Search PubMed⌕ Search

Biomedical subjects

T Kanno

Publications and source records attributed to T Kanno.

At least 253 records · Page 14Linked to original sources
PubMed1996

[Clinical significance of serum cholinesterase concentrations determined by enzyme-linked immunosorbent assay (ELISA)].

We developed a sensitive enzyme-linked immunosorbent assay (ELISA) for measurement of the protein mass of serum cholinesterase (CHE). In our ELISA system, a combination of a monoclonal antibody (a capture antibody) and an anti-CHE rabbit antibody (a second antibody) against CHE were used for the specific determination of CHE. The formed antigen-antibody complexes were detected with an alkaline phosphatase-labeled anti-rabbit IgG antibody. Using this ELISA system, we investigated for a possible relationship between the protein mass value and the catalytic activity of serum CHE in three patients groups with different clinical findings: control subjects selected randomly from outpatients (Group A), individuals with a low serum CHE activity including genetic variants (Group B) and patients with sarin poisoning (Group C). The CHE mass value correlated closely with the CHE activity in Group A, as previously reported. In Group B, a less significant correlation than in Group A was observed because both the CHE mass value and the CHE activity were disturbed at relatively lower levels. However, no discrepant cases were observed. On the other hand, in Group C, patients with serious sarin poisoning showed significant discrepancies between the mass value and activity of CHE before medical treatments, indicating that the inhalation of sarin did not affect the protein mass level but did affect the activity of serum CHE. As the patients recovered during the treatments, their CHE activities increased to the levels expected from the regression curve obtained with Group A, whereas the mass values were almost unchanged. In conclusion, protein mass determination of serum CHE provides valuable information concerning the target value of the serum CHE activity for the treatment of patients with organophosphate insecticide poisoning as well as for investigating the specific activity of genetic variants of serum CHE.

Animals↗
PubMed1996

[CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells].

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.

Antigen-Antibody Complex↗
PubMed1995

Inhibition of neutrophil superoxide generation by hypericin, an antiretroviral agent.

We previously reported that phorbol 12-myristate 13-acetate (PMA)-induced superoxide (O2.-) generation of neutrophils was inhibited by hypericin, a photosensitizing pigment found in St. Johnswort (herb Hypericin triquetrifolium Turra), via a mechanism involving protein kinase C (PKC). To obtain further insights into the mechanism of inhibition, the effects of hypericin on stimulation-dependent O2.- generation and related enzymes of neutrophils were investigated. Hypericin inhibited O2.- generation of neutrophils induced by PKC-dependent and -independent stimuli in a light- and concentration-dependent manner. Oxygen was required for the light-dependent inhibition by hypericin. NADPH oxidase activity in a cell-free system and TNF-alpha-induced tyrosyl phosphorylation of neutrophil proteins were also inhibited by hypericin in a concentration- and light-dependent manner. However, tyrosine kinase of p60src, an enzyme not bound to a membrane, was not inhibited either in the light or in the dark. Oxygen uptake of neutrophils by photosensitization with hypericin resulted in the formation of singlet oxygen (1O2), O2.-, and hydroxyl radical (.OH) and enhanced lipid peroxidation. The formation of 1O2 was inhibited by azide, a quencher of 1O2, but not by desferrioxamine (DSF), a ferric ion chelator. By contrast, both generation of .OH and lipid peroxidation were inhibited by DSF but not by azide. Furthermore, PMA-induced O2.- generation inhibited by hypericin partially recovered in the presence of azide but not DSF. These results suggested that the light-dependent inhibition of O2.- generation by hypericin might be due to inhibition of tyrosine kinase, PKC, and NADPH oxidase via an oxygen-dependent mechanism, possibly through both Type I and II photosensitization mechanisms.

Anthracenes↗
PubMed1995

Oxygen-dependent regulation of mitochondrial energy metabolism by nitric oxide.

To elucidate the role of nitric oxide (NO) in the regulation of mitochondrial function, the effect of NO on energy transfer reactions was examined under different oxygen tensions. Mitochondrial respiration was remarkably inhibited by NO resulting in the inhibition of ATP synthesis in a concentration-dependent manner. In the presence of succinate, respiration, respiratory control by ADP, and ATP synthesis recovered completely at certain times after adding NO. The inhibitory action of NO continued significantly longer under physiologically low oxygen concentrations (such as the cytosolic level) than at high concentrations. In the presence of various substrates, such as pyruvate malate, succinate, and ascorbate tetramethyl paraphenylenediamine, NO also inhibited the uncoupled respiration in an oxygen- and concentration-dependent manner. The inhibition of respiration by NO was stoichiometrically suppressed by oxyhemoglobin. When added to a mitochondrial suspension, NO rapidly disappeared from the medium particularly at high oxygen tension. However, the rate of NO disappearance was significantly lower under low oxygen tension. Thus, under cytosolic oxygen concentration, NO might play an important role in the regulation of mitochondrial energy metabolism.

Adenosine Triphosphate↗
PubMed1995

Effect of the antiretroviral agent hypericin on rat liver mitochondria.

The photosensitizing effect of hypericin (HY), an antiretroviral agent, on the functions of isolated rat liver mitochondria has been investigated. The respiratory control ratio (RCR), ADP/O and membrane potential of mitochondria were decreased by HY in a light-dependent manner. Uncoupled respiration of mitochondria in the presence of succinate was also inhibited by HY in a light-dependent manner. The ID50 of hypericin for these inhibitions was approximately 0.5 microM. These inhibitory effects of HY were not observed when photosensitization was conducted under anaerobic conditions and were not affected by desferrioxamine (DSF) or superoxide dismutase (SOD). Upon photosensitization of HY, mitochondria consumed oxygen in the absence of respiratory substrate with concomitant formation of thiobarbituric acid reactive substance (TBARS). The amount of oxygen consumed was 100-times greater than that of TBARS formed. The oxygen uptake was partially inhibited by NaN3, and formation of TBARS was inhibited by DSF. Upon photosensitization of HY in the presence of mitochondrial membranes, the electron spin resonance (ESR) signal of 2,2-dimethyl-5-hydroxy-1-pyrrolidinyloxyl (DMPO/.OH) was increased by a mechanism which was suppressed by DSF. An ESR signal for singlet oxygen bound to 2,5-dimethylfuran, 2,2,6,6-tetramethyl-4-piperidone (TEMP) was also detected under light in the presence of mitochondria. This signal of the TEMP-N-oxyl radical (TEMPO) was decreased by azide, which physically quenches singlet oxygen, but was increased by DSF. These results indicate that HY might inhibit mitochondrial functions by a type II photodynamic mechanism but that lipid peroxidation of biological membranes through an active oxygen-mediated photodynamic mechanism is not involved.

Animals↗
PubMed1995

Evidence for the presence of function of the inhibitory M2 receptors in the rabbit airways and lungs.

We investigated to determine whether or not the inhibitory M2-receptors function in the rabbit lung and heart. Rabbits were anesthetized, vagotomized, paralyzed and ventilated. Administration of gallamine, an M2-receptor antagonist, augmented an increase of PT produced by vagal stimulation with or without simultaneous administration of histamine and the increases were dose-dependent. Conversely, prior treatment with pilocarpine, an M2-receptor agonist, reduced these responses in a dose-dependent manner. The PT responses to histamine injection only were not significantly altered by administration of either gallamine or pilocarpine. The remaining bronchoconstrictor responses to the three stimuli in the presence of gallamine or pilocarpine were completely blocked by atropine. In another series of experiments, gallamine treatment enhanced bronchoconstriction evoked by vagal stimulation but reduced acetylcholine (ACh)-induced bronchoconstriction. These opposite responses were dose-dependent for gallamine. The results suggest that there are inhibitory M2-receptors in the parasympathetic nerves innervating the lungs in the rabbit. Furthermore, gallamine treatment that completely blocked bradycardia evoked by ACh administration reduced vagally-mediated bradycardia. This implies that gallamine appears to have an antagonistic action on muscarinic receptors in the rabbit heart.

Acetylcholine↗
PubMed1995

Evidence in support of a role for human T-cell leukemia virus type I Tax in activating NF-kappa B via stimulation of signaling pathways.

The human T-cell leukemia virus type I Tax protein activates NF-kappa B transcription factors from preformed cytoplasmic pools, including those pools that are retained by the I kappa B-alpha inhibitory protein. Degradation of I kappa B-alpha is enhanced by Tax, resulting in the liberation of some NF-kappa B, which then translocates into the nucleus. Here we have investigated the mechanism by which Tax causes degradation of I kappa B-alpha. Two I kappa B-alpha mutants defective in extracellular signal-induced degradation of I kappa B-alpha also blocked Tax-mediated kappa B-dependent transactivation when cotransfected into Jurkat T cells. Cotransfected wild-type I kappa B-alpha or an irrelevant mutant did not significantly effect transactivation induced by Tax. The signal-defective I kappa B-alpha proteins are mutated at either of two closely spaced serines in the N terminus of the protein (Ser32 and Ser36). In wild-type I kappa B-alpha, one or both of these serines are inducibly phosphorylated with extracellular stimuli, and such phosphorylation appears necessary for subsequent degradation and thus activation of NF-kappa B. These results suggest that Tax triggers I kappa B-alpha degradation and thus NF-kappa B activation by a mechanism that converges with that induced by extracellular stimulation such as phorbol 12-myristate 13-acetate/ionomycin or tumor necrosis factor alpha. A role for Tax in activating signal transduction pathways upstream of I kappa B-alpha is implied.

Gene Expression Regulation↗
PubMed1995

Genetic basis of the silent phenotype of serum butyrylcholinesterase in three compound heterozygotes.

Three Japanese patients showed very low butyrylcholinesterase activity in their sera and appeared to be homozygous for silent genes for butyrylcholinesterase. From DNA analysis, all three patients were compound heterozygotes: GGA(Gly) to CGA(Arg) at codon 365 (G365R) and TTC(Phe) to TCC(Ser) at codon 418 (F418S) in patient 1, G365R and CGT(Arg) to TGT(Cys) at codon 515 (R515C) in patient 2 and ACT(Thr) to CCT(Pro) at codon 250 (T250P) and AGA(Arg) to TGA(Stop) at codon 465 (R465X) in patient 3. The K-variant, GCA(Ala) to ACA(Thr) at codon 539, was also found in patients 1 and 2. Simple identification methods for all the mutations were developed and applied to family analysis and control individuals. The mutant alleles (with silent gene and K-variant) were segregated as predicted by theory in pedigrees of patients 1 and 2. Four of the mutations, F418S, R515C, T250P and R465X, were initially discovered in Japan and genetic heterogeneity among the human population for the butyrylcholinesterase gene was suggested.

Alleles↗
PubMed1995

Light-dependent inhibition of protein kinase C and superoxide generation of neutrophils by hypericin, an antiretroviral agent.

Hypericin, a photosensitizing plant pigment, has antiretroviral activity. When exposed to light, the inhibition of Friend leukemia virus (FLV)-induced splenomegaly by hypericin was increased. The ID50 was decreased to less than 2.5 micrograms/mouse by exposure to tungsten light (29 x 10(-3) W/cm2 for 3 min). This pigment inhibited phorbol 12-myristate 13-acetate (PMA)-activated protein kinase C of rat brain in a light- and concentration-dependent manner. The ID50 of hypericin and the light intensity for inhibition of PKC were 0.1 microM under a constant light of 29 x 10(-3) W/cm2 for 3 min and 5 x 10(-3) W/cm2 in the presence of 1 microM hypericin for 3 min, respectively. The PMA-induced respiratory burst of neutrophils was inhibited in the light but stimulated in the dark by hypericin. The ID50 for inhibition of the respiratory burst was similar to that for inhibition of PKC. These results suggest that hypericin might inhibited PKC-mediated processes of intact cells, including PMA-induced superoxide generation of neutrophils by some light-dependent mechanism, and that this mechanism might underlie its light-dependent inhibition of FLV infection.

Animals↗
PubMed1995

Lactate dehydrogenase M-subunit deficiencies: clinical features, metabolic background, and genetic heterogeneities.

Lactate dehydrogenase M-subunit deficiency was first reported 1980 as an exertional myoglobinuria. Since then, 6 Japanese and 3 Caucasian families have been reported. Also, typical skin lesions were observed in 1 Japanese patient. Since then, 2 families, one Japanese and one Caucasian, have been found with this typical skin eruption. The metabolic background of exertional myoglobinuria was demonstrated as a result of the impaired reoxidation of NADH produced by glyceraldehyde-3-phosphate-dehydrogenase (G3PD) action. The excess NADH was partly reoxidized by the action of alpha-glycerophosphate dehydrogenase abundant in cytosolic fraction of skeletal muscle. This enzyme reoxidizes excess NADH simultaneously draining out triose phosphate from the glycolytic pathway. Abortive glycolysis results in impaired ATP production followed by rhabdomyolysis. Genomic analysis revealed the heterogeneities of the mutations of this disease.

Adolescent↗
PubMed1995

Evolution of Mirizzi syndrome with biliobiliary fistula.

The mechanisms of fistula formation were analyzed in eight patients with Mirizzi syndrome with biliobiliary fistula. The fistula was type 1 in three patients and type 2 in five, according to the Corlette-Bismuth classification. The apparent mechanisms of fistula formation include inflammation of the gallbladder, its subsequent fusion to the bile duct, and increase in the internal pressure due to either contraction of the gallbladder or multiple stones. However, no predisposing conditions other than a longstanding history of cholelithiasis have been suggested. Differences in the type of fistula are considered to be due to the mode of fusion of the gallbladder to the bile duct, and the size of the perforation, which is apparently determined by the area in contact with the stone.

Adult↗
PubMed1995

Carbamylcholine- and catecholamine-induced intracellular calcium dynamics of epithelial cells in mouse ileal crypts.

BACKGROUND/AIMS: The intestinal epithelium is composed of various cells, and the enteric nervous system, which controls the epithelial functions, has different neurotransmitters and/or modulators. The aim of this study was to show whether the responses of intestinal epithelial cells to different neurotransmitters are elicited throughout the entire epithelium or are restricted to a certain cell. METHODS: The spatiotemporal dynamics of cytosolic calcium ion ([Ca2+]c) were measured by digital imaging analysis in isolated crypts of mouse ileum loaded with [1-[2-(5'-carboxyoxazol-2'-yl)-6-amino-benzofuran-5- oxy]-2-(2'-amino-5'-methylphenoxy)-ethane-N,N,N',N'-tetraacetic acid] pentakis (acetoxylmethyl) ester. Thereafter, the crypt cells were identified morphologically. RESULTS: Carbamylcholine elicited [Ca2+]c dynamics in Paneth cells, showing a biphasic increase, but neither cholecystokinin octapeptide nor nicotine had any effect on the [Ca2+]c of the crypt cells including the Paneth cells. Adrenaline and noradrenaline, but not isoproterenol, induced a transient elevation of [Ca2+]c of some enterochromaffin cells. Increases in the [Ca2+]c of most crypt cells were elicited by thapsigargin. Propagation of a [Ca2+]c wave in the crypts was not evident. CONCLUSIONS: Increases in [Ca2+]c can be induced by carbamylcholine in Paneth cells and catecholamines in some enterochromaffin cells. The digital imaging analysis showed the heterogeneity of the responses of intestinal crypt cells to different transmitters.

Animals↗
PubMed1995

Anterior cranial base reconstruction using a hydroxyapatite-tricalciumphosphate composite (Ceratite) as a bone substitute.

The craniofacial approach to cranial base tumors has widened the operability of tumors with intracranial invasion. However, the resulting skull base defect must be reconstructed adequately to prevent postoperative morbidity and mortality. We use hydroxyapatite-tricalciumphosphate ceramic (Ceratite) as a bone substitute material to reconstruct the skull base defect in combination with the pericranial flap, ensuring separation between the sinonasal cavity and epidural cavity. Although the nasal surface of the Ceratite block is left exposed directly to the sinonasal cavity, it was shown to be epithelialized within 6 months postoperatively. Our method is less invasive than any other conventional method and may offer more chance of curative resection of tumors with anterior skull base invasion.

Adenocarcinoma↗
PubMed1995

Usefulness of simulation of surgical approaches to cerebral aneurysms by helical scanning CT (HES-CT).

Using multiplanar reconstruction (MPR) CT imaging method, virtual views of various surgical approaches were compared preoperatively. With this technique, not only virtual surgical views of aneurysms and related vasculature, but also surgical views after virtual resection of skull base bone to a desirable extent are freely available. We operated four aneurysm cases after comparing various surgical approaches by this imaging method. It was found that these preoperative simulated images were very useful at surgery of complicated aneurysm cases.

Adult↗
PubMed1995

Surgical pitfalls in pinealoma surgery.

The author has treated 30 cases of pinealoma by the infratentorial supracerebellar approach with the patient in the sitting position. Long-term outcome has been excellent in 26 cases, poor in 1, and death in 3 cases. Postoperative deaths were due to: (i) high venous pressure in the jugular vein caused by a tourniquet placed around the neck to prevent air-embolism, making hemostasis more difficulty, (ii) the absence of retraction resulting in a narrow surgical field when acute brain swelling developed, and (iii) high coagulation and ablation of the precentral cerebellar vein causing diffusion thrombosis of deep veins. The details of these cases are presented in this article.

Adolescent↗
PubMed1995

Identification of the location of antigenic sites of swine vesicular disease virus with neutralization-resistant mutants.

Neutralization sites on swine vesicular disease virus (SVDV) have been identified by sequence analysis of neutralization-resistant mutants. Eight neutralizing monoclonal antibodies (MAbs) were produced and neutralization-resistant mutants were selected with the MAbs. Resistance of the mutants to neutralization was shown using the stab-neutralization method, and the results indicated the presence of five neutralization sites on the virus. The location of each site was identified from amino acid changes resulting from nucleotide substitutions in the mutants, and designated site 1 (residues 87 and 88 of VP1), 2a (residue 163 of VP2), 2b (residue 154 of VP2), 3a (residue 272 and 275 of VP1, 60 of VP3) and 3b (residues 70 and 233 of VP2, 73 and 76 of VP3). The locations of the amino acids substitutions at each site formed a cluster on a computer-simulated three-dimensional model of SVDV and were exposed to the surface of the virion.

Amino Acids↗
PubMed1995

Intracellular Ca2+ dynamics and in vitro secretory response in acute pancreatitis induced by a choline-deficient, ethionine-supplemented diet in mice.

In order to approach impaired stimulus-secretion coupling in acute pancreatitis induced by a choline-deficient, ethionine-supplemented (CDE) diet in mice, the agonist-evoked intracellular Ca2+ dynamics of dispersed pancreatic acini were evaluated by microspectrofluorometry. Mice were fed a CDE diet for 24 or 48 h, and the pancreas was dispersed to the acini. The in vitro amylase secretion analysis of the CDE groups demonstrated a poor dose-response curve which was significantly lower (p < 0.01) when 100 pM cholecystokinin (CCK) was administered. Both in CDE and control groups, the application of a physiological dose of CCK-8 (10 pM) evoked intracellular Ca2+ oscillations. Periodicity and amplitude of the oscillations in the CDE groups were not significantly different. The administration of a higher dose of CCK-8 (100 pM) evoked a large, sharp, and transient rise in intracellular Ca2+, followed by a small, continuous increase above basal levels for the duration of stimulation both in CDE and control groups. The peak Ca2+ level was lower in the CDE groups, but this was not statistically significant. In conclusion, during the early phase (from 24 to 48 h) of CDE pancreatitis, the pattern of agonist-evoked intracellular Ca2+ release is less affected. Other mechanisms subsequent to the onset of intracellular Ca2+ release are likely to be involved in the inhibition of enzyme secretion.

Acute Disease↗