Search PubMed⌕ Search

Biomedical subjects

S Schmitt

Publications and source records attributed to S Schmitt.

At least 19 recordsLinked to original sources
PubMed2004

Progress in functional neuroanatomy: precise automatic geometric reconstruction of neuronal morphology from confocal image stacks.

Dendritic architecture provides the structural substrate for myriads of input and output synapses in the brain and for the integration of presynaptic inputs. Understanding mechanisms of evolution and development of neuronal shape and its respective function is thus a formidable problem in neuroscience. A fundamental prerequisite for finding answers is a precise quantitative analysis of neuronal structure in situ and in vivo. Therefore we have developed a tool set for automatic geometric reconstruction of neuronal architecture from stacks of confocal images. It provides exact midlines, diameters, surfaces, volumes, and branch point locations and allows analysis of labeled molecule distribution along neuronal surfaces as well as direct export into modeling software. We show the high accuracy of geometric reconstruction and the analysis of putative input synapse distribution throughout entire dendritic trees from in situ light microscopy preparations as a possible application. The binary version of the reconstruction module is downloadable at no cost.

Animals↗
PubMed2004

The effect of moisture absorption on the fatigue crack propagation resistance of acrylic bone cement.

In vivo, bone cement is subject to cyclic loading in a fluid environment. However, little is known about the effect of moisture absorption on the fatigue crack propagation resistance of bone cement. The effect of moisture absorption at 37 degrees C on the fatigue crack propagation resistance of a common bone cement (Endurance, DePuy, Orthopaedics, Inc.) was examined. Preliminary fracture toughness tests were conducted on disk-shaped, vacuum-mixed cement specimens (compact tension type) that were cyclically pre-cracked. Plain-strain fracture toughness K(IC) (MPa square root(m)) was determined. To study the effect of moisture absorption four treatment groups, with different soaking periods in Ringer's at 37 degrees C, of Endurance cement were tested. The specimens weights prior to and following soaking showed a significant increase in mean weight for specimens soaked for 8 and 12 weeks. Linear regression analysis of log(da/dN) vs. log (deltaK) was conducted on the combined data in each fatigue test group. Soaking bone cement in Ringer's at 37 degrees C for 8 and 12 weeks lead to an improvement in fatigue crack propagation resistance, that may be related to water sorption that increases polymer chain mobility, with enhanced crack tip blunting. It may be more physiologically relevant to conduct in vitro studies of fatigue and fracture toughness of bone cements following storage in a fluid environment.

Absorption↗
PubMed2002

Bovine tuberculosis in Michigan wildlife.

White-tailed deer in Michigan are now recognized as a reservoir host of bovine tuberculosis (TB). It has been determined that the most likely cause of bovine TB infection in the deer is from congregating in artificially high numbers at feed sites. The presence of a wildlife reservoir of TB in Michigan poses a serious threat to the control and eradication programs that are now in their final stages in the United States.

Animals↗
PubMed2001

Contrast-enhanced three-dimensional MR angiography of the thoracic aorta: experiences after 118 examinations with a standard dose contrast administration and different injection protocols.

The aim of this study was to test three injection protocols for contrast-enhanced magnetic resonance angiography (MRA) of the thoracic aorta with a standard-dose application. Ninety-three patients with a total of 118 examinations underwent MRA of the thoracic aorta at 1.5 T. There were three injection protocols: in 24 cases, no test bolus was performed and contrast was injected manually; in 14 cases, contrast was injected manually after a test bolus; and in 80 cases, a MR-compatible injector was used after a timing examination. All patients received 20 ml of Gd-DTPA. Quantitative signal-to-noise (SNR) measurements were obtained at different locations in the thoracic aorta, the pulmonary arteries, and the superior vena cava. Two readers in conference retrospectively evaluated each examination with respect to overall image quality and quality of bolus timing. Bolus timing was considered optimal in 70 cases, and either too early or too late in 11 cases. In 37 examinations the bolus was broadened. The SNR measurements of the thoracic aorta revealed that examinations after bolus testing were significantly superior to examinations without a test bolus (p < 0.001). Signal intensity ratios of the aorta and the pulmonary trunk were significantly higher in examinations with an optimal contrast timing (p < 0.001). Magnetic resonance angiograms of the thoracic aorta with a timing run are significantly superior to non-timed examinations with respect to image quality and SNRs. The administration of 20 ml of Gd-DTPA is sufficient for adult patients.

Adolescent↗
PubMed2000

Genomic structure, chromosomal localization, and expression pattern of the human LIM-homeobox3 (LHX 3) gene.

Lhx3 is a LIM-homeobox protein essential for pituitary development in mice. The human homologue gene spans 7.2 kb and contains 7 exons, including two alternatively spliced first exons. This structure encodes two distinct protein isoforms, LHX3a and LHX3b, that differ exclusively in their amino-terminus. The LHX3 gene was localized at 9q34.2-34.3. The predicted protein sequence is highly homologous to other known Lhx3 proteins, the highest degree of homology being in the conserved domains. The highest expression of LHX3 was found in pituitary gland, spinal cord, and lung. Among different pituitary cell types, corticotrophs appear to express preferentially LHX3b isoform, suggesting a distinct role of the b-form in the development of this cell lineage. Although the human LHX3 gene structure would provide a ground for clarification of the molecular basis of complete anterior pituitary deficiency, we were unable to identify any mutation in the LHX3 gene of 46 such patients.

Alternative Splicing↗
PubMed2000

Is travel distance a barrier to veterans' use of VA hospitals for medical surgical care?

Lengthy travel distances may explain why relatively few veterans in the United States use VA hospitals for inpatient medical/surgical care. We used two approaches to distinguish the effect of distance on VA use from other factors such as access to alternatives and veterans' characteristics. The first approach describes how disparities in travel distance to the VA are related to other characteristics of geographic areas. The second approach involved a multivariate analysis of VA use in postal zip code areas (ZCAs). We used several sources of data to estimate the number of veterans who had priority access to the VA so that use rates could be estimated. Access to hospitals was characterized by estimated travel distance to inpatient providers that typically serve each ZCA. The results demonstrate that travel distance to the VA is variable, with veterans in rural areas traveling much farther for VA care than veterans in areas of high population density. However, Medicare recipients also travel farther in areas of low population density. In some areas veterans must travel lengthy distances for VA care because VA hospitals which were built over the past few decades are not located close to areas in which veterans reside in the 1990s. The disparities in travel distance suggest inequitable access to the VA. Use of the VA decreases with increases in travel distance only up to about 15 miles, after which use is relatively insensitive to further increases in distance. The multivariate analyses indicate that those over 65 are less sensitive to distance than younger veterans, even though those over 65 are Medicare eligible and therefore have inexpensive access to alternatives. The results suggest that proximity to a VA hospital is only one of many factors determining VA use. Further research is indicated to develop an appropriate response to the needs of the small but apparently dedicated group of VA users who are traveling very long distances to obtain VA care.

Aged↗
PubMed2000

Pathological angioarchitecture in lymph nodes: underlying histopathologic findings.

Pathologic changes of the intranodal angioarchitecture, as displayed by colour Doppler sonography, were used in recent studies to predict malignant infiltration of superficial lymph nodes. We searched for the underlying histopathologic findings in a prospective study including 100 lymph nodes in 86 patients. In the histopathologic specimens, we evaluated tumour infiltration, distribution of intranodal vessels, hilar structures, thickness of the capsule and tissue alterations (necrosis, sclerosis, lipo-/fibromatosis). Using the only prospectively tested classification, a pathologic angioarchitecture was described as displacement, aberrant course, avascular foci or subcapsular vessels. Testing these four criteria by multivariate regression analysis, the most important correlations were found between the following pairs of sonographic and histopathologic findings: displacement with perinodal tumour spread, aberrant vessels with intranodal sclerosis, avascular foci with intranodal necroses and subcapsular vessels with intranodal necroses. In conclusion, the criteria describing a pathologic angioarchitecture correlate with histopathologic findings that are frequently seen in malignant lymph nodes.

Adolescent↗
PubMed2000

High prevalence of diarrhea but infrequency of documented Clostridium difficile in autologous peripheral blood progenitor cell transplant recipients.

Autologous peripheral blood progenitor cell (PBPC) transplant recipients frequently receive multiple antibiotics for neutropenic fever in addition to high-dose chemotherapy. Although there are many possible causes for diarrhea in this population, empiric therapy for possible C. difficile colitis is common in some centers. This study sought to define the frequency of diarrhea and of a positive C. difficile toxin assay in PBPC transplant recipients. Data were collected on 80 patients enrolled in a randomized trial of two different antibiotic regimens during PBPC transplant. Data included the presence or absence of diarrhea, all microbiologic studies performed during the transplant admission, and all antimicrobials administered during the transplant admission. Of 80 patients enrolled, 61 (76.3%) developed diarrhea. Only 3/61 (4.9%) had a positive C. difficile toxin assay. A total of 122 C. difficile toxin assays were performed; for each positive C. difficile assay, 41 stool samples were analyzed. Twenty courses of oral metronidazole (18/20 empiric) and 10 courses of oral vancomycin (8/10 empiric) were given. A total of 25 of 61 patients with diarrhea (41%) received therapy for possible C. difficile. Diarrhea is common during autologous PBPC transplant but a positive C. difficile assay is uncommon. The practice of empiric therapy for C. difficile in this population in a non-outbreak setting should be re-evaluated. Bone Marrow Transplantation (2000) 25, 67-69.

Administration, Oral↗
PubMed2000

Mapping of immunodominant B-cell epitopes and the human serum albumin-binding site in natural hepatitis B virus surface antigen of defined genosubtype.

Twelve MAbs were generated by immunization of BALB/c mice with plasma-derived hepatitis B virus surface spherical antigen particles subtype ayw2 (HBsAg/ayw2 genotype D). Their epitopes were mapped by analysis of reactivity with plasma-derived HBsAg/ayw2 and HBsAg/adw2 (genotype A) in enzyme immunoassays and blots. Mapping was supported by nested sets of truncated preS2 proteins and preS2 peptides. Five antibodies were S domain-specific, seven were preS2-specific and 11 had a preference for genotype D. According to our data, group I of the three known epitope groups of preS2 has to be divided into IA and IB. Three preS2-specific MAbs forming the new group IA reacted with genotype D residues 3-15 which have not yet been described as an epitope region. IA antibodies strongly inhibited the binding of polymerized human serum albumin. Two antibodies (group II) reacted with the glycosylated N-terminal region of preS2 in plasma-derived HBsAg, but not with a preparation from transfected murine cells. One group III antibody was subtype-specific and reacted with the highly variable preS2 sequence 38-48. Only one antibody (group IB) mapped to the region (old group I) which was believed to be immunodominant and genotype-independent. Geno(sub)type-specific epitopes of preS2 are obviously the immunodominant components of natural HBsAg in BALB/c mice, but these epitopes may be masked by serum albumins in humans. The data may explain why it is difficult to detect anti-preS2 antibodies in human recipients of preS2-containing vaccines, in spite of the preS2 immunodominance in mice.

Amino Acid Sequence↗
PubMed1999

Analysis of the pre-S2 N- and O-linked glycans of the M surface protein from human hepatitis B virus.

The surface antigen of hepatitis B virus comprises a nested set of small (S), middle (M), and large (L) proteins, all of which are partially glycosylated in their S domains. The pre-S2 domain, present only in M and L proteins, is further N-glycosylated at Asn-4 exclusively in the M protein. Since the pre-S2 N-glycan appears to play a crucial role in the secretion of viral particles, the M protein may be considered as a potential target for antiviral therapy. For characterization of the pre-S2 glycosylation, pre-S2 (glyco)peptides were released from native, patient-derived hepatitis B virus subviral particles by tryptic digestion, separated from remaining particles, purified by reversed-phase high performance liquid chromatography, and identified by amino acid and N-terminal sequence analysis as well as matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS). Pre-S2 N-glycans were characterized by anion exchange chromatography, methylation analysis, and on target sequential exoglycosidase digestions in combination with MALDI-TOF-MS, demonstrating the presence of partially sialylated diantennary complex-type oligosaccharides. In addition, the pre-S2 domain of M protein, but not that of L protein, was found to be partially O-glycosylated by a Gal(beta1-3)GalNAcalpha-, Neu5Ac(alpha2-3)Gal(beta1-3)GalNAcalpha-, or GalNAcalpha-residue. The respective O-glycosylation site was assigned to Thr-37 by digestion with carboxypeptidases in combination with MALDI-TOF-MS and by quadrupole time-of-flight electrospray mass spectrometry. Analytical data further revealed that about 90% of M protein is N-terminally acetylated.

Amino Acid Sequence↗
PubMed1999

Structural analysis of glycoconjugates by on-target enzymatic digestion and MALDI-TOF-MS.

Exoglycosidase digestion combined with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) has been demonstrated to be an effective method for the structural characterization of glycoconjugates and oligosaccharides in picomolar amounts. A sample preparation method is described, in which 6-aza-2-thiothymine (ATT) in water is used as matrix and enzymes are dialyzed before use against a low concentration of volatile buffer such as ammonium acetate. Under these conditions, a series of sequential on-target exoglycosidase treatments was carried out in one single analyte spot in the presence of ATT matrix. Subsequent mass spectrometric analysis of the resulting products yielded information on both the completeness of the reaction and structural features of the glycoconjugates such as monosaccharide sequence, branching pattern, and anomeric configurations of the corresponding glycosidic linkages. The results show that all exoglycosidases used retain their activity in the presence of ATT matrix. Hence, structural analysis of carbohydrates or mixtures thereof can be performed very fast, without intermediate desalting steps or sample splitting. This approach is illustrated by the analysis of underivatized glycans, oligosaccharide derivatives, glycopeptides, and glycolipids. Depending on the analyte, amounts of sample required could be limited to a few picomoles.

Acetates↗
PubMed1999

An opinion survey of reported benefits from the use of stereolithographic models.

PURPOSE: The aim of the study was to determine the possible benefits from 3-dimensional epoxy stereolithographic (SL) models produced from computed tomography (CT) and magnetic resonance imaging (MRI) data. MATERIALS AND METHODS: Surgeon's opinions about the use of SL models for diagnosis, treatment planning, practicing surgery preoperatively, within the operating room during surgical procedures, and for the construction of custom titanium implants or surgical devices were tabulated, using a 2-page survey. RESULTS: Most of the surgeons found SL models useful in all phases of planning and implementation of surgical procedures. Sixty-five percent found that exposure to the SL model changed the way in which they approached the patient's surgery. They also determined that there was a median timesavings of 20% in expended operating room and anesthesia time. Sixty-two percent of surgeons believed the models were important for proper diagnosis. CONCLUSIONS: Most surgeons using 3-dimensional epoxy SL models for surgical procedures found them beneficial for diagnosis, treatment planning, as a reference during surgery, and in the fabrication of custom implants and surgical devices that afforded surgical solutions previously not available. Patients were believed to have received better care, because the surgeons had more knowledge of their unique anatomy before surgery. Through the use of these models, the patients experienced shorter surgical procedures, with more predictable results.

Attitude of Health Personnel↗
PubMed1999

Growth inhibition and antimetastatic effect of antisense poly-DNP-RNA on human breast cancer cells.

The RNase-resistant and membrane-permeable antisense poly-2'-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNA) against RIalpha subunit of protein kinase A (RIalpha/PKA) has been used to inhibit the growth of human breast cancer MDA-MB-231 cells in vitro and in vivo. This antisense poly-DNP-RNA, with oligonucleotide sequence GGGCGUGCCUCCUCACUGGC, was found to be an effective concentration-dependent inhibitor of MDA-MB-231 cell line, whereas the control poly-DNP-RNAs with either random or sense sequence were found completely inactive. In situ hybridization studies showed that this antisense inhibitor can permeate spontaneously into MDA-MB-231 cells and distribute itself throughout the cytoplasm. Intraperitoneal administration of this antisense RIalpha poly-DNP-RNA to SCID mice with transplanted MDA-MB-231 cells was found to inhibit the growth of the xenografts in a concentration-dependent way, prevent metastasis, and drastically reduce mortality.

Animals↗
PubMed1998

Planning the transition to a comprehensive implant rehabilitation: a case report--Part I.

When the edentulous condition has existed for many years, extensive ridge resorption may complicate the ability to function with a conventional prosthesis. Implant therapy in conjunction with bone augmentation procedures may provide new options for the predictable restoration of the edentulous state. However, complex implant reconstruction may place considerable stress on the patient's ability to function throughout therapy. Providing stable interim prostheses and smooth transitions between procedures may alleviate the problem. This can be accomplished only with extensive diagnosis, treatment planning, and the judicious use of transitional prostheses. The first part of this case report focuses on the planning stages of a complex implant dental rehabilitation.

Aged↗
PubMed1998

Structure and glycosylation patterns of surface proteins from woodchuck hepatitis virus.

Woodchucks chronically infected with woodchuck hepatitis virus (WHV) are a valuable model for human hepatitis B virus (HBV) in studies of pathogenesis, immunity, and antiviral therapy. For this reason, substantial efforts to characterize both the similarities and the differences between HBV and WHV are being made. The structure of the WHV surface proteins (WHs proteins) has not yet been adequately elucidated. The bands that would be expected for glycosylated and nonglycosylated small (S) WHs protein are found by sodium dodecyl sulfate gel electrophoresis of purified WHs protein, but the bands corresponding to the middle (M) and large (L) WHs proteins of HBV are not seen at the expected sizes, even though the sequences of the WHV and HBV surface protein genes are 60% homologous. By amino-terminal sequencing we have identified two bands at 41 and 45 kDa as the MWHs proteins, 8 kDa larger than expected. We have also confirmed that two bands at 24 and 27 kDa are SWHs proteins. A protein of 49 kDa was blocked at the N terminus, which using immunoblotting with an antiserum against WHV pre-S1 (positions 126 to 146) was identified, together with a part of the 45-kDa protein, as glycosylated and nonglycosylated LWHs protein of the expected size. Sialidase and O-glycosidase digestion showed that the larger size of MWHs protein results from the presence of O glycoside groups which are probably in the pre-S2 domain of MWHs protein. Since the pre-S2 domains of HBV and WHV have similar numbers of potential O glycosylation sites, it appears to be likely that the glycosyltransferases act differently on the viral proteins in woodchucks and humans.

Amino Acid Sequence↗
PubMed1998

[Which contraceptive methods are recommended for young women with type 1 diabetes mellitus? A survey among practitioners in Germany].

AIM: The aim of this study was to find out which recommendations German gynecologists gave to young patients with type 1 diabetes mellitus in respect to contraception. In addition, it was asked to what extent German gynecologists/obstetricians had experience regarding counselling of young women with type 1 diabetes. SUBJECTS AND METHODS: A structured questionnaire containing questions about attitudes, health care beliefs and contraception in young women with type 1 diabetes was developed. 804 attendees of the Giessen Gynecological Seminar which was held in January 1997 were asked to participate in the study. RESULTS: Only 142 (17.7%) of the questionnaires were returned. There was no consensus in respect to contraception in young women with diabetes. 61% of the respondents referred to the micropill (< 0.3 mg estrogen) as the preferred contraceptive method for young women with diabetes. Condoms were regarded as second line contraceptive devices in this age and patient group. There was only very limited experience in regard to counselling and treating adolescents/young women with type 1 diabetes. CONCLUSION: Among the German gynecologists questioned there was no consensus in respect to contraception in young women with diabetes. Most importantly, there was only very limited individual experience in regard to counselling and treating adolescents/young women with type 1 diabetes among the doctors who participated in the study.

Adolescent↗
PubMed1997

Two separable T cell receptor signals reconstitute positive selection of CD4 lineage T cells in vivo.

Positive selection is an obligatory step during intrathymic T cell differentiation. It is associated with rescue of short-lived, self major histocompatibility complex (MHC)-restricted thymocytes from programmed cell death, CD4/CD8 T cell lineage commitment, and induction of lineage-specific differentiation programs. T cell receptor (TCR) signaling during positive selection can be closely mimicked by targeting TCR on immature thymocytes to cortical epithelial cells in situ via hybrid antibodies. We show that selection of CD4 T cell lineage cells in mice deficient for MHC class I and MHC class II expression can be reconstituted in vivo by two separable T cell receptor signaling steps, whereas a single TCR signal leads only to induction of short-lived CD4+CD8lo intermediates. These intermediates remain susceptible to a second TCR signal for 12-48 h providing an estimate for the duration of positive selection in situ. While both TCR signals induce differentiation steps, only the second one confers long-term survival on immature thymocytes. In further support of the two-step model of positive selection we provide evidence that CD4 T cell lineage cells rescued by a single hybrid antibody pulse in MHC class II-deficient mice are pre-selected by MHC class I.

Animals↗