Search PubMed⌕ Search

Biomedical subjects

Satoshi Mori

Publications and source records attributed to Satoshi Mori.

At least 55 records · Page 3Linked to original sources
PubMed2003

ZmYS1 functions as a proton-coupled symporter for phytosiderophore- and nicotianamine-chelated metals.

Among higher plants graminaceous species have the unique ability to efficiently acquire iron from alkaline soils with low iron solubility by secreting phytosiderophores, which are hexadentate metal chelators with high affinity for Fe(III). Iron(III)-phytosiderophores are subsequently taken up by roots via YS1 transporters, that belong to the OPT oligopeptide transporter family. Despite its physiological importance at alkaline pH, uptake of Fe-phytosiderophores into roots of wild-type maize plants was greater at acidic pH and sensitive to the proton uncoupler CCCP. To access the mechanism of Fe-phytosiderophore acquisition, ZmYS1 was expressed in an iron uptake-defective yeast mutant and in Xenopus oocytes, where ZmYS1-dependent Fe-phytosiderophore transport was stimulated at acidic pH and sensitive to CCCP. Electrophysiological analysis in oocytes demonstrated that Fephytosiderophore transport depends on proton cotransport and on the membrane potential, which allows ZmYS1-mediated transport even at alkaline pH. We further investigated substrate specificity and observed that ZmYS1 complemented the growth defect of the zinc uptake-defective yeast mutant zap1 and transported various phytosiderophore-bound metals into oocytes, including zinc, copper, nickel, and, at a lower rate, also manganese and cadmium. Unexpectedly, ZmYS1 also transported Ni(II), Fe(II), and Fe(III) complexes with nicotianamine, a structural analog of phytosiderophores, which has been shown to act as an intracellular metal chelator in all higher plants. Our results show that ZmYS1 encodes a proton-coupled broad-range metal-phytosiderophore transporter that additionally transports Fe- and Ni-nicotianamine. These biochemical properties indicate a novel role of YS1 transporters for heavy metal homeostasis in plants.

Animals↗
PubMed2003

Conductivity and field effect transistor of La2@C80 metallofullerene.

We first demonstrate a field-effect-transistor operation of dimetallofullerene La2@C80 with the icosahedral cage symmetry. The thin-film device showed an n-type behavior with a mobility of 1.1 x 10-4 cm2/V s at room temperature under high vacuum. Taking the nature of LUMO into account, the n-type behavior indicates an occurrence of carrier conduction through encapsulated La ions. The low mobility, suggesting an intermolecular hopping mechanism, is ascribed to the intrinsic and extrinsic reasons, which are discussed in the text.

Journal Article↗
PubMed2003

Temporal progressive antigen expression in radial glia after contusive spinal cord injury in adult rats.

In the development of the CNS, radial glial cells are among the first cells derived from neuroepithelial cells. Recent studies have reported that radial glia possess properties of neural stem cells. We analyzed the antigen expression and distribution of radial glia after spinal cord injury (SCI). Sprague-Dawley rats had a laminectomy at Th11-12, and spinal cord contusion was created by compression with 30 g of force for 10 min. In the injury group, rats were examined at 24 h and 1, 4, and 12 weeks after injury. Frozen sections of 20-microm thickness were prepared from regions 5 and 10 mm rostral and caudal to the injury epicenter. Immunohistochemical staining was performed using antibodies to 3CB2 (a specific marker for radial glia), nestin, and glial fibrillary acidic protein (GFAP). At 1 week after injury, radial glia that bound anti-3CB2 MAb had spread throughout the white matter from below the pial surface. From 4 weeks after injury, 3CB2 expression was also observed in the gray matter around the central canal, and was especially strong around the ependymal cells and around blood vessels. In double-immunohistochemical assays for 3CB2 and GFAP or 3CB2 and nestin, coexpression was observed in subpial structures that extended into the white matter as arborizing processes and around blood vessels in the gray matter. The present study demonstrated the emergence of radial glia after SCI in adult mammals. Radial glia derived from subpial astrocytes most likely play an important role in neural repair and regeneration after SCI.

Animals↗
PubMed2003

Evidence that electron-dense bodies in Cyanidium caldarium have an iron-storage role.

The acidophilic and thermophilic unicellular red alga, Cyanidium caldarium (Tilden) Geitler, is widely distributed in acidic hot springs. Observation by transmission electron microscopy (TEM) showed that algae grown in Allen's medium contained electron-dense bodies with diameters from 100 to 200 nm. Electron dispersive x-ray analysis indicated that the electron-dense bodies contained high levels of iron, phosphorous, and oxygen; P/Fe ratios were from 1.3 to 2.0. The electron spin resonance (ESR) spectrum of the intact C. caldarium cells showed an isotropic signal at a g value of 2.00. Density-gradient centrifugation of the cell lysate yielded a fraction that included substances showing the isotropic ESR signal. EDTA treatment of this fraction reduced the ESR signal intensity, whereas it increased a signal that is typical of Fe(III)-EDTA. The fact that the isotropic signal dominates the ESR spectrum, together with a previous finding that iron is confined to the electron-dense bodies, led us to conclude that iron in the electron-dense bodies accounts for the isotropic ESR signal. Since the intensity of the ESR signal depends on the amount of iron in the cells, the electron-dense bodies are probably iron storage sites.

Electron Spin Resonance Spectroscopy↗
PubMed2003

Three rice nicotianamine synthase genes, OsNAS1, OsNAS2, and OsNAS3 are expressed in cells involved in long-distance transport of iron and differentially regulated by iron.

Nicotianamine (NA), a chelator of metals, is ubiquitously present in higher plants. In graminaceous plants, NA is a biosynthetic precursor of phytosiderophores and is thus a crucial component for iron (Fe) acquisition. Here, we show that three rice NA synthase (NAS) genes, OsNAS1, OsNAS2, and OsNAS3 are expressed in cells involved in long-distance transport of Fe and that the three genes are differentially regulated by Fe. OsNAS1 and OsNAS2 transcripts were detected in Fe-sufficient roots but not in leaves, and levels of both increased markedly in both roots and leaves in response to Fe deficiency. In contrast, the OsNAS3 transcript was present in leaves but was very low in roots of Fe-sufficient plants. Further, OsNAS3 expression was induced in roots but was suppressed in leaves in response to Fe deficiency. Promoter-GUS analysis revealed that OsNAS1 and OsNAS2 were expressed in Fe-sufficient roots in companion cells and pericycle cells adjacent to the protoxylem. With Fe deficiency, OsNAS1 and OsNAS2 expression extended to all root cells along with an increase in phytosiderophore secretion. In Fe-deficient plants, OsNAS1 and OsNAS2 were expressed in the vascular bundles of green leaves and in all cells of leaves showing severe chlorosis. OsNAS3 expression was restricted to the pericycle and companion cells of the roots, and in companion cells of leaves irrespective of Fe status. These results strongly suggested that NAS and NA play an important role in long-distance transport of Fe in rice plants, in addition to their roles in phytosiderophore secretion from roots.

Alkyl and Aryl Transferases↗
PubMed2003

Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants.

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between -272 and -91 from the translational start site (-272/-91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at -153/-136 (ATCAAGCATGCTTCTTGC) and IDE2 at -262/-236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the -46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the -90/+8 region of the CaMV 35S promoter was fused, the -272/-227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.

Base Sequence↗
PubMed2003

Three nicotianamine synthase genes isolated from maize are differentially regulated by iron nutritional status.

Nicotianamine synthase (NAS) is an enzyme that is critical for the biosynthesis of the mugineic acid family of phytosiderophores in graminaceous plants, and for the homeostasis of metal ions in nongraminaceous plants. We isolated one genomic NAS clone, ZmNAS3, and two cDNA NAS clones, ZmNAS1 and ZmNAS2, from maize (Zea mays cv Alice). In agreement with the increased secretion of phytosiderophores with Fe deficiency, ZmNAS1 and ZmNAS2 were positively expressed only in Fe-deficient roots. In contrast, ZmNAS3 was expressed under Fe-sufficient conditions, and was negatively regulated by Fe deficiency. This is the first report describing down-regulation of NAS gene expression in response to Fe deficiency in plants, shedding light on the role of nicotianamine in graminaceous plants, other than as a precursor in phytosiderophore production. ZmNAS1-green fluorescent protein (sGFP) and ZmNAS2-sGFP were localized at spots in the cytoplasm of onion (Allium cepa) epidermal cells, whereas ZmNAS3-sGFP was distributed throughout the cytoplasm of these cells. ZmNAS1 and ZmNAS3 showed NAS activity in vitro, whereas ZmNAS2 showed none. Due to its duplicated structure, ZmNAS2 was much larger (65.8 kD) than ZmNAS1, ZmNAS3, and previously characterized NAS proteins (30-38 kD) from other plant species. We reveal that maize has two types of NAS proteins based on their expression pattern and subcellular localization.

Alkyl and Aryl Transferases↗
PubMed2003

Post-translational modification of betaH-crystallin of bovine lens with aging.

This study investigates post-translational modification of proteins of bovine lens with aging (3 year old vs. 6 month old cows). After water-soluble proteins were submitted to gel and ion exchange chromatography, betaH-crystallin, a subunit of beta-crystallin, and modified materials were isolated. These materials were then submitted to two dimensional polyacrylamide gel electrophoresis (2D-SDS PAGE) to detect and isolate the new spots. Results for lens proteins from 3 year old animals were compared to those from 6 month old animals. All spots were digested in gel with trypsin and the molecular masses of tryptic digests were measured by matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOFMS). Peptides peaks obtained from mass mapping were identified using the protein database of the MS-Fit program in the Protein prospector program of the University of California, San Francisco. We found that two post translational modifications of betaH-crystallin, acetylation and phosphorylation occurred with aging.

Acetylation↗
PubMed2003

Long-term treatment of incadronate disodium accumulates microdamage but improves the trabecular bone microarchitecture in dog vertebra.

This study aimed to investigate the effect of long-term suppression of bone resorption by bisphosphonate on the microstructure, accumulation of microdamage, and mechanical properties of trabecular bone. Twenty-nine 1-year-old beagles (15 males, 14 females) were divided into three groups. The control group (CNT) was treated daily with vehicle, and the other two groups were treated with incadronate at a dose of 0.3 mg/kg/day (LOW) or 0.6 mg/kg/day (HIGH) orally for 3 years. After death, the second thoracic vertebra was scanned with microcomputed tomography (micro-CT) and assigned to histomorphometric and microdamage measurements. The fourth lumbar vertebra was mechanically tested by compression. Incadronate concentration in bone was measured in the 11th thoracic vertebra. Micro-CT analysis demonstrated a platelike trabecular structure and increased concave surface of trabeculae in the thoracic vertebra of incadronate-treated groups. Three-year incadronate treatment significantly suppressed trabecular activation rates by 56% in LOW and 67% in HIGH without impairment of mineralization, and increased microdamage accumulation in both incadronate-treated groups. Trabecular bone volume was significantly increased in both LOW and HIGH groups, and vertebral strength was significantly increased in the HIGH group compared with the CNT group. However, intrinsic material properties such as normalized ultimate stress and normalized toughness were reduced in incadronate-treated groups. Incadronate concentration in bone was dose-dependent. This study suggests that long-term suppression of bone remodeling increases microdamage accumulation, but this is not necessarily associated with vertebral fragility because of compensated increase of bone mass and improved microarchitecture.

Animals↗
PubMed2003

Role of nicotianamine in the intracellular delivery of metals and plant reproductive development.

Nicotianamine (NA), a chelator of metals, is ubiquitously present in higher plants. Nicotianamine aminotransferase (NAAT) catalyzes the amino group transfer of NA in the biosynthetic pathway of phytosiderophores and is essential for iron acquisition in graminaceous plants. The gene that encodes NAAT from barley was introduced into the nongraminaceous plant tobacco, which produces NA but not phytosiderophores. Transgenic tobacco plants (naat tobacco) that constitutively expressed the NAAT gene had young leaves with interveinal chlorosis and flowers that were abnormally shaped and sterile. Endogenous NA was consumed as a result of NAAT overproduction in naat tobacco. The resulting NA shortage caused disorders in internal metal transport, leading to these abnormal phenotypes. In addition to its role in long-distance metal transport, NA may be involved in the regulation of metal transfer within the cells. These results suggest that a shortage of NA impaired the functions of metal-requiring proteins, including transcription factors.

Alkyl and Aryl Transferases↗
PubMed2003

Enhanced expression of PP1gamma1, a catalytic subunit isoform of protein phosphatase type1 and expression of telomerase activity in Ewing's sarcoma cells.

We previously reported that PP1gamma1 is highly expressed in osteosarcoma and chondrosarcoma, and suggested that this protein plays a role in malignancy of osteogenic tumors. In this study, we investigated the correlation of the expression of PP1gamma1 with telomerase activity. PP2A protein was not positive in any of the 5 cases of Ewing's sarcoma, but PP1gamma1 protein was strongly positive in all cases. Furthermore, malignant cells had high telomerase activity. We investigated the correlation of the expression of PP1gamma1 with telomerase activity, and showed that telomerase activity is regulated by protein phosphorylation in Ewing's sarcoma cells.

Chondrosarcoma↗
PubMed2002

Novel iron-storage particles may play a role in aluminum tolerance of Cyanidium caldarium.

Cyanidium caldarium (Tilden) Geitler, a unicellular red alga, has extraordinarily high aluminum (Al) tolerance. Algal cells cultured in the presence or absence of Al were subjected to transmission electron microscopy and energy dispersive X-ray analysis. Substantial changes to the thylakoid lumens were observed for the algal cells cultured in medium containing 200 mM Al, while other organelles were largely unaffected. Several spherical electron-dense bodies were found in the cytoplasm near the nucleus of both of the control and Al-treated cells. Although high levels of Fe and P were found in the bodies of control cells, immunocytochemical and morphological analysis data did not match the criteria established for Fe-accumulating substances like ferritin and phytate. In addition to these elements, Al was found in the bodies of the Al-treated cells. These results suggest that the electron-dense bodies function as an Fe-storage site under normal culture conditions, and that sequestration of Al in these bodies contributes to the high Al tolerance exhibited by C. caldarium.

Aluminum↗
PubMed2002

cDNA microarray analysis of gene expression during Fe-deficiency stress in barley suggests that polar transport of vesicles is implicated in phytosiderophore secretion in Fe-deficient barley roots.

To acquire Fe from soil, graminaceous plants secrete mugineic acid family phytosiderophores (MAs) from their roots. The secretion of MAs increases in response to Fe deficiency, and shows a distinct diurnal rhythm. We used a microarray that included 8987 cDNAs of rice EST clones to examine gene expression profiles in barley roots during Fe-deficiency stress. Approximately 200 clones were identified as Fe-deficiency-inducible genes, of which seven had been identified previously. In order to meet the increased demand for methionine to produce MAs, Fe-deficiency enhances the expression of genes that participate in methionine synthesis, as well as recycling methionine through the Yang cycle. Of these 200 genes, approximately 50 exhibited different transcription levels in Fe-deficient roots at noon and at night. Northern blot analysis of time course experiments confirmed that five of these genes exhibited a diurnal change in their level of expression. The diurnal changes in the expression of these genes suggest that polar vesicle transport is involved in the diurnal secretion of MAs.

Azetidinecarboxylic Acid↗
PubMed2002

IDI7, a new iron-regulated ABC transporter from barley roots, localizes to the tonoplast.

A new Fe-deficiency-induced cDNA, IDI7, was isolated from the roots of Fe-deficient barley (Hordeum vulgare L. cv. Ehimehadaka no. 1). The transcript levels of IDI7 in roots strongly correlated with iron nutritional status, and induction by Fe-deficiency was restricted to roots. Excess treatment with heavy metal ions, such as copper, manganese, and zinc, did not cause obvious IDI7 induction in either leaves or roots. IDI7 encodes a 644 amino acid protein, and has features typical of ATP-binding cassette (ABC) transporters. Phylogenetic analysis revealed that IDI7 is closely related to the half-type ABC protein subfamily, which includes mammalian transporters associated with antigen processing (TAPs). A transiently expressed fusion protein of IDI7 to green fluorescent protein (GFP) was localized to tonoplasts in suspension-cultured tobacco (Nicotiana tabacum L.) cells. IDI7 and its orthologues are thought to comprise a new class of ABC transporters, located in the tonoplasts of higher plants. A possible Fe-deficiency adaptation role for IDI7 in barley root cells, involving transport across the tonoplast, is proposed.

ATP-Binding Cassette Transporters↗
PubMed2002

Cloning an iron-regulated metal transporter from rice.

Rice cDNA and genomic libraries were screened in order to clone an Fe(II) transporter gene. A cDNA clone highly homologous to the Arabidopsis Fe(II) transporter gene IRT1 was isolated from Fe-deficient rice roots. The cDNA clone was named OsIRT1. A genomic clone corresponding to the cDNA was also obtained, sequenced and analysed. When expressed in yeast cells, OsIRT1 cDNA reversed the growth defects of the yeast iron-uptake mutant. Northern blot analysis revealed that OsIRT1 mRNA was predominantly expressed in roots and was induced by Fe- and Cu-deficiency. This suggests that OsIRT1 is a functional metal transporter for iron, and is actively engaged in Fe uptake from soils, especially under limiting conditions.

Amino Acid Sequence↗
PubMed2002

Raloxifene, estrogen, and alendronate affect the processes of fracture repair differently in ovariectomized rats.

We investigated the effects of inhibitors of bone resorption (estrogen, raloxifene, and alendronate) on the processes of fracture repair in ovariectomized (OVX) rats. One hundred forty female Sprague-Dawley rats at 3 months of age were either OVX or sham-operated and divided into five groups: sham control, OVX control, estrogen (17alpha-ethynyl estradiol [EE2], 0.1 mg/kg), raloxifene (Rlx, 1.0 mg/kg), and alendronate (Aln, 0.01 mg/kg) groups. Treatment began immediately after the surgery. Four weeks postovariectomy, prefracture controls were killed and bilateral osteotomies were performed on the femoral midshafts and fixed with intramedullary wires. Treatment was continued and fracture calluses were excised at 6 weeks and 16 weeks postfracture for evaluation by X-ray radiography, quantitative computed tomography (QCT,) biomechanical testing, and histomorphometry. At 6 weeks postfracture, Aln and OVX had larger calluses than other groups. Sham and OVX had higher ultimate load than EE2 and Rlx, with Aln not different from either control. Aln calluses also contained more mineral (bone mineral content [BMC]) than all other groups. By 16 weeks postfracture, OVX calluses were smaller than at 6 weeks and the dimensions for Aln had not changed. Aln had higher BMC and ultimate load than OVX, EE2, and Rlx. EE2 and Rlx had similar biomechanical properties, which were similar to sham. Interestingly, OVX and Aln animals were heavier than other groups at all time points; therefore, ultimate load was normalized by body weight to show no significant differences in strength of the whole callus between groups at either 6 weeks or 16 weeks postfracture. However, Aln strongly suppressed remodeling of the callus, resulting in the highest content of woven bone, persistent visibility of the original fracture line, and lowest content of lamellar bone, compared with other groups. Therefore, the larger Aln callus appeared to be a remarkable, morphological adaptation to secure the fracture with inferior material. In conclusion, OVX-stimulated bone turnover resulted in the fastest progression of fracture repair that was most delayed with Aln treatment, consistent with marked suppression of bone resorption and formation activity. Estrogen and Rlx had similar effects that were generally similar to sham, indicating that mild suppression of bone turnover with these agents has insignificant effects on the progression of fracture repair.

Alendronate↗