Search PubMed⌕ Search

Biomedical subjects

Y Ohshima

Publications and source records attributed to Y Ohshima.

At least 199 records · Page 11Linked to original sources
PubMed1985

[Studies on sub-MIC activities of beta-lactam antibiotics and aminoglycoside antibiotics against clinically isolated strain].

Sub-MIC range of 8 kinds of beta-lactam antibiotics and 3 kinds of aminoglycoside antibiotics against strain of Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa isolated from clinical source were determined by nephlometic method, and following results were obtained. When 10 strains of S. aureus tested to ampicillin (ABPC), hetacillin (IPABPC), mecillinam (MPC), cephalexin (CEX), cefotaxime (CTX), latamoxef (LMOX), cefatrizine (CFT), cephapirin (CEPR), gentamicin (GM), dibekacin (DKB) and amikacin (AMK), ratio of MIC to MAC were 36.8, 53.6, 156.8, 29.6, 61.6, 34.4, 50.0, 111.2, 9.2, 20.0 and 13.6, respectively. When 10 strains of K. pneumoniae tested to MPC, CEX, CTX, LMOX, CFT, CEPR, GM, DKB and AMK, ratio of MIC to MAC were 409.6, 10.4, 34.4, 123.2, 39.2, 167.2, 5.2, 5.6 and 13.2, respectively. When 10 strains of P. aeruginosa tested against CTX, LMOX, GM, DKB and AMK, ratio of MIC to MAC were 16.8, 38.4, 6.8, 3.2 and 10.4, respectively.

Aminoglycosides↗
PubMed1984

Isolation of a novel antibody, which precipitates ribonucleoprotein complex containing threonine tRNA from a patient with polymyositis.

We have isolated and characterized a novel antibody from a patient with polymyositis, which precipitates threonine tRNA and an unknown small RNA molecule from 32P-labeled HeLa extract. Fingerprint analysis showed that the human threonine tRNA precipitated was nearly identical to the murine tRNA described by Harada [(1978) Seikagaku 50, 397-411]. Nucleotide analysis suggested that the other small RNA molecule might be transfer RNA. Since phenol extraction resulted in the loss of immunoprecipitability, the protein portion was presumed to be involved in the recognition of the antigen. Immunofluorescence staining of HeLa cells with the antibody clearly demonstrated that the antigen was located predominantly in the cytoplasm.

Autoantibodies↗
PubMed1984

Sequence polymorphisms in the 5'-upstream region of the fibroin H-chain gene in the silkworm, Bombyx mori.

DNA fragments containing the fibroin H-chain gene from two different strains of Bombyx mori, J-139 and Nd (2) were cloned into phage lambda Charon 4A. Comparison of the restriction sites in these cloned DNAs revealed that in addition to the known polymorphism in the region coding for the repetitive amino acid sequence of the fibroin H-chain [Manning and Gage, J. Biol. Chem. 255 (1980) 9451-9457], at least two other types of polymorphism were present, one around the 5' end of the structural gene, and the other in the far upstream region of the gene. Restriction sites around the 5' end of the gene were well conserved between these strains, but some heterogeneity, suggesting the presence of small insertions, deletions or base changes, was noted. In contrast, DNA sequences of the region 2-4 kb upstream from the 5' end of the gene were markedly different between these two strains, indicating that either a deletion or an insertion of a DNA sequence longer than 2 kb had occurred in this region. Comparison with several other strains suggested that the observed changes in the far-upstream region were unique to the Nd(2) strain.

Animals↗
PubMed1984

U1 RNA-protein complex preferentially binds to both 5' and 3' splice junction sequences in RNA or single-stranded DNA.

We have investigated factors that recognize the splice junctions for mRNA by means of a rapid and sensitive filter binding assay using chemically synthesized single-stranded (ss) DNA (16-21 nucleotides) that includes a splice junction sequence or using RNA transcribed from the DNA. When small nuclear RNA-protein complexes from HeLa cells or rat liver were separated by a DEAE-Sepharose column, U1 RNA-protein complex fractions showed strong binding to ss DNA including a 5' or 3' consensus splice junction sequence. This binding took place in the presence of a large excess of Escherichia coli denatured DNA or RNA, but it was significantly reduced when conserved G-T or A-G within the splice junction was altered. In contrast, the U2 RNA-protein complex fractions did not show significant binding. We also have prepared RNA carrying the splice junction sequence by in vitro transcription of double-stranded splice junction DNA, which was linked to the E. coli lac promoter. By using this RNA, preferential binding to both 5' and 3' splice junction sequences has been confirmed with the partially purified U1 RNA-protein complex fraction described above. When the U1 RNA-protein complex is highly purified, it always retains a strong binding activity for a 5' splice junction. The binding activity for a 3' splice junction is partly or mostly lost during purification. These results strongly suggest that the U1 RNA-protein complex and/or an associated factor participates in the recognition of both 5' and 3' splice junctions.

Animals↗
PubMed1984

Effects of fibronectin on the compact colony formation in staphylococci.

Fifty-two unencapsulated strains of Staphylococcus aureus, including strains of Wood 46 and Cowan I, formed compact colonies in fibronectin -soft agar. However, 20 encapsulated strains of Staphylococcus aureus and 50 strains of Staphylococcus epidermidis showed diffuse growth in the medium. The results suggest that another possible cellular factor, other than protein A, is involved in the binding of the cell surface with fibronectin and that it would be one of factors in forming compact colonies in serum-soft agar.

Agar↗
PubMed1984

Encapsulation and mouse-virulence of Serratia marcescens strain SM-1 and its variants in relation to colonial morphology.

With the addition to a soft-agar medium of rabbit anti-flagella serum inhibiting mobility, strain SM-1 of Serratia marcescens produced single colonies. Strain SM-1 and its variants A and B exhibited three kinds of colonial form. The parent strain showing extra large round-type growth in the medium had the highest cell volume index and mouse virulence, and a large capsule was seen on electron microscopy. An intermediate cell volume index and a remarkably lower mouse virulence were observed with variant A, which exhibited diffuse-type growth in the medium, although no definite extracellular feature was shown. The variant B, showing compact-type growth in the medium, represented the lowest cell volume index, mouse avirulence and was not encapsulated. Mouse virulence of the parent strain was assumed to be related to encapsulation which protects against phagocytosis.

Agar↗
PubMed1983

Molecular cloning and characterization of a gene for rat U2 small nuclear RNA.

Six phage clones that contain sequences hybridizable with the small nuclear RNA U2 were isolated from a rat gene library. Of these clones, one which includes a candidate for a functional U2 RNA gene was selected and characterized. The sequence within the clone which hybridizes with rat U2 RNA was completely co-linear with that of the RNA. A T-A-T-A box was not found in the region of more than 400 base-pairs which lies upstream of the gene. However, several block homologies were found with the upstream sequences of a rat U1 RNA gene candidate cloned in our laboratory. An "identifier sequence", which was reported to be an element of gene regulation related to differentiation, was found downstream of the coding region at the same distance and with the same orientation as the identifier sequence located downstream of the U1 RNA gene candidate. We detected a presumed U2 RNA precursor elongated by about 11 nucleotides at the 3' end by S1 nuclease mapping using a fragment from the clone. A potential termination signal for transcription was found within the elongated region of the presumed precursor. Southern blot analysis suggests that families of U2 RNA genes that have conserved flanking sequences are present in the genomes of rat, mouse, man, calf and chicken.

Animals↗
PubMed1983

Structural analysis of gene loci for rat U1 small nuclear RNA.

Four phage clones which hybridize with U1 small nuclear RNA were obtained from a rat gene library. Two clones contain a presumed pseudogene. A third clone includes two gene candidates that are co-linear with the rat U1-RNA, 3.6kb apart and in the opposite orientation. The two genes are surrounded by identical sequences of 491bp upstream and 178bp downstream. The upstream sequences do not contain a TATA box, but share many block homologies with those for the human U1-RNA gene(1-3). A 101bp "identifier (ID) sequence", which was reported to be specifically expressed in rat brain (4), is inserted immediately after the shared sequence downstream of one of the genes. In the fourth clone, there are two putative pseudogenes, which have one or three nucleotide changes, 3kb apart and in the same orientation. Southern blot analysis of total rat DNA reveals about 50 U1-RNA genes/pseudogenes in the genome.

Animals↗
PubMed1982

A pseudogene cluster in the leader region of the Euglena chloroplast 16S-23S rRNA genes.

The nucleotide sequence of a region (leader region) preceding the 5'-end of 16S-23S rRNA gene region of Euglena gracilis chloroplast DNA was compared with the homologous sequences that code for the 16S-23S rRNA operons of Euglena and E. coli. The leader region shows close homology in sequence to the 16S-23S rRNA gene region of Euglena (Orozco et al. (1980) J. Biol.Chem. 255, 10997-11003) as well as to the rrnD operon of E. coli, suggesting that it was derived from the 16S-23S rRNA gene region by gene duplication. It was shown that the leader region had accumulated nucleotide substitutions at an extremely rapid rate in its entirety, similar to the rate of tRNAIle pseudogene identified in the leader region. In addition, the leader region shows an unique base content which is quite distinct from those of 16S-23S rRNA gene regions of Euglena and E. coli, but again is similar to that of the tRNAIle pseudogene. The above two results strongly suggest that the leader region contains a pseudogene cluster which was derived from a gene cluster coding for the functional 16S-23S rRNA operon possibly by imperfect duplication during evolution of Euglena chloroplast DNA.

Base Sequence↗
PubMed1982

Sequence determination of rat U5 RNA using a chemical modification procedure for counteracting sequence compression.

Using post-labeling techniques, the nucleotide sequence of a major species of U5 RNA isolated from rat liver was determined to be: XpppAmUmACUCUGGUUUCUCUUCAGAUCGUAUAAAUCUUUCGmCCUUmUpsiACmNAAAGAUpsiUCCGUGGAGAGGA ACAACUCUGAGUCUUAAACCAAUUUUUUGAGGCCUUGUCUUGA(G)CAAGGCUOH. The 5'-end of the RNA is blocked with a cap structure. In addition to the modified nucleotides around the 5'-end (XpppAmUmA), U5 RNA contains Gm at position 38, Um at position 42, psi at position 44, Cm at position 46, N at position 47, and psi at position 54 as modified nucleotides. U5 RNA is present as a mixture of several species with microheterogeneity, whose lengths are 117, 118, or 119 nucleotides. The major species, with 117 nucleotides, comprised approximately 60% of the total U5 RNA. A region near the 3'-end forms a stable second structure, which causes sequence compression on electrophoresis in polyacrylamide gel. To surmount with this obstacle, we developed a chemical modification procedure with sodium bisulfite prior to partial hydrolysis in formamide, which allows denaturation of the secondary structure in polyacrylamide gel containing 7 M urea. The procedure provides a good system for checking RNA sequences determined by electrophoresis in polyacrylamide gel which might have apparent deletions on account of sequence compression.

Animals↗
PubMed1981

Nucleotide sequences of mouse genomic loci including a gene or pseudogene for U6 (4.8S) nuclear RNA.

We have isolated four clones which hybridize with U6 (4.8S) nuclear RNA, a mammalian small nuclear RNA(nRNA), from DNA of BALB/C mouse liver. Their restriction maps are totally different from each other, indicating that they derived from different loci in the mouse genome. The nucleotide sequences around the hybridizing region in the three clones have been determined. One clone gives a gene that is co-linear with the U6 RNA. There is a sequence TATAAAT beginning 31 nucleotides upstream of the gene, which may suggest that the U6 RNA is transcribed by RNA polymerase II. The other two clones contain a pseudogene for the U6 RNA which has 7 or 9 nucleotide changes from the RNA. The pseudogenes are surrounded by radically different sequences from those surrounding the gene, and they are closely linked to a pseudogene for another snRNA, 4.5S-I RNA, or a part of highly repetitive an interspersed sequence B1.

Animals↗
PubMed1981

Novel models for RNA splicing that involve a small nuclear RNA.

Nucleotide sequences of mammalian small nuclear RNAs (snRNAs) have been analyzed with a computer program for complementarity with sequences around a splice junction of various eukaryotic mRNA precursors (pre-mRNAs). A region in U2 RNA or some other snRNAs can form base pairs with both exons surrounding an intron of certain pre-mRNAs and, thereby, can align the two junctions leading to correct splicing of the pre-mRNA. These findings suggest that a snRNA such as U2 can be involved in splicing certain pre-mRNAs by pairing with exons, which we we call an "exon model" for splicing, as compared with the model involving U1 RNA presented by Lerner et al. [Lerner, M. R., Boyle, J. A., Mount, S. M., Wolin, S. L. & Steitz, J. A. (1980) Nature (London) 283, 220-224]. We constructed a secondary structure model of U1 RNA and studied the capacity of base pairing with pre-mRNAs on the basis of both primary and secondary structures of U1 RNA. We present an alternative model for splicing that involves U1 RNA, which assumes base pairing of noncontiguous regions of U1 RNA with an intron of a pre-mRNA. Pairing of an snRNA with exons could explain correct matching of the two junctions that bound one and the same intron, which is not explained by pairing with consensus sequences at the ends of an intron as proposed by Lerner et al. Pairing of an intron with U1 RNA and pairing of the surrounding exons with another snRNA such as U2 RNA could take place at the same time to insure specificity of splicing.

Animals↗