Search PubMed⌕ Search

Biomedical subjects

R L Jones

Publications and source records attributed to R L Jones.

At least 109 records · Page 6Linked to original sources
PubMed1995

A study of prostacyclin mimetics distinguishes neuronal from neutrophil IP receptors.

The prostacyclin mimetics BMY 45778 (3-[4-(4,5-diphenyl-2-oxazolyl)-5-oxazolyl]phenoxy]acetic acid), BMY 42393 (2-[3-[2-(4,5-diphenyl-2-oxazolyl)ethyl]phenoxy]acetic acid) and EP 185 (rac 5-endo-(6'-carboxyhex-2'Z-enyl)-6-exo-(p-methoxyphenyl- phenyl-methylazino)-bicyclo[2.2.2]oct-2-ene) inhibited rat neutrophil aggregation stimulated by N-formyl-methionyl-leucyl-phenylalanine (IC50 = 20, 462, and 1195 nM respectively). In contrast only BMY 45778 (1-10 microM) produced any significant inhibition (10-20%) of the spontaneous activity of rat colon. BMY 45778 (10 microM) also attenuated the inhibitory effect of the prostacyclin analogue cicaprost on rat colon, whereas BMY 42393 and EP 185 did not. BMY 45778 appears to be a low affinity partial agonist at prostacyclin receptors on rat colon and its low potency in rat colon compared with rat neutrophils suggests the presence of a different prostacyclin receptor located on enteric neurones.

Acetates↗
PubMed1995

Comparison of clinical signs, diagnostic findings, organisms isolated, and clinical outcome in dogs with bacterial pneumonia: 93 cases (1986-1991).

Medical records were reviewed for 93 dogs with bacterial pneumonia from which transtracheal aspiration samples were obtained for culturing of Mycoplasma spp and aerobic bacteria. On the basis of culture results, there were 65 Mycoplasma-positive dogs, including 7 dogs for which only Mycoplasma spp were isolated, and 28 Mycoplasma-negative dogs. Most dogs were > 5 years old, and differences in breed or gender distribution among the 3 groups of dogs were not detected. Hematologic and serum biochemical analysis results did not differ significantly between Mycoplasma-positive and Mycoplasma-negative dogs. Fifty-three of 93 (57%) dogs had a concurrent medical problem that may have predisposed them to developing bacterial pneumonia as a sequelae to aspiration or immunosuppression. Mycoplasma-positive dogs were significantly (P < 0.005) more likely to have > 1 species of bacteria isolated from their transtracheal aspiration samples. Clinical outcome was favorable when antimicrobials were selected on the basis of antimicrobial susceptibility results for the other bacterial isolates and not on results of the antimicrobial activity against Mycoplasma spp. It could not be determined whether Mycoplasma spp were primary pathogens or only opportunists.

Animals↗
PubMed1995

Characterization of the EP-receptor mediating dilatation and potentiation of inflammation in rabbit skin.

The interactions of bradykinin (BK) and FMLP (a leukocyte-dependent mediator of inflammation) with thirteen prostaglandin E analogs have been investigated in a rabbit skin model of inflammation. The PGE analogs were chosen with a view to defining the EP-receptor subtypes involved. Five analogs, PGE2, misoprostol, 16,16-dimethyl PGE2, nocloprost, and enisoprost, were potent vasodilators (133Xe clearance method) and potent potentiators of both BK and FMLP exudation ([125I]albumin method). A further four analogs, butaprost, 11-deoxy PGE1, mexiprostil, and AH 13205, were weaker vasodilators and weaker potentiators of exudation. The remaining four analogs, 11-deoxy PGE2-1-alcohol, MB 28767, sulprostone, and GR 63779X did not induce vasodilatation and did not potentiate FMLP exudation. However, the latter three prostanoids (which are all potent and moderately selective EP3 agonists) produced a modest potentiation of BK exudation at low doses (1 and 10 ng), with no greater effect at higher doses (100 and 1000 ng). Statistical correlation of vasodilator responses with potentiation of FMLP exudation responses was highly significant. A similar correlation for vasodilation/BK exudation, although statistically significant, was not as convincing. The analyses suggested that vasodilatation is a major mechanism of PGE-induced potentiation of plasma exudation and that an EP2-receptor subtype is involved. However, the possibility of a second non-dilator mechanism could not be ruled out.

16,16-Dimethylprostaglandin E2↗
PubMed1995

Intracranial complications of sinusitis: the need for aggressive management.

Sinus-induced intracranial sepsis can represent a genuine medical and surgical emergency. We review 12 cases presenting to our hospitals over a five-year period. Nine were male and three were female with an age range of 16 to 74 years (mean 35.5 years). Four patients had their sinusitis diagnosed prior to admission and eight did not. Nine patients had bilateral sinus disease, the most common sinus involved was the frontal followed by the ethmoid, maxillary and sphenoid. Neurosurgical drainage was via a craniotomy in seven cases and burr hole in three. Nine patients underwent sinus surgery and three did not. Of the nine who had sinus surgery three had frontal drainage, four fronto-ethmoidal and two trans-sphenoidal drainage. The most common organism was Streptococcus milleri. Our series confirms that sinus-induced intracranial sepsis is a serious problem needing early diagnosis and aggressive treatment. We would recommend a high index of suspicion of sinusitis in patients with intracranial infection.

Acute Disease↗
PubMed1995

Aortic distensibility in patients with cerebrovascular disease.

1. Non-invasive aortic compliance measurements have been used previously to assess the distensibility of the aorta in several pathological conditions associated with increased cardiovascular risk. We set out to establish whether aortic compliance is abnormal in patients with stroke. 2. Pulse wave velocity measurements of thoraco-abdominal aortic compliance were made in 20 stroke patients and 25 age- and sex-matched hospitalized, non-stroke control subjects putatively free of cardiovascular disease. Since compliance varies with non-chronic changes in blood pressure, a blood pressure corrected index of aortic distensibility, Cp, was calculated. 3. Aortic compliance was significantly reduced in patients with stroke compared with non-stroke control subjects (0.46 +/- 0.27 versus 0.86 +/- 0.34%/10 mmHg, P < 0.0002), corresponding with higher values for pulse wave velocity. Stroke patients also had significantly higher systolic and diastolic blood pressures (P < 0.02 and P < 0.002 respectively) and total cholesterol levels (P < 0.004) than the control subjects. Calculation of Cp did not alter the observation of stiffer aortas in the stroke cohort (P < 0.0007). 4. In both stroke patient and control cohorts, as expected, inverse trends were observed between aortic compliance and blood pressure. Also as expected, in the control group Cp values did not show a relationship with blood pressure (r = 0.02, P = 0.092, not significant). However, in the stroke cohort a marked dependence of Cp on blood pressure was observed (r = -0.48, P = 0.03). 5. Transoesophageal echocardiographic studies have recently identified advanced atherosclerosis in the ascending aorta as a possible source of cerebral emboli and an independent risk factor for ischaemic stroke.(ABSTRACT TRUNCATED AT 250 WORDS)

Aged↗
PubMed1995

Mortality of young physicians in the United States, 1980-1988.

BACKGROUND: The obituary section of most issues of JAMA announces the death of at least one physician under the age of 40 years. The premature death of a physician is a significant loss to society. METHOD: The authors ascertained the mortality of physicians ages 25 to 39 years occurring from January 1, 1980, through December 31, 1988, from obituary listings in JAMA, and calculated mortality rates by gender and age. Death certificates were sought for all decedents listed as residing in California, Illinois, and Pennsylvania. Cause of death was investigated for this subset. RESULTS: There were 835 young-physician fatalities reported in JAMA during the study period, (an average of 93 deaths per year). The mortality rate among female doctors was 26/100,000; among male doctors it was 40/100,000. The mortality rate of young doctors was less than half that of the general population of white persons of the same age. Of the 122 deaths for which a death certificate was located, 45 (37%) were due to disease, 32 were suicides (26%), 31 were unintentional injuries (25%), and five (4%) were homicides. CONCLUSION: Young physicians enjoy a considerable mortality advantage over non-physicians of similar age. If the study findings in the death certificate sample are generalizable, at least half of the deaths of young physicians are theoretically preventable (suicides, homicides, and unintentional injuries). Residency program directors should consider how their training programs may affect the likelihood of a young physician's dying from a preventable cause.

Adult↗
PubMed1995

Inhibition of rat colon contractility by prostacyclin (IP-) receptor agonists: involvement of NANC neurotransmission.

1. The possibility that prostacyclin (IP-) receptor agonists inhibit spontaneous contractions of the rat isolated colon by activating enteric neurones has been investigated. Cicaprost was used as the test agonist because of its high stability, selectivity and potency (IC50 = 3.8 nM). 2. The Na+ channel blockers saxitoxin (STX, 1 nM) and tetrodotoxin (TTX, 1 microM), whilst having little effect on resting spontaneous activity, virtually abolished the inhibitory actions of cicaprost (10 nM) and nicotine (3 microM); inhibitory responses to isoprenaline (20 nM) were not affected. Phentolamine (1 microM), propranolol (1 microM) and atropine (1 microM) had no effect on cicaprost inhibition. These data are compatible with release of inhibitory NANC transmitter(s) by cicaprost. 3. A transmitter role for nitric oxide was investigated. The nitric oxide synthase (NOS) inhibitor N omega-nitro-L-arginine methyl ester (L-NAME, 100 microM) inhibited the actions of both cicaprost (10 nM) and nicotine (3 microM) by 50-60%, but did not affect responses to isoprenaline (20 nM) or sodium nitroprusside (1-5 microM). The enantiomeric D-NAME (100 microM), which has negligible NOS inhibitory activity, had no effect on the action of cicaprost. 4. The involvement of purinergic transmitters was also investigated. Desensitization to the inhibitory action of ATP did not affect cicaprost responses. The P2x/P2y-receptor antagonist, suramin, at 300 microM blocked ATP responses, but not those due to adenosine; it did not affect cicaprost inhibition. The selective adenosine A1-receptor antagonist, DPCPX, used at a sufficiently high concentration (5 microM) to block adenosine A2-receptors, did not affect cicaprost inhibition. Apamin (25 nM), a blocker of calcium activated K+ channels on smooth muscle, abolished or markedly reduced the inhibitory actions of ATP and adenosine, and partially inhibited cicaprost and nicotine responses. The combination of L-NAME(100 microM) and apamin (25 nM) abolished cicaprost and nicotine responses.5. Investigation of vasoactive intestinal peptide (VIP) as a potential transmitter showed that its inhibitory action on the colon (IC50 = 50 nM) was partially inhibited by TTX (1 microM). alpha-Chymotrypsin abolished the effect of VIP but had no effect on cicaprost inhibition. Attempts to inhibit VIP responses using peptide antagonists and by agonist desensitization were unsuccessful.6. KCI (40 mM) contracted the colon and abolished spontaneous activity. Under these conditions,isoprenaline, sodium nitroprusside and ATP induced relaxation, whereas cicaprost (10-3 10 nM) had no effect. Cicaprost inhibited both the tone and the spontaneous activity induced by the EP1/EP3-receptor agonist, sulprostone (8.6 nM) but not when either TTX (1 microM) or KC1 (40 mM) was also present. On KCl-treated preparations, the prostacyclin analogue, iloprost (10-500 nM), induced contraction,presumably due to activation of EP-receptors.7. It is concluded that IP-receptor agonists inhibit the contractility of rat colon by stimulating the release of at least two transmitters from NANC enteric neurones. Nitric oxide appears to be one of the transmitters. The second transmitter mechanism is apamin-sensitive; the experimental results do not support ATP, adenosine or VIP as transmitter candidates. However, further studies using more potent and selective receptor antagonists are required.

Amino Acid Oxidoreductases↗
PubMed1995

Hypercapnic ventilation response in patients with lung disease: improved accuracy by correcting for ventilation ability.

The hypercapnic ventilation response (HCVR) is positively correlated with forced expired volume in 1 s (FEV1). Therefore, subjects of small stature or patients with lung disease have low values for HCVR. However, indexing the HCVR for the subject's predicted maximal voluntary ventilation (MVV) results in a corrected HCVR (CHCVR) which is not dependent on FEV1 in normal subjects [Respiration 1993;60:197-202]. We hypothesized that the CHCVR would also be useful in assessing chemosensitivity in patients with poor lung function. To obtain the predicted MVV, we used the linear regression for FEV1 vs. measured MVV obtained from 411 patients with a wide range of FEV1 values (MVV = 31.2 x FEV1 + 11.8, r = 0.90, p < 0.001). We compared HCVR and CHCVR to the occlusion pressure response to hypercapnia (OPRH) in 34 patients with chronic obstructive pulmonary disease (COPD) and in 19 patients with low FEV1 due to small stature. All patients had been referred for assessment of possible sleep apnea. The results for the two groups of patients were similar. For the COPD patients, the HCVR had high values for sensitivity (86%) and negative predictive value (94%), but specificity, positive predictive value and accuracy were low (59, 35 and 65%, respectively). In contrast, CHCVR had high values for all the foregoing (86, 96, 100, 100 and 97%, respectively). Our results suggest that the CHCVR is useful in assessing chemosensitivity in patients who are ventilation-limited.

Adult↗
PubMed1994

Hairpin formation within the human enkephalin enhancer region. 2. Structural studies.

Receptor-mediated induction of the human proenkephalin gene has been mapped to an imperfect palindrome located between -104 and -86, upstream of the transcriptional start site. Several lines of evidence suggest that receptor-mediated transcription of proenkephalin involves a reversible conformational change from duplex to a hairpin state of the enhancer [McMurray, C.T., Wilson, W.D., & Douglass, J.O. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 666]. To determine the structure that would form if such a conformational change took place, we have synthesized two 23-bp oligonucleotides, d(GCTGGCGTAGGGCCTGCGTCAGC) and d(GCTGACGCAGGCCCTACGCCAGC), whose sequences are identical to the top and the bottom strands of the native enhancer. We have found that each oligonucleotide strand exists primarily as a hairpin structure over a wide range of oligonucleotide concentrations and a wide range of temperatures (0-45 degrees C). The assignment of each imino proton was carried out using 1D and 2D nuclear Overhauser effects (NOE) and by comparison with the spectra of hairpins containing single base substitutions. The hairpin structure for each oligonucleotide contains a 3-member loop, a 10-bp stem, and two mismatched pairs. The hairpin that forms from the top strand of the enhancer and contains two GT mispaired bases creates an alternative binding site for the cyclic adenosine monophosphate element binding protein (CREB), a transcription factor that binds to and regulates the human proenkephalin gene. Circular dichroism and 31P NMR indicate that, despite the presence of mismatched pairs, each oligonucleotide hairpin adopts a B-form conformation with no unusual bending or kinking. The structure of the hairpin may explain the effect on expression of point mutations within the enhancer.

Base Sequence↗
PubMed1994

Solution structure of a GA mismatch DNA sequence, d(CCATGAATGG)2, determined by 2D NMR and structural refinement methods.

GA mismatches in DNA have drawn attention because of their special repair mechanisms, stability, and variety of conformations. A symmetric 10-base oligodeoxyribonucleotide duplex, d(CCATGAATGG)2, containing two GA mismatches has been investigated by one- and two-dimensional multinuclear NMR and molecular refinement procedures to ascertain the conformational details of the 5'-pyrimidine-GA-purine-3' sequence. A molecular model established from the NMR results has a B-type right-handed helix with each of the bases retaining the normal anti-glycosidic torsional angles. Type I mismatched base pairs have GNH2-AN7 and GN3-ANH2 (edge-to-edge) hydrogen bonds, while type II base pairs have GN1H-AN1 and GO6-ANH2 (face-to-face) bonds. The conformation at the GA mismatch site has type I GA base pairs and an unusual cross-strand stacking of the adjacent G5 and A6 bases, which causes significant overwinding of the helix at the mismatch site. Unusual shifts of the 31P resonances suggest that the phosphate linkage between G5 and A6 is no longer in the low-energy BI conformation. One-dimensional imino and phosphorus NMR studies were carried out on a number of DNA sequences containing adjacent 5'-GA-3' mismatched base pairs to investigate the sequence dependence of the conformations and base-pairing types. Type I and type II conformations have very different imino proton and 31P NMR spectral patterns that can be used to classify any sequence with adjacent GA mismatches by base-pairing and conformational type. The NMR results indicate that the conformation selected is dictated completely by the flanking sequence: 5'-pyrimidine-GA-purine-3' sequences adopt the type I conformation, while 5'-purine-GA-pyrimidine-3' sequences have the type II conformation.

Base Sequence↗
PubMed1994

Aortic compliance measured by non-invasive Doppler ultrasound: application of a personal computer based MkII system and its repeatability.

A non-invasive pulse-wave-velocity Doppler ultrasound technique for the assessment of aortic compliance is described. A computational approach for correcting for the effect of non-chronic changes in blood pressure is considered and applied to compliance measurements performed on an age-select cohort of 70 normotensive, normal healthy volunteers. In order to permit the wider availability of the pulse-wave-velocity Doppler ultrasound technique, the authors have developed a MkII system based on a standard 80486/33 MHz IBM compatible WINDOWS based personal computer; real-time spectral analysis being achieved using a relatively inexpensive but fast analogue to digital signal processing card. An overview of the new apparatus is provided and verification work to compare the repeatability of the MkI and MkII systems is described. Medical disorders such as atherosclerosis, diabetes mellitus, familial hypercholesterolaemia, growth hormone deficiency, and Ehlers-Danlos and Marfan's syndromes have all been shown to affect arterial wall compliance. We suggest that the in vivo clinical measurement of blood pressure corrected aortic distensibility using the MkII system may be a useful, reproducible, non-invasive tool for assessing such patients' susceptibility to atheromatous arterial disease as well as for monitoring their response to therapeutic interventions. Measurements in the aorta may be especially pertinent since the natural history of fatty streaks there tends to parallel that in the coronary vasculature thereby potentially affording a convenient surrogate estimate of coronary heart disease.

Aorta↗
PubMed1994

An empirical study of Freud's penis-baby equation.

One hypothesis of traditional psychoanalytic theory holds that a cardinal aspect of the "natural" development of femininity involves the woman's substitution of the wish for a baby in place of her original wish for a penis. The current study modified and extended earlier research examining the validity of Freud's this "penis-baby" theory. College-aged women and men were presented with either subliminal or supraliminal auditory messages concerned with either pregnancy or penetration themes. Subjects' written responses to Holtzman ink-blots, obtained both before and after exposure to an auditory message, were content-coded for phallic imagery and sexual imagery. Consistent with Freud's speculations about the phallic significance of pregnancy for women, female subjects who were exposed to the subliminal pregnancy message produced significantly more phallic imagery responses to ink-blots than did women in any of the other experimental conditions (p < .01). The phallic imagery production of males did not vary significantly as a function of message condition. Implications of these findings are discussed in the context of modern revisions to Freud's psychology of women and the current psychoanalytic conceptualization of penis envy as a highly condensed mental product with many layers of meaning.

Adolescent↗
PubMed1994

Potent contractile actions of prostanoid EP3-receptor agonists on human isolated pulmonary artery.

1. In 13 of 15 experiments, prostaglandin E2 (PGE2) and sulprostone (a prostanoid EP1/EP3-receptor agonist) contracted isolated rings of human pulmonary artery at low concentrations (> or = 5 and > or = 0.5 nM respectively). Tissue was obtained from patients undergoing surgery mainly for carcinoma of the lung. Characterization of the receptors involved was complicated by loss of sensitivity to the contractile PGE action over the experimental period. In contrast, contractile responses to KCl, phenylephrine and the specific thromboxane (TP-) receptor agonist, U-46619, did not decrease with time. 2. The relative contractile potencies for seven PGE analogues, measured during the first few hours after setting up the preparations, were as follows: sulprostone > misoprostol = gemeprost > or = PGE2 > or = GR 63799X > 17-phenyl-omega-trinor PGE2 > or = 11-deoxy PGE1. This ranking indicates that an EP3-receptor is involved. 3. The contractile action of sulprostone was not blocked by the TP-receptor antagonists, EP 169 and GR 32191, and the EP1-receptor antagonist, AH 6809. 4. In two experiments, PGE2 (50 nM) reduced basal tone and sulprostone was a weak contractile agent. Phenylephrine-induced tone was also inhibited by PGE2 (EC50 = 5-20 nM), 11-deoxy PGE1 and butaprost (a selective EP2-receptor agonist); the latter prostanoids were about 2 and 4 times less potent than PGE2 respectively. Interactions with phenylephrine were different in experiments where PGE2 alone was contractile: PGE2 induced contraction superimposed on the phenylephrine response and 11-deoxy PGE1 induced either further contraction or had no effect. Butaprost produced relaxation at high concentrations;this may not be an EP2 action since preparations were highly sensitive to relaxant actions of prostacyclin (IP-) receptor agonists (cicaprost and TEI-9063).5 The study has shown that in the majority of experiments on the human isolated pulmonary artery,the contractile EP3 system outweighed the relaxant EP2 system. However, in two experiments the reverse was true. It is not clear to what extent these differences are due to disease processes affecting the tissues.The findings are discussed in relation to the adverse cardiovascular responses occasionally encountered during treatment of postpartum haemorrhage with sulprostone, and more generally to the clinical use of EP-receptor agonists in man.

Adolescent↗
PubMed1994

Characterization of prostanoid receptors on rat neutrophils.

1. The effects of various prostanoid agonists have been compared on the increase in intracellular free calcium ([Ca2+]i) and the aggregation reaction of rat peritoneal neutrophils induced by N-formyl-L-methionyl-L-leucyl-L-phenylalanine (FMLP). 2. Prostaglandin E2 (PGE2) and the specific IP-receptor agonist, cicaprost, both inhibited the FMLP-induced increase in [Ca2+]i (IC50 33 nM and 18 nM respectively) and the FMLP-induced aggregation reaction (IC50 5.6 nM and 7.9 nM respectively). PGD2, PGF2 alpha, and the TP-receptor agonist, U 46619, were inactive at the highest concentration tested (1 microM). 3. The EP1-receptor agonist, 17-phenyl-omega-trinor PGE2, and the EP3-receptor agonists, GR 63799X and sulprostone, had no inhibitory effect on FMLP-stimulated rat neutrophils. 4. PGE1 (EP/IP-receptor agonist) and iloprost (IP-receptor agonist) inhibited the FMLP-induced increase in [Ca2+]i with IC50 values of 34 nM and 38 nM respectively. The EP2-receptor agonists, butaprost and misoprostol (1 microM), inhibited both FMLP-stimulated [Ca2+]i and aggregation. However another EP2-receptor agonist, AH 13205, was inactive in both assays. 5. Prostanoid receptors present on rat neutrophils were further characterized by measuring [3H]-adenosine 3':5'-cyclic monophosphate ([3H]-cyclic AMP) accumulation. Only those agonists capable of stimulating [3H]-cyclic AMP accumulation were able to inhibit both FMLP-stimulated [Ca2+]i and aggregation. 6. These results indicate that rat neutrophils possess inhibitory IP and EP-receptors; the relative potencies of PGE2, misoprostol and butaprost are those expected for the EP2-receptor subtype. No evidence for DP, FP, TP or EP1 and EP3-receptors was obtained.

Animals↗
PubMed1993

Problems encountered by primary care physicians in the care of patients with diabetes.

OBJECTIVE: The purpose of this study was to identify problems encountered by primary care physicians in the care of patients with diabetes in order to develop appropriate education programs for physicians. METHODS: A random, stratified telephone survey of 832 physicians in Pennsylvania who listed their specialty as internal medicine, family practice, or general practice was conducted. The response rate was 73%. RESULTS: Following diet and weight control were by far the most common problems reported by physicians for patients with insulin-dependent and non-insulin-dependent diabetes mellitus. Although physicians reported that education regarding diet is discussed during office visits, fewer than 25% of the physicians routinely refer patients to a dietician or health educator. Maintaining glucose control and dealing with the complications of diabetes were the next most common problems for patients with insulin-dependent diabetes mellitus, while compliance issues were common problems for patients with non-insulin-dependent diabetes mellitus. CONCLUSIONS: Efforts to improve the care of patients with diabetes need to recognize and address the problems identified by primary care physicians. Education programs for physicians should deal with attitudes as well as knowledge and should focus on problems such as diet, compliance, referrals to eye doctors, and methods to improve glucose control, such as the use of multiple injections.

Blood Glucose Self-Monitoring↗