking 25--65% of the genetic content of ASV; the fourth provirus had a novel site for cleavage by Eco RI but was otherwise normal. Tests for the biological competence of proviral DNA, based upon rescue of transforming virus after fusion with chicken cells, were generally consistent with the physical mapping studies.

Avian Sarcoma Viruses

Structure of the genome of Moloney murine leukemia virus: a terminally redundant sequence.

The genome of the Moloney strain of murine leukemia virus (Mo-MuLV) has been analyzed by digestion with ribonuclease T1 and separation of the digestion products by two-dimensional gel electrophoresis. Thirty large oligonucleotides isolated from such a fingerprint have been characterized. One of these oligonucleotides (number 21) was found to be present in twice the molar yield of the rest. The 30 oligonucleotides were mapped on the genome by determining their yields in various size classes of 3' terminal fragments of Mo-MuLV RNA. The physical map obtained in this way suggested that oligonucletoide 21 was present very near the 3' end of the geome as well as in another location near or at the 5' end. The genome structure suggested by these results was confirmed by analyzing oligonucleotides in Mo-Mulv RNA complementary to strong stop DNA, which is shown to be a copy of the 5' terminal 134 nucleotides of the MoMuLV genome. Some of the oligonucleotides in the RNA protected from RNAase digestion by hybridization to this DNA, including oligonucleotide 21, were present near both the 3' and 5' ends. Comparison of these with the nucleotide sequence of strong stop DNA shows that there is a terminal redundancy of 49-60 nucleotides in the Mo-MuLV genome RNA.

Base Sequence

Redundant nutritive tubes in insect ovarioles: the fate of an extensive microtubule transport system.

The developing oocytes in the ovarioles of hemipteran insects receive materials from nutritive cells by way of channels known as nutritive tubes. The tubes contain an extensive system of microtubules which are thought to be involved in the transport between the two cell types. At the onset of vitellogenesis the connection is discontinued. Redundant nutritive tubes have been identified, compared with functional tubes, and their fate discussed.

Animals

Adaptive Evolution Reveals Metabolic Plasticity and Functional Redundancy in an Anaerobic Microbiome under Extreme Ammonia Stress.

Ammonia toxicity represents a primary biochemical bottleneck governing microbial community structure and performance during the anaerobic digestion of the organic fraction of municipal solid waste. However, the mechanistic basis of microbial adaptation to chronic ammonia levels remains poorly characterized. In this study, a long-term sequential enrichment strategy under progressively increasing ammonia concentrations (350-1500 mgN L-1), integrated with genome-centric metagenomics and metatranscriptomics, was employed to resolve the response of an organic waste-degrading microbiome over a 240 day period. Increasing ammonia pressure induced a progressive decline in methanogenesis and accumulation of volatile fatty acids, particularly acetate. Despite these inhibitory pressures, methane production was only halved relative to the initial baseline reflecting a resilient methanogenic community. This stability was driven by a restructuring of the microbiome, where functional redundancy across divergent taxa preserved core metabolic functions. Key adaptive responses included the reconfiguration of carbon fixation pathways, specifically via a variant of the Wood-Ljungdahl pathway coupled with the glycine cleavage system acting as an alternative acetate oxidation route, as well as sustained osmoprotectant biosynthesis. Cellular homeostasis was preserved through H+ replenishment via multiple energy-converting complexes and K+ influx to maintain cation-proton balance. Collectively, these findings demonstrate that metabolic plasticity and the preservation of core metabolic functions are the primary determinants of ammonia resilience, sustaining methane production under inhibitory conditions.

Ammonia

Rous sarcoma virus genome is terminally redundant: the 5' sequence.

When Rous sarcoma virus RNA is transcribed into DNA by the reverse transcriptase, a tRNA primer is elongated into DNA. The primer is near the 5' end of the virus genome; the first major DNA made is a "run-off" product extending 101 bases from the primer to the 5' end of the template. We have studied this DNA molecule to determine the sequence of the first 101 bases at the 5' end of the Rous sarcoma virus genome (Prague strain, subgroup C). Twenty-one bases at the extreme 5' end are also at the 3' end of the virus genome (see D. E. Schwartz, P. C. Zamecnik, and H. L. Weith, this issue, pp. 994-998), and thus this virus is terminally redundant. The existence of this sequence repetition immediately suggests mechanisms by which the growing DNA copy can jump from the 5' end to a 3' end of the template and become circular. The sequence also displays a possible ribosome binding site and enough secondary structure to permit a possible 5'-5' linkage of viral RNA molecules.

Avian Sarcoma Viruses

Rous sarcoma virus genome is terminally redundant: the 3' sequence.

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.

Avian Sarcoma Viruses

Reducing redundancy and enhancing accuracy through a phylogenetically-informed microbial community metabolic modeling approach.

MOTIVATION: Metabolic modeling has emerged as a powerful tool for predicting community functions. However, current modeling approaches face significant challenges in balancing the metabolic trade-offs between individual and community-level growth. In this study, we investigated the effect of metabolic relatedness among taxa on growth rate calculations by merging related taxa based on their metabolic similarity, introducing this approach as PhyloCOBRA. RESULTS: This approach enhanced the accuracy and efficiency of microbial community simulations by combining genome-scale metabolic models (GEMs) of closely related organisms, aligning with the concepts of niche differentiation and nestedness theory. To validate our approach, we implemented PhyloCOBRA within the MICOM and OptCom package (creating PhyloMICOM and PhyloOptCom, respectively), and applied it to metagenomic data from 186 individuals and four-species synthetic community (SynCom). Our results demonstrated significant improvement in the accuracy and reliability of growth rate predictions compared to the standard methods. Sensitivity analysis revealed that PhyloMICOM models were more robust to random noise, while Jaccard index calculations showed a reduction in redundancy, highlighting the enhanced specificity of the generated community models. Furthermore, PhyloMICOM reduced the computational complexity, addressing a key concern in microbial community simulations. This approach marks a significant advancement in community-scale metabolic modeling, offering a more stable, efficient, and ecologically relevant tool for simulating and understanding the intricate dynamics of microbial ecosystems. AVAILABILITY AND IMPLEMENTATION: PhyloCOBRA implementations are available as extensions to the MICOM packages and can be accessed at https://github.com/sepideh-mofidifar/PhyloCOBRA.

Phylogeny

Terminal redundancy heterozygotes involving the first-step-transfer region of the bacteriophage T5 chromosome.

Individual progeny of two-factor crosses between A1am and A2am T5 phages give rise to bursts containing more than one type of plaque. The simplest explanation for these mixed bursts is that the A1 and A2 genes are located within the terminally repeated portion of the T5 genome and that the mixed bursts are made by "terminal redundancy heterozygotes". The observation of genetic heterozygosity means that the A1 and A2 genes are repeated intact. This implies that the terminal segments of T5 are genetically interchangeable.

Aneuploidy

The redundant factor method and bladder cancer mortality.

Of the three factors, age at death, epoch of death, and epoch of birth, one seems almost superfluous. It may nevertheless be worthwhile to include all three in a mortality analysis, allowing for the constraints that the redundancy imposes. This procedure is applied to data for England and Wales on bladder cancer mortality from 1951 to 1970.

Adult

A systematic CRISPR screen reveals redundant and specific roles for Dscam1 isoform diversity in neuronal wiring.

Drosophila melanogaster Down syndrome cell adhesion molecule 1 (Dscam1) encodes 19,008 diverse ectodomain isoforms via the alternative splicing of exon 4, 6, and 9 clusters. However, whether individual isoforms or exon clusters have specific significance is unclear. Here, using phenotype-diversity correlation analysis, we reveal the redundant and specific roles of Dscam1 diversity in neuronal wiring. A series of deletion mutations were performed from the endogenous locus harboring exon 4, 6, or 9 clusters, reducing to 396 to 18,612 potential ectodomain isoforms. Of the 3 types of neurons assessed, dendrite self/non-self discrimination required a minimum number of isoforms (approximately 2,000), independent of exon clusters or isoforms. In contrast, normal axon patterning in the mushroom body and mechanosensory neurons requires many more isoforms that tend to associate with specific exon clusters or isoforms. We conclude that the role of the Dscam1 diversity in dendrite self/non-self discrimination is nonspecifically mediated by its isoform diversity. In contrast, a separate role requires variable domain- or isoform-related functions and is essential for other neurodevelopmental contexts, such as axonal growth and branching. Our findings shed new light on a general principle for the role of Dscam1 diversity in neuronal wiring.

Animals

Measuring the use of a principle by retarded adolescents and nonretarded children on a Redundancy Series Test.

A series test composed of geometric figures placed in redundant patterns was designed to measure the ability of retarded adolescents to use of principle. It was administered to institutionalized and noninstitutionalized retarded adolescents and to nonretarded children from nursery school through fourth grade. Results revealed that four of the items accounted for most of the errors and that these four critical items were particularly sensitive to an inadequate scanning strategy. The retarded groups showed a mental age lag at least 1 year, 6 months and did not perform above chance on the critical items.

Child

Children's sensitivity to intraword redundancy in spoken words.

Kindergarten, third-grade and fifth-grade children were tested on a same-different auditory discrimination task. Stimuli consisted of familiar and unfamiliar 3-letter words which were subdivided into high and low positional frequency word pairs. Analysis of correct same and different judgments supported the hypothesis that prereaders who have had normal language experiences develop sensitivities to intraword-redundancy relations. Children made significantly more correct same or different judgments when word pairs were high rather than low in summed positional frequency.

Age Factors

Increase of rDNA redundancy in bb females of Drosophila melanogaster.

The purpose of this work was to analyze the difference between males and females with respect to rDNA magnification. To study eventual rDNA variations in females aYbb chromosome was chosen since it can magnify in males but not show phenomena of rDNA dosage compensation. The authors have observed an increase of rDNA pertaining to the Ybb chromosome in females of XXNO-/Ybb genotype with respect to the same Ybb chromosome studied in XXbb+/Ybb females. This non-inheritable rDNA increase cannot be explained in terms of compensatory increase reported in X/O males nor can it fit in the magnification scheme. The possibility might be entertained that some mechanism is missing in females which cannot complete a magnification cycle. The rDNA increase that we called rDNA magnification in males occurs in the germ line and in the soma, whereas the evidence, here reported, suggest that magnification in females occurs only in the soma.

Aneuploidy