Search PubMed⌕ Search

Biomedical subjects

S Li

Publications and source records attributed to S Li.

At least 1,405 records · Page 78Linked to original sources
PubMed1995

[Posterior chamber intraocular lens implantation in filtered glaucoma eyes].

PURPOSE: To investigate the method of cataract extraction with posterior chamber intraocular lens implantation in eyes that had undergone glaucoma filtering surgery and its effect on filtering bleb. METHODS: Extracapsular cataract extraction with posterior chamber intraocular lens implantation was performed in 21 eyes with a preexisting filtration bleb, in which a lateral and inferior lateral limbal incison was selected, the pupil sphinctor was cut and the iris was sew for the small and fixed pupil. RESULTS: the postoperative visual acuity of all patients was improved in different degrees, with 0.5 or better in 76.19% of the eyes. The postoperative IOP increased by 0.41 kPa. The functional filtering bleb was not apparently cicatrized. CONCLUSIONS: Filtered glaucoma eyes with cataract can improve visual acuity and maintain the functional filtered bleb by extracapsular cataract extraction with posterior chamber intraocular lens implantation with lateral or inferior lateral limbal incision.

Aged↗
PubMed1995

[Detection of herpes viral genome in corneal buttons of quiescet herpes simplex keratitis with polymerase chain reaction].

PURPOSE: Herpetic keratitis is one of the major cause of blindness. The recent reports have proposed that the herpetic viruses may persist in cornea but provided noconclusive evidence. This study is to determine whether the cornea is another latent site of herpes simplex virus. METHODS: 18 corneal buttons of patients with quiescent herpes simplex keratitis which had quited for at least three months (mean 3.7 years) and were obtained by corneal transplantation were detected using polymerase chain reaction (PCR). The sequences of the primers are: P15'CATCACCGACCCGGAGAGGGAC, P25'GGGCCAGGCGCTTGTTGGTGTA. RESULTS: The positive HSV DNA were found in 17 corneal buttons out of 18 cases. CONCLUSION: The HSV genomes are present in the cornea of quiescent herpetic keratitis, which suggest that the cornea may be another latent site of herpetic virus. The PCR is a simple, specific and sensitive way to detect HSV genomes in cornea.

Adolescent↗
PubMed1995

[Effect of homoharringtonine on lens epithelial cells in rabbits].

PURPOSE: To study the effects of Homoharringtonine (Hh) on lens epithelial cells (LEC) in rabbits for the possibility of preventing or treating the development of after cataract. METHODS: Lens epithelial cells from the right eyes of 9 New Zealand Albino rabbits were processed for light microscope and transmission electronic microscope 30 minutes, 3 days and 60 days after phacoemulsification by the use of Hh (20 micrograms/ ml) in balanced salt solution (BSS) as irrigating solution. LEC from the left eyes of the same rabbits served as controls after phacoemulsification by the use of BSS. Clinical examinations were also performed in all eyes before and after the surgery. RESULTS: Hh as irrigating solution during phacoemulsification had antiproliferative effects on LEC 3 days postoperatively, the Hh treated eyes developed less LEC proliferation than the controls. Though the development of after cataract formation (Soemmering ring) could not be prevented in both Hh treated eyes and controls 60 days after phacoemulsification, the ultrastructural study of LEC from the Hh treated eyes indicated some changes of cytoplasm such as vacuolation of organelles. CONCLUSION: It is suggested that increasing the concentration of Hh in irrigating solution for phacoemulsification and prolonging the existence of Hh in aqueous humor may have more effects on the inhibition of the proliferation of LEC. From the results of this preliminary study a pharmacological means of prevention and treatment of after cataract may be indicated.

Animals↗
PubMed1995

[Study on human gamma-crystallins: V. Non-enzymatic glycation of fetal lens gamma 1- and gamma 3-crystallins in vitro].

PURPOSE: To compare the non-enzymatic glycation of different human fetal gamma-crystallins induced by glucose and fructose. METHODS: gamma 1- and gamma 2-crystallin were separated by the Sephadex gel chromatography from human fetal lenses. The non-enzymatic glycations of these gamma-crystallins were conducted by incubating with glucose or fructose at 37 degrees C for 20 days. The opacity and pellet formation as well as changes on SDS-polyacrymide gel electrophoresis (SDS-PAGE) pattern and blue fluorescence production were observed. RESULTS: Although the two gamma-crystallins displayed similar alterations, gamma 1-crystallin was easier to produce aggregation and insolublization in early stage (i.e. 3 days). SDS-PAGE showed that there were aggregates, formed through disulfide and non-disulfide cross-links, and degraded peptides produced. The blue fluorescence increased in glycated gamma 3-crystalline solution. Fructose had more significant effects (i.e. aggregation, degradation, producing blue fluorescence) on gamma-crystallins as compared with glucose. CONCLUSION: Human fetal gamma 1- and gamma 3-crystallins are sensitive, at different extent (gamma 1 > gamma 3), to response to non-enzymatic glycation, and fructose has stronger effect than glucose on the glycation.

Crystallins↗
PubMed1995

[Reduction of induced corneal astigmatism after IOL implantation by small incision technique].

PURPOSE: To investigate the effect of incision length on corneal astigmatism after intraocular lens implantation. METHODS: The change of induced corneal astigmatism was observed in 36 patients underwent phacoemusification cataract extraction with intraocular lens implantation through a 6.5 mm limbal incision comparing with that in extracapsular cataract extraction with intraocular lens implantation through a 11 mm limbal incision. RESULTS: The surgically induced astigmatism in 1 week, 1.3 and 6 months after the operation was 2.13 +/- 1.41, 1.58 +/- 1.07, 0.92 +/- 0.75 and 0.77 +/- 0.55D in 6.5 mm limbal incision group while that was 4.63 +/- 1.39, 3.08 +/- 1.11, 2.52 +/- 0.89 and 2.04 +/- 0.87 in 11 mm incision group, the difference in the same postoperative period was significant (P < 0.05). At 1 week and 1 month postoperatively, 52.8% and 61.41% of 6.5 mm limbal incision cases had uncorrected visual acuity of 0.5 or better compared with 28.6% and 37.1% of 11 mm incision cases (P < 0.05). There was no difference of the uncorrected visual acuity 6 months after the surgery between the two groups. CONCLUSION: Reducing incision can minimize surgically induced astigmatism and promote early postoperative visual rehabilitation.

Aged↗
PubMed1994

Mitogenicity and transforming activity of the insulin-like growth factor-I receptor with mutations in the tyrosine kinase domain.

We have investigated the effect of mutations in tyrosines 1131, 1135, and 1136 of the human insulin-like growth factor-I receptor (IGF-IR) on the growth and transformation of mammalian cells. We have used for this purpose R- cells, which are 3T3-like fibroblasts derived from mouse embryos with a targeted disruption of the IGF-IR genes. These cells have no IGF-IR, do not grow in serum-free medium supplemented with the growth factors that sustain the growth of 3T3 cells, and cannot be transformed by simian virus 40 large tumor antigen or other oncogenes. The R- cells were transfected with plasmids expressing: 1) a wild type human IGF-IR cDNA; 2) a receptor with a triple mutation in the above mentioned tyrosines; and 3) receptors with single tyrosine mutations. Cells expressing the wild type or the single tyrosine mutants Y1 (Y1131F) and Y2 (Y1135F) grew in serum-free medium supplemented solely with IGF-I. Cells expressing the triple tyrosine mutant YF or the single mutant Y3 (Y1136F) failed to grow in response to IGF-I only. All mutants, though, failed to form colonies in soft agar, indicating that a fully functional IGF-IR is more critical for anchorage-independent growth than for monolayer growth. The triple mutant expression plasmid also functioned as a dominant negative, inhibiting the growth of wild type cells transformed by the simian virus tumor antigen.

3T3 Cells↗
PubMed1994

Influenza and vaccinia viruses expressing malaria CD8+ T and B cell epitopes. Comparison of their immunogenicity and capacity to induce protective immunity.

We compared the effectiveness of several recombinant influenza and vaccinia viruses to induce a malaria-specific immune response. The CD8+ T cell epitope of the circumsporozoite (CS) protein of Plasmodium yoelii, a rodent malaria parasite, was expressed in two distinct influenza virus proteins, the hemagglutinin and the neuraminidase. These recombinant viruses were found to be equally efficient at inducing CS-specific CD8+ T cells in mice. A third recombinant virus, which expresses a B cell epitope of the CS protein, induced neutralizing anti-sporozoite Abs. Expression in the same recombinant virus of the CD8+ T cell epitope and of the B cell epitope did not impair the capacity of this recombinant virus to induce malaria-specific CD8+ T cells and neutralizing Abs. The immunogenicity of a vaccinia virus, expressing the entire CS protein, was compared with that of a highly attenuated vaccinia strain expressing the same protein and with that of another vaccinia virus expressing only the CD8+ T cell epitope. All three vaccinia virus recombinants elicited CS-specific CD8+ cells and a potent inhibitory response against pre-erythrocytic stages of malaria parasites. Optimal levels of anti-sporozoite Abs, inhibition of liver stage development, and protection against malaria infection resulted from repeatedly immunizing the animals with recombinant influenza viruses followed by boosters with a recombinant vaccinia virus. These findings support the concept that live viral vectors expressing the appropriate proteins and/or epitopes can be used as promising vaccine candidates.

Amino Acid Sequence↗
PubMed1994

Vasoactive intestinal peptide-receptor imaging for the localization of intestinal adenocarcinomas and endocrine tumors.

BACKGROUND: Intestinal adenocarcinomas and various endocrine tumors express large numbers of high-affinity receptors for vasoactive intestinal peptide (VIP). We have evaluated the usefulness of scanning with VIP labeled with iodine-123 for tumor localization in patients with gastrointestinal tumors. METHODS: Radioiodinated VIP was purified by high-pressure liquid chromatography and administered as a single intravenous bolus injection (300 pmol [1 microgram]). Scanning with radiolabeled VIP was compared with computed tomography and scanning with somatostatin analogues in 79 patients with colorectal cancer, pancreatic carcinoma, gastric cancer, carcinoid tumor, or insulinoma. RESULTS: Visualization of gastrointestinal tumors and metastases was obtained with radiolabeled VIP. Binding of the labeled peptide by primary tumors and metastases was visible shortly after the injection and was still demonstrable at 24 hours. In patients with colorectal adenocarcinomas, primary or recurrent tumors were visualized in 10 of 10, liver metastases in 15 of 18, lung metastases in 2 of 3, and lymph-node metastases in 4 of 4. Primary pancreatic adenocarcinomas were visualized by imaging in 10 of 12 patients, and liver metastases were seen in 7 of 7. Primary or recurrent gastric adenocarcinomas were visualized in 5 of 5 patients, and liver metastases were seen in 2 of 2 patients. VIP scans were positive in 9 of 10 patients with carcinoid tumors and in 4 of 4 patients with insulinomas. Some tumors with positive VIP scans were also visualized with somatostatin analogues (4 of 17 colorectal adenocarcinomas, 8 of 9 carcinoids, and 2 of 2 insulinomas). In vitro binding studies confirmed the presence of VIP receptors on gastrointestinal tumors. CONCLUSIONS: Scanning with radiolabeled VIP can visualize intestinal tumors and metastases that express receptors for VIP.

Adenocarcinoma↗
PubMed1994

Calorimetric studies and molecular mechanics simulations of monounsaturated phosphatidylethanolamine bilayers.

This investigation was designed to determine how information about the lipid chain melting and structural characteristics of sn-1 saturated/sn-2 monounsaturated phosphatidylethanolamines, a subclass of naturally occurring phospholipids, can be generalized among these lipid molecules. Specifically, 30 molecular species of sn-1 saturated/sn-2 unsaturated monoenoic phosphatidylethanolamines were semi-synthesized. The phase transition behavior of these monoenoic lipids in excess water was studied calorimetrically. The computer-based molecular mechanics approach was used to simulate the energy-minimized structures and to calculate steric energies for the diglyceride moieties of some of the 30 monoenoic lipid molecules, at T < Tm, in various aggregated states. These combined calorimetric and computational studies led to the following results and conclusions. 1) For a homologous series of monoenoic lipids with a common molecular weight and with a cis-double bond at various positions along the sn-2 acyl chain, the characteristic reduction of the main phase transition temperature (Tm) is proposed to be a result of an entropy-driven phenomenon. 2) The maximal decrease in the Tm for bilayers prepared from four series of monoenoic phosphatidylethanolamines containing a sn-2 octadecenoyl chain is shown by interpolation of calorimetric data to occur uniquely when the cis double bond is located commonly between C(10) and C(11) positions from the carboxyl end. 3) Monoenoic phosphatidylethanolamines can be divided into two groups. The Tm values obtained with bilayers of monoenoic lipids within each group can be systematically correlated with their structural parameters, leading to the derivation of two general Tm-structure relationships.

Calorimetry, Differential Scanning↗
PubMed1994

On the main phase transition temperatures of highly asymmetric mixed-chain phosphatidylcholines.

The highly asymmetric mixed-chain phosphatidylcholines or C(X):C(Y)PC, which can self-assemble at T < Tm into the mixed interdigitated gel-state bilayer in excess water, can be divided into two groups. Group I consists of C(X):C(Y)PC with X > Y, and Group II consists of C(X):C(Y)PC with X < Y. The main phase transition temperatures (Tm) of these C(X):C(Y)PC have been analyzed in terms of two structural parameters (delta and Nf). Specifically, these structural parameters are related to the packing geometry of the lipid's acyl chains as the lipid molecules are packed either in a mixed (delta) or a hypothetically partially (Nf) interdigitated packing motif at T < Tm. Based on 28 and 29 Tm values of Group I and II C(X):C(Y)PC, two general equations are derived, respectively, by multiple regression analyses. These equations correlate systematically the Tm values of Group I and II phosphatidylcholines with their corresponding structural parameters. Using these two derived equations, the Tm values of a total of 92 molecular species of C(X):C(Y)PC are generated, and these calculated Tm values can be considered as the reliably predicted Tm values for highly asymmetric C(X):C(Y)PC which have delta C/CL values within the range of 0.42-0.66.

Calorimetry, Differential Scanning↗
PubMed1994

Distribution of FMR-1 and associated microsatellite alleles in a normal Chinese population.

The CGG repeat size distribution of the fragile X mental retardation gene (FMR-1) was studied in a population of normal Chinese X chromosomes along with that of two proximal microsatellite polymorphic markers: FRAXAC1 and DXS548. The most common CGG repeat allele was 29 (47.2%) with 30 being second most common (26%). This distribution was different from that seen in Caucasian controls, where the most common allele was 30 repeats. Other differences with Caucasian controls included a secondary modal peak at 36 repeats and the absence of peaks at 20 or 23 repeats. There were only two FRAXAC1 and five DXS548 alleles found in the Chinese sample. A striking linkage disequilibrium of FMR-1 alleles with FRAXAC1 alleles was observed, in that 90% of the 29 CGG repeat alleles but only 41% of the 30 CGG repeat alleles had the FRAXAC1 152 bp allele (18 AC repeats). This disequilibrium suggests that slippage between the closely spaced normal CGG repeat alleles, 29 and 30, and between 152 and 154 FRAXAC1 alleles is very rare. This study lays the groundwork for an understanding of founder chromosome effects in comparing Asian and Caucasian populations.

Alleles↗
PubMed1994

Epithelial differentiation of metanephric mesenchymal cells after stimulation with hepatocyte growth factor or embryonic spinal cord.

Mammalian kidney emerges from metanephric mesenchyme following the insertion of a migrating ureteric bud. The pattern morphology of mesenchymal specialization during tubular segmentation is remarkably complex, and the relative contribution of pattern gradients from the microenvironment versus the instructive role of individual cells is not known. We have started to examine the differentiation of metanephric mesenchyme using cultures of metanephric ridge (MMR) cells from day 13.5 mouse embryos to investigate the conversion of mesenchyme toward kidney epithelium in vitro. One of our mesenchymal clones, MMR1, expresses little Pax2, uvomorulin, or cytokeratin but does express neural cell adhesion molecule, bc12, and desmin; these are properties consistent with an early stem cell. Coculture of MMR1 cells with embryonic spinal cord leads to the induction of a more differentiated cell phenotype characterized by decreased expression of neural cell adhesion molecule, the appearance of uvomorulin, and the emergence of cytokeratin, all consistent with an evolution toward epithelium. We were also able to detect the hepatocyte growth factor receptor c-met on MMR1 cells by indirect immunofluorescence. When MMR1 cells were stimulated with hepatocyte growth factor, neural cell adhesion molecule expression decreased and uvomorulin appeared. This effect of hepatocyte growth factor, as a single cytokine, may be important in the early assemblage of kidney, since we were able to detect mRNA transcripts encoding c-met from mouse embryo metanephric kidneys.

Animals↗
PubMed1994

Involvement of an autoregulatory mechanism for the regulation of gonadotropin-releasing hormone (GnRH) gene expression in neurons in the rat preoptic area.

To verify the hypothesis that GnRH neurons can influence each other, we have studied the effects of GnRH, a potent GnRH agonist (Des-Gly10, D-Ala6-proethylamide9)-GnRH and a GnRH antagonist Antide on GnRH gene expression in the male rat preoptic area (POA). Hypophysectomized rats received into the left lateral brain ventricle either the vehicle or each of the peptides. GnRH mRNA levels in neurons in POA were evaluated by quantitative in situ hybridization using a 35S-labelled 48-base oligonucleotide. In hypophysectomized animals, a 18% decrease in the number of silver grain overlying GnRH neurons was observed as compared to intact animals. In hypophysectomized animals neither GnRH nor the GnRH agonist modified GnRH mRNA levels. On the other hand, the administration of Antide induced a 34% increase in the levels of GnRH mRNA. These results suggest that GnRH exerts a negative regulation of the GnRH gene expression in neurons in the POA probably via GnRH receptors.

Animals↗
PubMed1994

Identification and quantitation of drugs of abuse in urine using the generalized rank annihilation method of curve resolution.

A rapid analytical method which is of practical use for the identification and quantitation of drugs of abuse in urine using HPLC with a diode-array detection is described. Because the method utilizes mathematical resolution of partially resolved peaks, greatly simplified sample preparation procedures and very short run times can be used. The generalized rank annihilation method (GRAM) is used to eliminate response due to unknown background peaks and separate partially resolved peaks. An optimized gradient elution program was found for which morphine, phenylpropanolamine, ephedrine, benzoylecgonine, lidocaine, cocaine, diphenhydramine, nortriptyline, norpropoxyphene, nordiazepam, codeine, D-amphetamine, meperidine, and amitriptyline elute from the HPLC column in less than 8.5 min. A commercially available system for HPLC analysis of drugs of abuse is currently available, however, the commercially available system takes 21 min to complete its analysis. Two modified sample pre-treatment methods were also developed to simplify sample treatment procedures substantially. In this paper, The GRAM technique is shown to be extremely powerful in identifying drugs of abuse from large overlapping peaks.

Chromatography, High Pressure Liquid↗
PubMed1994

Distal regulatory elements required for rat whey acidic protein gene expression in transgenic mice.

Previous studies have demonstrated that a 3.0-kilobase, rat whey acidic protein (WAP) transgene containing 949 base pairs (bp) 5'- and 70 bp 3'-flanking DNA is expressed specifically in the mammary gland of transgenic mice in a copy number-dependent, position-independent manner (1). In order to localize the critical regulatory elements important for tissue-specific, high level WAP gene expression, DNase I hypersensitivity mapping studies of WAP transgenes were performed in nuclei isolated from mammary gland and liver. Two regions of DNase I hypersensitivity located at approximately -150 and -800 by from the site of transcription initiation, respectively, were detected only in nuclei isolated from the lactating mammary gland. Within the distal hypersensitive region several binding sites for members of the CTF/NFI family of transcription factors were identified using in vitro DNase I and dimethyl sulfate interference footprinting and electrophoretic mobility shift assays. Genomic footprinting established that such protein-DNA interactions occur preferentially in the lactating mammary gland. The analysis of several 5' deletion constructs identified the region between -853 and -729 bp as essential for WAP transgene expression. These results suggest that the distal DNase I hypersensitive region contains binding sites for CTF/NFI and plays a critical role in the regulation of WAP gene expression in transgenic mice.

Animals↗
PubMed1994

Metabolism of polyhalogenated compounds by a genetically engineered bacterium.

The decomposition of organic compounds by bacteria has been studied for almost a century, during which time selective enrichment culture has generated microorganisms capable of metabolizing thousands of organic compounds. But attempts to obtain pure cultures of bacteria that can metabolize highly halogenated compounds, a large and important class of pollutants, have been largely unsuccessful. Polyhalogenated compounds are most frequently metabolized by anaerobic bacteria as a result of reductive dehalogenation reactions, the products of which are typically substrates for bacterial oxygenases. Complete metabolism of polyhalogenated compounds therefore necessitates the sequential use of anaerobic and aerobic bacteria. Here we combine seven genes encoding two multi-component oxygenases in a single strain of Pseudomonas which as a result metabolizes polyhalogenated compounds by means of sequential reductive and oxidative reactions to yield non-toxic products. Cytochrome P450cam monooxygenase reduces polyhalogenated compounds, which are bound at the camphor-binding site, under subatmospheric oxygen tensions. We find that these reduction products are oxidizable substrates for toluene dioxygenase. Perhalogenated chlorofluorocarbons also act as substrates for the genetically engineered strain.

Camphor 5-Monooxygenase↗
PubMed1994

Temporal regulation of the IgE-dependent 1,2-diacylglycerol production by tyrosine kinase activation in a rat (RBL 2H3) mast-cell line.

We explored the possible role of tyrosine kinases in the IgE-dependent regulation of 1,2-diacylglycerol (DAG) production in RBL 2H3 cells. When triggered via their high-affinity IgE receptors (Fc epsilon RI), there was a rapid phosphorylation of tyrosine residues on a number of proteins. The phosphorylation of these proteins and ultimately histamine release were inhibited in a concentration-dependent manner by the tyrosine kinase inhibitor, tyrphostin. In cells labelled with [3H]myristic acid, we observed a characteristic biphasic increase in [3H]DAG production. In the presence of tyrosine kinase inhibitor, the initial increase in DAG was still observed, but the secondary increase, which was dependent on phosphatidylcholine-specific phospholipase D (PC-PLD) activation, was completely abolished. Tyrphostin significantly inhibited IgE-dependent activation of PC-PLD, suggesting that PC-PLD activation was regulated by tyrosine phosphorylation. Furthermore, when proteins from RBL 2H3 cells were immunoprecipitated with an anti-phosphotyrosine antibody, PC-PLD activity was recovered from the immunoprecipitated fraction. These results demonstrate that the secondary, but not the initial, phase of 1,2-DAG production in response to Fc epsilon RI aggregation is regulated by the initial activation of tyrosine kinases and that PC-PLD may be regulated directly by this mechanism.

Animals↗