Search PubMed⌕ Search

Biomedical subjects

S Aiba

Publications and source records attributed to S Aiba.

At least 127 records · Page 7Linked to original sources
PubMed1987

Acute hemodynamic effects of dopamine, dobutamine, and isoproterenol in congested infants or young children with large ventricular septal defect.

We studied the acute hemodynamic effects of dopamine, dobutamine, and isoproterenol in infants and young children with large ventricular septal defect (VSD). Dopamine (5 micrograms/kg/min) had no significant hemodynamic effects. Dobutamine (5 micrograms/kg/min) administration resulted in modest increases in heart rate and systemic arterial pressure and a decrease in left atrial pressure. This drug decreased the pulmonary blood flow, and the pulmonary-to-systemic blood flow (Qp/Qs) ratio, although these changes were not statistically significant. Isoproterenol, infused at doses of 0.03 and 0.06 micrograms/kg/min, increased the heart rate and lowered left atrial pressure. Only the high dose of isoproterenol lowered systemic and pulmonary arterial pressure. The low dose infusion of this drug increased the pulmonary blood flow as well as the systemic flow, whereas the high dose infusion resulted in a decrease of the Qp/Qs ratio without an increase in the pulmonary blood flow. Right atrial pressure was lowered by dobutamine and the high dose of isoproterenol, but the mean change was only 1 to 2 mmHg. The difference of the effects among these catecholamines is due to their relative strength of action on the vascular bed and the myocardium. Although the doses and durations of the drug infusions were limited, these acute hemodynamic effects should be taken into account when they are to be given to congested infants and young children with large VSD.

Dobutamine↗
PubMed1987

Monoclonal antibody AHS-7 defines a specific basement membrane antigen localized to the hemidesmosome zone.

MoAb AHS-7 labels the basement membrane of the skin. In this report, we have determined the precise localization and molecular nature of the antigen(s). After epidermal-dermal separation by suction blistering, the antigen(s) were detected on the epidermal side. Immunoelectron microscopy revealed the reaction product observed as a discontinuous line along the plasma membrane of the basal keratinocytes, which corresponded to the distribution of the hemidesmosomes. We extracted the proteins from the normal human epidermis separated from the dermis by suction blistering. After being separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the proteins were electrophoretically transferred to nitrocellulose sheets, and the antigen(s) were identified by immunoperoxidase staining with MoAb AHS-7. We detected 4 protein bands of molecular weights of 82 kd, 104 kd, 120-135 kd, and 140-160 kd when unreduced, in contrast to only two bands of 41 kd and 52 kd when reduced. These data suggest that the antigen(s) recognized by MoAb AHS-7 defines a unique antigen, different from bullous pemphigoid antigen on the hemidesmosome zone.

Antibodies, Monoclonal↗
PubMed1987

Analysis of increased urinary acid glycosaminoglycans in a patient with relapsing polychondritis.

We analysed the composition of glycosaminoglycans (GAGs) found in an increased amount in the urine from a patient with relapsing polychondritis (RP) by means of electrophoresis, since to our knowledge no analytical studies on the composition of GAGs in the urine from the patients with RP have been performed. Unexpectedly, the major GAGs detected in increased amount in the urine were found to be dermatan sulfate (DS) and hyaluronic acid (HA), the excretion of which correlated with the activity of the disease. Both DS and HA are the major components not of the cartilage but of the skin. Therefore, our findings suggest that the increased GAGs in RP are derived from skin or other tissues containing these GAGs rather than from the cartilage, unless there is an extensive cartilage destruction.

Electrophoresis, Cellulose Acetate↗
PubMed1986

Immunohistologic analysis of the phenomenon of spontaneous regression of numerous flat warts.

Among various tumors induced by human papilloma virus (HPV), flat warts are unique in that they show a systemic regression phenomenon after sudden occurrence of inflammation in all the tumors, leaving permanent immunity to flat warts in the host. When studied immunohistochemically, the presence of HPV antigen using papilloma virus genus-specific antiserum in 31 cases of regressing flat warts was not found; whereas it was demonstrated in the nuclei of upper epidermal cells of ordinary flat warts in 12 of 19 cases (63%). T-cell phenotype assessment in nine regressing flat warts using monoclonal antibodies showed that helper/inducer subsets constituted a major peritumoral dermal infiltrate with a moderate number of intermingling OKT6+ cells. In contrast, the tumoral epidermis was invaded by almost equal number of suppressor/cytotoxic T-cells and helper/inducer T-cells, where at least some keratinocytes also expressed HLA-DR antigen in addition to Langerhans cells. Most T-cells expressed HLA-DR antigen, a marker of activation, but only a small number of them were Tac antigen+, i.e., bearing interleukin 2 receptors. Leu 7+ natural killer cells were seldom found in the infiltrate. These data provide evidence that T-cell-mediated immune attack against tumor cells and not against intranuclear HPV antigen, induces the systemic spontaneous regression of numerous flat warts in humans.

Antigens, Viral↗
PubMed1986

Complete nucleotide sequences of Bacillus plasmids pUB110dB, pRBH1 and its copy mutants.

The deletion plasmids, pRBH1 (1.5 MDa, kanamycin resistance, Kmr) and pUB110dB (1.5 MDa, Kmr), were obtained from pTB913 (2.9 MDa, Kmr, isolated from a thermophilic bacillus) and pUB110 (3.0 MDa, Kmr, from Staphylococcus aureus), respectively. All the nucleotide sequences of these deletion plasmids were determined. Replication origin regions of pRBH1 and pUB110dB contained, respectively, 63 base-pair inverted repeat and a large open reading frame, encoding RepB protein (235 amino acid residues). The nucleotide sequences were identical to each other except for one base in the center of the inverted repeat. Two copy number mutant plasmids, pRBHC3 and pRBHC7, were obtained from pRBH1. The mutation points were located at different positions in the RepB protein coding region (Gly to Asp for pRBHC3 and Gly to Glu for pRBHC7). RepB protein was shown to be involved in the copy number control of these plasmids.

Bacillus↗
PubMed1986

The copy number of Bacillus plasmid pRBH1 is negatively controlled by RepB protein.

The replication control mechanism of Bacillus plasmid pRBH1 was analysed; pRBH1 contains four promoters, P1 to P4, and a large inverted repeat (63 base pairs) upstream of the protein (RepB) coding sequence. The stem and loop structure is surrounded by two promoters, P1 and P3, with different directions of transcription. One base substitution in the loop structure caused a change in copy number. Since the P1 promoter is located upstream of the replication origin of pRBH1, the transcript from the P1 promoter might serve as the primer of DNA replication. In vivo transcription from the P1 promoter was repressed by a trans-acting plasmid gene product. Since the RepB protein is involved in copy number control and RepB contains the consensus amino acid sequence of DNA binding proteins, RepB was thought to be the repressor. It was concluded from these data that the inverted repeat is involved in the control of copy number of the plasmid pRBH1. The RepB protein also contains two regions highly homologous with the Rom protein encoded on Escherichia coli plasmid ColE1. The possible mechanism for the copy number control of the plasmid via RepB protein and/or RNAs is discussed.

Bacillus↗
PubMed1986

Single amino acid replacements affecting the thermostability of kanamycin nucleotidyltransferase.

Amino acid residues of the carboxyl-terminal region of kanamycin nucleotidyltransferase were modified using segment-directed mutagenesis. Six different mutant enzymes with single amino acid replacements were selected out of 59 clones by DNA sequence analyses. The mutant enzymes were purified and it was found that the thermostability of one mutant enzyme was identical to the wild type, whereas the other five were less thermostable at varying degrees. The data suggested that changes in the enzyme thermostability depend not only on the position but also on the species of amino acid residue replaced.

Base Sequence↗
PubMed1986

Complete nucleotide sequence of the low copy number plasmid pRAT11 and replication control by the RepA protein in Bacillus subtilis.

The 2.6 kb kanamycin-resistant (Kmr) plasmid, pRAT11, was constructed using both the replication determinant (repA) region of the 10.8 kb tetracycline-resistant (Tcr) low copy number plasmid pTB52 and another fragment (0.9 kb) that contained solely the Kmr gene of pUB110. The complete nucleotide sequence of this plasmid was determined. The repA region contained a large open reading frame encoding RepA protein (396 amino acid residues). In vitro transcription and translation of the repA gene were confirmed. RepA protein was shown to be indispensable for plasmid replication, and acted in trans on DNA. The part of the repA gene encoding the specific recognition region of the RepA protein was located and contained 3.5 direct repeats of 24 bp (GGTTTCAAAAATGAAACGGTGGAG). Upstream and downstream of the direct repeats were the recognition sequence (TTATCCACA) of the Escherichia coli DnaA protein and an AT-rich region, respectively. The replication control mechanism of the low copy number Bacillus plasmid is discussed.

Amino Acid Sequence↗
PubMed1986

Construction of high, intermediate and low-copy-number promoter-probe plasmids for Bacillus subtilis.

We constructed promoter-probe plasmids for Bacillus subtilis based on the promoterless gene for penicillinase (penP) of Bacillus licheniformis. A Bacillus stearothermophilus DNA fragment, which contained translational stop codons for all three reading frames and transcription terminators of the alpha-amylase gene, was inserted upstream from the Shine-Dalgarno sequence for the penP gene. A low-copy-number plasmid (about 10 copies per chromosome), pPF101, carried tetracycline-resistance gene, whereas another high-copy-number plasmid (about 55 copies per chromosome), pPF201, conferred resistance to kanamycin. The intermediate-copy-number plasmids (about 20 copies per chromosome), pPF001, pPF002, pPF011 and pPF012, conferred chloramphenicol resistance to both B. subtilis and Escherichia coli. Vector plasmids, pPF011 and pPF012, were provided with single cloning sites for BamHI, SacI, SmaI and XbaI upstream from the protein coding region of penP, whereas other plasmids contained only unique BamHI cloning sites. The applicability of these plasmids was demonstrated by cloning a promoter for the alpha-amylase gene.

Bacillus subtilis↗
PubMed1986

Temperature-dependent plasmid integration into and excision from the chromosome of Bacillus stearothermophilus.

A transformant of Bacillus stearothermophilus carrying a recombinant plasmid, pLP11 (9.5 MDa), on which the penicillinase gene (penP) and kanamycin resistance gene (kan) were located was subjected to mutagenesis, and a mutant plasmid (9.5 MDa; penP kan), designated pTRA117, was obtained. A transformant of B. stearothermophilus carrying pTRA117 could grow at 63 degrees C in medium containing kanamycin, whereas a transformant carrying pLP11 could not. Although pTRA117 was detected as covalently closed circular (ccc) DNA when it was extracted from transformants cultured at 48 degrees C, it was integrated into the host chromosome when the culture temperature was shifted up to 63 degrees C. If the culture temperature was lowered to 48 degrees C from 63 degrees C, a new plasmid (10.7 MDa; penP kan), designated pTRZ117, could be detected as ccc DNA; the size of this plasmid suggested that it was pTRA117 plus a 1.2 MDa DNA fragment of the host chromosome, and this was confirmed by Southern hybridization. pTRZ90 (7.9 MDa; kan) was constructed from pTRZ117 by the deletion of a 2.8 MDa DNA fragment that contained penP. Fresh transformants of B. stearothermophilus that carried either pTRZ117 or pTRZ90 could grow at 65 degrees C.

Chromosomes, Bacterial↗
PubMed1986

Changes in expression of Ia, Thy-1, and Ly-5 antigens in epidermal cells during delayed contact sensitivity reactions in mice: flow cytometric analysis.

Ia antigen-bearing (Ia+) Langerhans cells have attained an important position as immunocompetent cells in the epidermis. Recently there have been successive reports on other new possible candidates for immunocompetent cells in the epidermis, i.e., Ia+ keratinocytes and dendritic Thy-1 antigen-bearing (Thy-1+) epidermal cells which also express Ly-5 antigen and asialo-GM1. Based on our previous findings that in allergic contact sensitivity reactions, keratinocytes express Ia antigen 3-9 days postchallenge, in this report, we have attempted to define more clearly the dynamic changes of Ia+ keratinocytes and dendritic Thy-1+ epidermal cells by enumeration of the precise percentages of Ia+, Thy-1+, and Ly-5 antigen-bearing (Ly-5+) cells in epidermal cells at various times of the challenge phase in allergic contact sensitivity reactions by use of a fluorescence-activated cell sorter. By 24 h postchallenge, the percentages of Ia+, Thy-1+, and Ly-5+ cells showed hardly any change. There were approximately 2% Ia+ cells, 50% Thy-1+ cells which consist of 2 populations (i.e., 45% weakly Thy-1 antigen-positive cells and 4% strongly Thy-1 antigen-positive cells), and 3.5% Ly-5+ cells. From 48 h postchallenge, however, the percentage of Ia+ cells and that of Thy-1+ cells began to increase and reached a plateau, with approximately 20% Ia+ cells and 70% Thy-1+ cells, respectively, at 120 h postchallenge. The change of the percentages of Ly-5+ cells appears to correspond to that of strongly Thy-1 antigen-positive cells. Only at 48 h postchallenge, Ly-5+ cells and strongly Thy-1 antigen-positive cells showed a small increase in number, comprising approximately 10% of the epidermal cells. These data suggest that among Thy-1+ epidermal cells, strongly Thy-1 antigen-positive cells correspond to dendritic Thy-1+ epidermal cells, and in contact sensitivity reactions in mice, dendritic Thy-1+ epidermal cells show only a minor dynamic change in contrast to Ia+ cells, in which more than 15% of keratinocytes express Ia antigen from 48 h postchallenge.

Animals↗
PubMed1986

Nucleotide sequence of the penicillinase repressor gene penI of Bacillus licheniformis and regulation of penP and penI by the repressor.

Bacillus licheniformis penicillinase genes, penP and penI, are coded on a 4.2-kilobase EcoRI fragment of pTTE21 (T. Imanaka, T. Tanaka, H. Tsunekawa, and S. Aiba, J. Bacteriol. 147:776-186, 1981). The EcoRI fragment was subcloned in a low-copy-number plasmid pTB522 in Bacillus subtilis. B. subtilis carrying the recombinant plasmid pPTB60 (Tcr penP+ penI+) was chemically mutagenized. Of about 150,000 colonies, two penI(Ts) mutant plasmids, pPTB60D13 and pPTB60E24, were screened by the plate assay at 30 and 48 degrees C for penicillinase. By constructing recombinant plasmids between wild-type and mutant plasmids, the mutation points were shown to be located in a 1.7-kilobase EcoRI-PstI fragment. The EcoRI-PstI fragments of the wild-type plasmid and two mutant plasmids were sequenced. A large open reading frame, composed of 384 bases and 128 amino acid residues (molecular weight, 14,983), was found. Since the mutation points were located at different positions in the protein coding region (Ala to Val for pPTB60D13 and Pro to Leu for pPTB60E24), the coding region was concluded to be the penI gene. A Shine-Dalgarno sequence was found 7 bases upstream from the translation start site (ATG). A probable promoter sequence which is very similar to the consensus sequence was also found upstream of the penP promoter, but in the opposite direction. A consensus twofold symmetric sequence (AAAGTATTA CATATGTAAGNTTT) which might have been used as a repressor binding region was found downstream and in the midst of the penP promoter and also downstream of the penI promoter. The regulation of penP and penI by the repressor is discussed.

Amino Acid Sequence↗
PubMed1986

[Significance of AFP in gastric cancer].

Serum alpha-fetoprotein (AFP) was positive in as few as 5.7-13.5% of gastric cancer patients prior to surgery, and most of the positive cases had cancer of stage IV or higher. Thus, the parameter did not seem to be very useful in diagnosis. It was positive in as many as 45% of terminal cancer patients, while many cases with AFP of more than 1000 ng/ml had metastases to the liver. Thus, AFP was proved to be useful for follow-up of the postoperative course. AFP staining was conducted in 29 dissected stomachs and five of them were positive for AFP staining.

Adult↗
PubMed1986

In vitro propagation of tissue-infiltrating lymphoid cells from lesional skin by culture in IL 2-containing medium.

Using an in vitro culture system, we have propagated lymphoid cells infiltrating the tissues of allergic contact dermatitis and several inflammatory dermatoses, and those drawn from the blister observed at the sites of allergic contact dermatitis. Approximately 10(7) cells were eventually obtained after 3 weeks from 3 mm punch-biopsied tissues by their culture in human IL 2-containing medium. Studies by flow-cytometrical analysis demonstrated that the proliferated cells were composed of 32-88% Leu-1-bearing (Leu-1+) cells, 70-90% Leu-2a-bearing (Leu-2a+) cells, 10-40% Leu-3a-bearing (Leu-3a+) cells, 70-90% HLA-DR-bearing (HLA-DR+) cells, and less than 10% Tac (IL 2 receptor)-bearing (Tac+) cells. Only the cultured cells derived from lesional tissue of pityriasis rosea and those from the blister content of contact dermatitis showed low percentage of T cell phenotype-bearing cells. These results suggest that the described method has opened a new system that enables us to culture possible effector lymphoid cells actually infiltrating various lesional skin.

Antigens, Differentiation, T-Lymphocyte↗
PubMed1985

Screening for thermostable mutant of kanamycin nucleotidyltransferase by the use of a transformation system for a thermophile, Bacillus stearothermophilus.

A structural gene of kanamycin nucleotidyltransferase cloned into a single-stranded bacteriophage M13 was subjected to mutagenesis with hydroxylamine. Having recloned the mutagenized gene of the enzyme in a vector plasmid pTB922, the recombinant plasmid was used to transform Bacillus stearothermophilus with a purpose of screening for the more thermostable enzyme than the wild type. Out of greater than 8 X 10(3) transformants, 12 clones that were suspected to harbor the mutant gene encoding the more thermostable enzyme were isolated by shifting from a permissive (55 degrees C) to a nonpermissive (61 degrees C) temperature that inactivates the wild-type enzyme. DNA sequence analysis of the mutant genes revealed two types of mutation of single base substitution and hence a single amino acid replacement. The first type was the replacement of an aspartate by a tyrosine at position 80 of the wild-type enzyme, while the second was that of a threonine by a lysine at position 130. Purified enzymes from the two mutant genes were confirmed to be substantially more thermostable than the wild type in vitro. The method of screening for a thermostable kanamycin nucleotidyltransferase presented here could be applied to any other enzyme, if a transformation system of a thermophile were available. Indeed, thermostable mutants with a subtle amino acid change would be of value for better understanding of forces and interactions that contribute to the stability of a protein.

Amino Acid Sequence↗
PubMed1985

Immunohistologic studies in pityriasis rosea. Evidence for cellular immune reaction in the lesional epidermis.

Biopsy specimens of the skin lesions of pityriasis rosea obtained from 15 patients were studied. Characteristic histologic changes were composed of focal intercellular edema, epidermotropism of mononuclear cells often associated with the formation of focal intraepidermal collections of mononuclear cells, and of a perivascular lymphohistiocytic cell infiltration in the superficial dermis. Immunologic analysis using monoclonal antibodies showed that large numbers of lymphoid cells in the perivascular infiltrate reacted with anti-pan-T-cell, anti-helper-inducer subset, and anti-HLA-DR monoclonal antibodies, while the epidermotropic mononuclear cells consisted of helper-inducer cells or suppressor-cytotoxic cells without any predominance pattern. In addition to epidermal Langerhans' cells, some of the dermal infiltrating cells were reactive with monoclonal antibody OKT6. Moreover, there was localized expression of HLA-DR antigen on the keratinocytes. We think that cellular immune reactions are taking place in the lesional epidermis of pityriasis rosea.

Adolescent↗