Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “redundancy”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources
PubMed2025

Redundant and Singular Regulatory Elements Underlie the Rapidly Evolving Pigmentation of Drosophila.

A major hurdle in understanding the molecular changes responsible for metazoan diversity is the characterization of cis-regulatory elements (CREs) for gene regulatory networks (GRNs). CRE changes are suspected to be commonplace in trait evolution, since such changes circumvent the deleterious effects of pleiotropy. A growing list of genes, though, is known to be regulated by redundant CREs. Such redundant CRE architectures complicate the characterization of GRN evolution, as they compound the effort to characterize each locus, and raise the questions of how and whether genes with redundant architectures evolve expression. Here, we used the evolution of sexually dimorphic abdomen pigmentation of Drosophila (D.) melanogaster as a model to study the function and evolution of CREs. Numerous sequences were evaluated that were previously predicted as potential abdomen CREs. Most of these predictions were validated, including two, four, and ten that, respectively, reside in the homothorax, grainy head, and Eip74EF transcription factor loci. The homothorax CREs were found to be partially redundant for this gene's pigmentation function, and pupal-stage Homothorax expression and the CRE activities were conserved among Drosophila species with the derived dimorphic and ancestral monomorphic phenotypes. Similarly, the Eip74EF CREs were conserved in the monomorphic D. willistoni. Thus, this gene's extensive CRE spatiotemporal redundancy has been conserved for over 30 million years, predating the dimorphic trait. Pigmentation evolution has been connected elsewhere to changes in nonredundant CREs. When these traits evolve, GRN changes may be biased towards the genes with singular nonredundant CREs, while the expression of redundantly regulated genes remains conserved.

Animals↗
PubMed2026

Brief Review: Rethinking Colonic Redundancy in Gastroenterology.

BACKGROUND: Dolichocolon (DC), or colonic redundancy, is an elongated and tortuous colon described as early as 1820, yet it remains underrecognized in clinical gastroenterology. Advances in imaging and motility assessment offer new insights into its prevalence, mechanisms, and clinical implications. AIMS: To summarize current evidence on the anatomy, epidemiology, and potential clinical significance of DC and to explore possible pathophysiological mechanisms linking this variant to gastrointestinal disorders. METHODS: A targeted literature review of studies published between 1900 and 2024 was conducted using PubMed and Scopus with search terms including dolichocolon, colonic redundancy, and redundant colon. Publications addressing anatomy, motility, symptom associations, and disease relevance were included. RESULTS: Though epidemiological data are limited, it has been estimated that DC affects 10-20% of the population and is associated with constipation, volvulus, and, possibly, inflammatory bowel disease. Proposed mechanisms include segmental stasis and ischemia in redundant loops, altered neuromuscular signaling, and increased mucosal surface area promoting immune-microbiota interactions. Despite its potential importance, DC is rarely noted in modern radiology reports, contributing to under-recognition in clinical practice. CONCLUSIONS: Colonic redundancy represents a common anatomic variant with potentially overlooked clinical implications. Standardized radiologic characterization and prospective studies are needed to clarify its role in gastrointestinal disorders and to guide future diagnostic and therapeutic approaches.

Humans↗
PubMed1977

Avian myeloblastosis virus RNA is terminally redundant: implications for the mechanism of retrovirus replication.

We have determined the terminal heteropolymeric sequences of AMV RNA by the following procedures: first, RNA sequence determination on the 5' terminal and the poly(A)-linked 3' terminal T1 oligonucleotides, and second, analysis by the Maxam and Gilbert (1977) method of AMV strong stop DNA and of DNA complementary to the poly(A)-linked T1 oligonucleotide, synthesized with reverse transcriptase and (pdT)13 as primer. The structure deduced for the 5' terminal region is (5')7mGpppGmCCAUUCUACCUCUCACCACAUUGGUGUGCACCUGGGUUGAUGGCCGGACCGUCGAUUCCCUGACGACUACGAGCACCUGCAUGAAGCAGAAGGCUUCAU... Two distinct 3' terminal sequences were deduced: GCCAUUCUACCUCUCAAA...AOH and GCCAUUCUACCUCUCACCAAA...AOH. The two termini, differing by a C-C-A sequence, may reflect genetic heterogeneity of the AMV stock or, more probably, may be generated at or after RNA transcription. These results demonstrate a terminal redundancy of the hetero polymeric sequence of 16 and 19 nucleotides, respectively. The terminal redundancy allows for mechanisms which involve transfer of the DNA segment synthesized on the 5' terminal redundant sequence to the 3' terminal redundant sequence.

Alpharetrovirus↗
PubMed1976

Sequence arrangement in herpes simplex virus type 1 DNA: identification of terminal fragments in restriction endonuclease digests and evidence for inversions in redundant and unique sequences.

It has been proposed by Sheldrick and Berthelot (1974) that the terminal sequences of herpes simplex virus type 1 (HSV-1) DNA are repeated in an internal inverted form and that the inverted redundant sequences delimit and separate two unique sequences, S and L. In this study the sequence arrangement in HSV-1 DNA has been investigated with restriction endonuclease cleavage, end-labeling studies, and molecular hybridization experiments. The terminal fragments in digests with restriction endonucleases Hind III, Hpa-1, EcoRI and Bum were identified and shown to be consistent with the Sheldrick and Berthelot model. Inverted fragments which contain unique sequences as well as redundant sequences, and which the model predicts, were identified by DNA-DNA hybridization studies. Further cleavage of Bum fragments with Hpa-1 also revealed inversions of the terminal sequences that contained unique sequences. The results obtained showed that the unique sequences S and L are relatively inverted in different DNA molecules in the population, resulting in the presence of four related genomes with rearranged sequences in apparently equal amounts. The redundant sequences bounding S do not share complete sequence homology with those bounding L, but hybridization studies are presented which show that the terminal 0.3% of the genome is repeated in every redundant sequence.

Base Sequence↗
PubMed1977

Temporal patterns, their distribution and redundancy in trains of spontaneous neuronal spike intervals of the feline hippocampus studied with a non-parametric technique.

A modification of the non-parametric technique for the analysis of temporal patterns in long trains of single neuronal spike intervals has been described and tested empiracally. The technique is based on inequality testing of sequential pairs of intervals. If the second interval in a pair is longer or shorter than or equal to the first interval, a(+), a(-), and a (0) is recorded respectively in sequential bins of the computer memory. Subsequently, the long sequences of signs are arranged into transition frequency matrices which are then converted into transition probability matrices of various complexity. In this manner, the sign permutations composed of 4, 5, 6, etc. signs were studied. First of all, the theoretical distribution of various sign permutations was derived, assuming that the arrangement of intervals that generate the signs is totally independent. The theoretical distribution of signs permutations in tetragrams, pentagrams and hexagrams constitute the 'controls' with which the empirical data can be compared. In this manner, using the chi-square test, the total deviation of a studied neuronal output from an independent state can be quantified. The empirical data showed a consistent deviation from the theoretical distribution of sign permutations during REM sleep, as compared to slow wave sleep which was characterized by an almost perfect theoretical distribution of sign permutations. This indicates that slow wave sleep is associated with relaxation of constraints that are responsible for the emergence of specific patterns. In addition, redundancies in the occurrence of sign permutations, and the linear relationships between them, have been defined and tested empirically. The apparent discrepancies between the redundancies, based on theoretical symmetry in sign distribution and the linear redundancy that fits the empirical data, have been defined and discussed.

Action Potentials↗
PubMed2026

A spatiotemporal resolution to genetic redundancy: MIR164 diversification coordinates development and metabolism in Brassica.

Whole-genome duplication (WGD) events create genetic redundancy, posing the evolutionary challenge of how paralogs escape functional overlap to drive innovation. Here, we demonstrate that the MIR164 family in Brassica oleracea resolves this redundancy through spatiotemporal niche partitioning. Following WGD, the family expanded to eight members, which subsequently underwent divergent selection-some preserved under purifying selection, while others showed signals of positive selection. This led to expression divergence, with Bol-MIR164a1 emerging as a key universally expressed paralog. CRISPR-Cas9 mutagenesis of Bol-MIR164a1 revealed its essential role in coordinating two pivotal traits: leaf serration and leaf coloration. Mutants exhibited enhanced leaf serration due to spatial deregulation of CUC2 at organ boundaries, concurrently with yellow-green leaves and elevated flavonoid accumulation. We mechanistically linked the metabolic phenotype to direct transactivation of the anthocyanidin reductase (ANR) promoter by NAC100, alongside its upregulation of chlorophyll catabolism genes. Our findings establish a paradigm in which spatial segregation of target gene expression domains enables a single, widely expressed miRNA paralog to resolve genetic redundancy by independently orchestrating distinct regulatory programs. This provides a fundamental framework for understanding complex trait evolution in polyploids. This allows a single miRNA locus to independently orchestrate both morphological patterning and metabolic programming, providing a fundamental framework for understanding complex trait evolution in polyploid crops.

MicroRNAs↗
PubMed2025

CAGEcleaner: reducing genomic redundancy in gene cluster mining.

SUMMARY: Mining homologous biosynthetic gene clusters (BGCs) typically involves searching colocalised genes against large genomic databases. However, the high degree of genomic redundancy in these databases often propagates into the resulting hit sets, complicating downstream analyses and visualization. To address this challenge, we present CAGEcleaner, a Python-based pipeline with auxiliary bash scripts designed to reduce redundancy in gene cluster hit sets by dereplicating the genomes that host these hits. CAGEcleaner integrates seamlessly with widely used gene cluster mining tools, such as cblaster and CAGECAT, enabling efficient filtering and streamlining BGC discovery workflows. AVAILABILITY AND IMPLEMENTATION: Source code and documentation is hosted at GitHub (https://github.com/LucoDevro/CAGEcleaner) and Zenodo (https://doi.org/10.5281/zenodo.14726119) under an MIT license. For accessibility, CAGEcleaner is installable from Bioconda (https://anaconda.org/bioconda/cagecleaner) and PyPi (https://pypi.org/project/cagecleaner/), and is also available as a Docker image from DockerHub (https://hub.docker.com/r/lucodevro/cagecleaner).

Software↗
PubMed2026

MCM10 and RECQL4 have cooperative and redundant roles in activating the CMG helicase during the replication initiation.

DNA replication initiation requires activation of the CMG helicase to establish the replisome. This process involves the extrusion of single-stranded DNA (ssDNA) from the central channel of MCM double hexamers, allowing the two CMG helicases to pass each other; however, the factors that mediate this process in human cells remain unclear. We show that degron-mediated depletion of either MCM10 or RECQL4 alone causes mild replication defects, whereas simultaneous depletion of both proteins severely impairs CMG activation. ChIP-seq analyses demonstrate that RECQL4 localizes to replication initiation zones (IZs) independently of MCM10, whereas MCM10 recruitment to IZs is enhanced upon RECQL4 depletion, consistent with partially redundant roles during CMG activation. Rescue experiments further indicate that RECQL4 cooperates with MCM10 through direct interaction, and that their ssDNA-binding activity underlies their functional overlap. We propose that MCM10 and RECQL4 act cooperatively and redundantly to promote CMG activation.

CMG activation↗
PubMed1978

Absence of circularly permuted and largely redundant sequences in the genome of visna virus.

A previous study of the infectivity of visna virus proviral DNA suggested that the genetic information of the virus is distributed over at least two of the RNA subunits. Because the genetic complexity of visna virus corresponds to the size of one subunit, this result may imply that sequence redundancies exist within each subunit. In the present article we have examined this question by constructing a map of the large RNase T1-resistant oligonucleotides of the viral genome. Our principal results are as follows: (i) all 36S RNA subunits have the same genetic content regardless of their polyadenylic acid [poly(A)] content; (ii) the poly(A) tract is present at the 3' end of the molecule; and (iii) the recoveries of 19 large RNase T1-resistant oligonucleotides from poly(A)-tagged RNA fragments of various sizes demonstrate that the oligonucleotides are organized in the same linear order within all subunits. Our results, therefore, exclude the existence of large sequence redundancies in the genome of visna virus.

Base Sequence↗
PubMed2021

The Murine MHC Class II Super Enhancer IA/IE-SE Contains a Functionally Redundant CTCF-Binding Component and a Novel Element Critical for Maximal Expression.

In both humans and mice, CTCF-binding elements form a series of interacting loops across the MHC class II (MHC-II) locus, and CTCF is required for maximal MHC-II gene expression. In humans, a CTCF-bound chromatin insulator termed XL9 and a super enhancer (SE) DR/DQ-SE situated in the intergenic region between HLA-DRB1 and HLA-DQA1 play critical roles in regulating MHC-II expression. In this study, we identify a similar SE, termed IA/IE-SE, located between H2-Eb1 and H2-Aa of the mouse that contains a CTCF site (C15) and a novel region of high histone H3K27 acetylation. A genetic knockout of C15 was created and its role on MHC-II expression tested on immune cells. We found that C15 deletion did not alter MHC-II expression in B cells, macrophages, and macrophages treated with IFN-γ because of functional redundancy of the remaining MHC-II CTCF sites. Surprisingly, embryonic fibroblasts derived from C15-deleted mice failed to induce MHC-II gene expression in response to IFN-γ, suggesting that at least in this developmental lineage, C15 was required. Examination of the three-dimensional interactions with C15 and the H2-Eb1 and H2-Aa promoters identified interactions within the novel region of high histone acetylation within the IA/IE-SE (termed N1) that contains a PU.1 binding site. CRISPR/Cas9 deletion of N1 altered chromatin interactions across the locus and resulted in reduced MHC-II expression. Together, these data demonstrate the functional redundancy of the MHC-II CTCF elements and identify a functionally conserved SE that is critical for maximal expression of MHC-II genes.

Animals↗
PubMed2026

An atlas of non-redundant sequences and structures of transcription factor assemblies across domains of life.

Transcription factors (TFs) regulate gene expression by controlling the recruitment of transcriptional machinery to regulatory regions of the genome. Nearly 10% of the human genome encodes TFs, making them one of the largest protein families. Despite their central roles in gene regulation, TFs are historically considered challenging therapeutic targets due to their complex interactions with DNA, RNA and associated proteins. Although recent progress in studying TFs both at molecular and structural level excels our understanding on their function, yet a universal rule decoding their recognition process remains elusive. Here, we present a curated non-redundant dataset of TFs with 3570 sequences and 377 structures. We further characterize "unique interfaces" by quantifying interface identity across interacting chains in TF assemblies. Surprisingly, our data shows that the "unique interfaces" have optimal size ranging from 2000 Å2 to 4000 Å2 irrespective of their quaternary assembly. To understand the functional diversity, we integrate sequence motifs, structural domains, subcellular localization and functional enrichment of TFs. We have also catalogued association of TFs with various human diseases. Our dataset provides a comprehensive platform to perform large scale analysis of TF-assemblies and aid in computational methods for their prediction across domains of life.

Gene regulation↗
PubMed1978

Proviruses of avian sarcoma virus are terminally redundant, co-extensive with unintegrated linear DNA and integrated at many sites.

We have analyzed the DNA from 15 clones of avian sarcoma virus (ASV)-transformed rat cells with restriction endonucleases and molecular hybridization techniques to determine the location and structure of proviral DNA. All twenty units of proviral DNA identified in these 15 clones appear to be inserted at different sites in host DNA. In each of the ten cases that could be sufficiently well mapped, entirely different regions of cellular DNA were involved. Thus ASV DNA can be accommodated at many positions in cellular DNA, but the existence of preferred sites has not been excluded. Six of the 15 clones carry only one normal provirus, two contain two normal proviruses, and seven harbor either one or two proviruses that appear anomalous in physical mapping tests. Both ends of at least 18 proviruses, however, were found to contain sequences specific to both the 3' and 5' termini of viral RNA. The organization of these terminally redundant sequences appeared identical to that of the 300 base pair (bp) repeats found at the ends of unintegrated linear DNA (Shank et al., 1978). Proviral DNA is therefore co-extensive, or nearly co-extensive, with unintegrated linear DNA and has a structure we denote as CELL DNA-3'5'----------3'5'-CELL DNA. Three of the four anomalous proviruses which were fully analyzed were deletion mutants lacking 25--65% of the genetic content of ASV; the fourth provirus had a novel site for cleavage by Eco RI but was otherwise normal. Tests for the biological competence of proviral DNA, based upon rescue of transforming virus after fusion with chicken cells, were generally consistent with the physical mapping studies.

Avian Sarcoma Viruses↗
PubMed2026

Adaptive Evolution Reveals Metabolic Plasticity and Functional Redundancy in an Anaerobic Microbiome under Extreme Ammonia Stress.

Ammonia toxicity represents a primary biochemical bottleneck governing microbial community structure and performance during the anaerobic digestion of the organic fraction of municipal solid waste. However, the mechanistic basis of microbial adaptation to chronic ammonia levels remains poorly characterized. In this study, a long-term sequential enrichment strategy under progressively increasing ammonia concentrations (350-1500 mgN L-1), integrated with genome-centric metagenomics and metatranscriptomics, was employed to resolve the response of an organic waste-degrading microbiome over a 240 day period. Increasing ammonia pressure induced a progressive decline in methanogenesis and accumulation of volatile fatty acids, particularly acetate. Despite these inhibitory pressures, methane production was only halved relative to the initial baseline reflecting a resilient methanogenic community. This stability was driven by a restructuring of the microbiome, where functional redundancy across divergent taxa preserved core metabolic functions. Key adaptive responses included the reconfiguration of carbon fixation pathways, specifically via a variant of the Wood-Ljungdahl pathway coupled with the glycine cleavage system acting as an alternative acetate oxidation route, as well as sustained osmoprotectant biosynthesis. Cellular homeostasis was preserved through H+ replenishment via multiple energy-converting complexes and K+ influx to maintain cation-proton balance. Collectively, these findings demonstrate that metabolic plasticity and the preservation of core metabolic functions are the primary determinants of ammonia resilience, sustaining methane production under inhibitory conditions.

Ammonia↗
PubMed1977

Rous sarcoma virus genome is terminally redundant: the 5' sequence.

When Rous sarcoma virus RNA is transcribed into DNA by the reverse transcriptase, a tRNA primer is elongated into DNA. The primer is near the 5' end of the virus genome; the first major DNA made is a "run-off" product extending 101 bases from the primer to the 5' end of the template. We have studied this DNA molecule to determine the sequence of the first 101 bases at the 5' end of the Rous sarcoma virus genome (Prague strain, subgroup C). Twenty-one bases at the extreme 5' end are also at the 3' end of the virus genome (see D. E. Schwartz, P. C. Zamecnik, and H. L. Weith, this issue, pp. 994-998), and thus this virus is terminally redundant. The existence of this sequence repetition immediately suggests mechanisms by which the growing DNA copy can jump from the 5' end to a 3' end of the template and become circular. The sequence also displays a possible ribosome binding site and enough secondary structure to permit a possible 5'-5' linkage of viral RNA molecules.

Avian Sarcoma Viruses↗
PubMed1977

Rous sarcoma virus genome is terminally redundant: the 3' sequence.

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.

Avian Sarcoma Viruses↗
PubMed2025

Reducing redundancy and enhancing accuracy through a phylogenetically-informed microbial community metabolic modeling approach.

MOTIVATION: Metabolic modeling has emerged as a powerful tool for predicting community functions. However, current modeling approaches face significant challenges in balancing the metabolic trade-offs between individual and community-level growth. In this study, we investigated the effect of metabolic relatedness among taxa on growth rate calculations by merging related taxa based on their metabolic similarity, introducing this approach as PhyloCOBRA. RESULTS: This approach enhanced the accuracy and efficiency of microbial community simulations by combining genome-scale metabolic models (GEMs) of closely related organisms, aligning with the concepts of niche differentiation and nestedness theory. To validate our approach, we implemented PhyloCOBRA within the MICOM and OptCom package (creating PhyloMICOM and PhyloOptCom, respectively), and applied it to metagenomic data from 186 individuals and four-species synthetic community (SynCom). Our results demonstrated significant improvement in the accuracy and reliability of growth rate predictions compared to the standard methods. Sensitivity analysis revealed that PhyloMICOM models were more robust to random noise, while Jaccard index calculations showed a reduction in redundancy, highlighting the enhanced specificity of the generated community models. Furthermore, PhyloMICOM reduced the computational complexity, addressing a key concern in microbial community simulations. This approach marks a significant advancement in community-scale metabolic modeling, offering a more stable, efficient, and ecologically relevant tool for simulating and understanding the intricate dynamics of microbial ecosystems. AVAILABILITY AND IMPLEMENTATION: PhyloCOBRA implementations are available as extensions to the MICOM packages and can be accessed at https://github.com/sepideh-mofidifar/PhyloCOBRA.

Phylogeny↗
PubMed2023

A systematic CRISPR screen reveals redundant and specific roles for Dscam1 isoform diversity in neuronal wiring.

Drosophila melanogaster Down syndrome cell adhesion molecule 1 (Dscam1) encodes 19,008 diverse ectodomain isoforms via the alternative splicing of exon 4, 6, and 9 clusters. However, whether individual isoforms or exon clusters have specific significance is unclear. Here, using phenotype-diversity correlation analysis, we reveal the redundant and specific roles of Dscam1 diversity in neuronal wiring. A series of deletion mutations were performed from the endogenous locus harboring exon 4, 6, or 9 clusters, reducing to 396 to 18,612 potential ectodomain isoforms. Of the 3 types of neurons assessed, dendrite self/non-self discrimination required a minimum number of isoforms (approximately 2,000), independent of exon clusters or isoforms. In contrast, normal axon patterning in the mushroom body and mechanosensory neurons requires many more isoforms that tend to associate with specific exon clusters or isoforms. We conclude that the role of the Dscam1 diversity in dendrite self/non-self discrimination is nonspecifically mediated by its isoform diversity. In contrast, a separate role requires variable domain- or isoform-related functions and is essential for other neurodevelopmental contexts, such as axonal growth and branching. Our findings shed new light on a general principle for the role of Dscam1 diversity in neuronal wiring.

Animals↗