Biomedical subjects

N I Matvienko

Publications and source records attributed to N I Matvienko.

At least 19 recordsLinked to original sources

PubMed2006

Nickase and a protein encoded by an open reading frame downstream from the nickase BspD6I gene form a restriction endonuclease complex.

We are the first to have isolated a protein (186 amino acid residues) encoded by the open reading frame adjacent to the end of the BspD6I nickase (N.BspD6I) gene. Cleavage of both DNA strands near the sequence recognized by nickase (5 -GAGTC/5 -GACTC) occurs when this protein is added to the reaction mixture containing N.BspD6I. The protein encoded by the open reading frame and the nickase are suggested to be subunits of heterodimeric restriction endonuclease R.BspD6I.

Amino Acid Sequence↗

PubMed2005

Location of the bases modified by M.BcoKIA and M.BcoKIB methylases in the sequence 5 -CTCTTC-3 /5 -GAAGAG-3.

The strain Bacillus coagulans K contains two DNA-methyltransferases, M.BcoKIA and M.BcoKIB, which recognize the sequence 5 -CTCTTC-3 /5 -GAAGAG-3 and possess N4-methylcytosine and N6-methyladenine specificities, respectively. A special construct containing the recognition site of BcoKI and sites of four IIS restriction endonucleases (IIS restriction endonuclease cassette) was designed to locate the nucleotides modified by the methylases. The modified bases were determined as: 5 -m(4)CTCTTC-3 /5 -GAAGAm(6)G-3 .

Bacteriocins↗

PubMed2004

Isolation and characterization of site-specific DNA-methyltransferases from Bacillus coagulans K.

Two site-specific DNA methyltransferases, M.BcoKIA and M.BcoKIB, were isolated from the thermophilic strain Bacillus coagulans K. Each of the methylases protects the recognition site 5'-CTCTTC-3'/5'-GAAGAG-3' from cleavage with the cognate restriction endonuclease BcoKI. It is shown that M.BcoKIB is an N6-adenine specific methylase and M.BcoKIA is an N4-cytosine specific methylase. According to bisulfite mapping, M.BcoKIA methylates the first cytosine in the sequence 5'-CTCTTC-3'.

Adenine↗

PubMed2004

Significance of codon usage and irregularities of rare codon distribution in genes for expression of BspLU11III methyltransferases.

Genes of adenine-specific DNA-methyltransferase M.BspLU11IIIa and cytosine-specific DNA-methyltransferase M.BspLU11IIIb of the type IIG BspLU11III restriction-modification system from the thermophilic strain Bacillus sp. LU11 were expressed in E. coli. They contain a large number of codons that are rare in E. coli and are characterized by equal values of codon adaptation index (CAI) and expression level measure (E(g)). Rare codons are either diffused (M.BspLU11IIIa) or located in clusters (M.BspLU11IIIb). The expression level of the cytosine-specific DNA-methyltransferase was increased by a factor of 7.3 and that of adenine-specific DNA only by a factor of 1.25 after introduction of the plasmid pRARE supplying tRNA genes for six rare codons in E. coli. It can be assumed that the plasmid supplying minor tRNAs can strongly increase the expression level of only genes with cluster distribution of rare codons. Using heparin-Sepharose and phosphocellulose chromatography and gel filtration on Sephadex G-75 both DNA-methyltransferases were isolated as electrophoretically homogeneous proteins (according to the results of SDS-PAGE).

Amino Acid Sequence↗

PubMed2004

Plasmid pRARE as a vector for cloning to construct a superproducer of the site-specific nickase N.BspD6I.

The gene of methylase M.SccL1I that protects DNA against hydrolysis with the nickase N.BspD6I was inserted into plasmid pRARE carrying genes of tRNA, which are rare in E. coli. The insertion of the gene sscML1I into pRARE was reasoned by incompatibility of pRARE and the plasmid carrying the gene sscML1I, because both plasmids contained the same ori-site. Upon transformation of E. coli TOP10F cells with both the recombinant plasmid pRARE/MSsc and the expression vector pET28b containing the nickase gene bspD6IN under the phage T7 promoter, a strain of E. coli was obtained which produced 7 x 10(5) units of the nickase N.BspD6I per 1 g wet biomass, and this yield was two orders of magnitude higher than the yield of the enzyme from the strain free of pRARE/MSsc.

Amino Acid Sequence↗

PubMed2003

Regulatory C protein of the EcoRV modification-restriction system.

The C gene product of the modification-restriction system PvuII binds to its own promoter (C box) and stimulates transcription of both the C gene and the endonuclease gene. According to our data the same regulatory mechanism is realized in the EcoRV system. It was found that upstream of the EcoRV endonuclease gene two ATG codons give rise to two open reading frames (ORF1 and ORF2) ending at the same point inside the endonuclease gene. Two DNA fragments corresponding to ORF1 and ORF2 were cloned, and the homogenous products of proteins encoded by them were found to be DNA-binding proteins. A specific DNA sequence (C box) recognized by the proteins was determined with DNAse I footprinting. The C box CCCATTTTGGGTTATCCCATTTTGGG is located inside ORF1 and, similar to the PvuII C box consisting of tandem repeats of 11 nucleotides, is divided by four nucleotides. In its turn each of the repeats contains inverted repeats of four terminal nucleotides. The EcoRV C box sequence differs both from the PvuII C box sequence and from the proposed consensus sequence of C boxes in other modification-restriction systems.

Base Sequence↗

PubMed2003

Bacillus species LU4 is an effective producer of thermostable site-specific endonuclease BspLU4I, an isoschizomer of AvaI.

The site-specific endonuclease BspLU4I was discovered in the thermophilic Bacillus species LU4 strain and purified to functionally pure state by chromatography on blue agarose, hydroxyapatite HTP, and heparin-Sepharose columns. Analysis of cleavage patterns of different DNAs with known nucleotide sequences demonstrated that the enzyme recognizes the CPyCGPuG site on the DNA. Cleavage points in the sequence were determined with the elongated primer method. It was shown that the endonuclease is an isoschizomer of AvaI. The final yield of the enzyme is 2.25.10(6) units per g wet biomass.

Bacillus↗

PubMed2003

Cloning and sequencing of the gene of site-specific nickase N.BspD6I.

A fragment of chromosomal DNA from Bacillus species D6 containing the gene of nickase N.BspD6I and the regions adjacent to its 5;- and 3;-ends was cloned and sequenced. The nucleotide sequence of the nickase gene, except of one neutral change, is homologous to the nicking endonuclease N.BstNBI gene sequenced by Higgens et al. (2001). After integration of a PCR-copy of the nickase gene into an expression vector pET28b under the control of the phage T7 promoter, specific nicking activity was detected in the lysates of transformed E. coli cells.

Bacillus↗

PubMed2002

Some properties of site-specific nickase BspD6I and the possibility of its use in hybridization analysis of DNA.

A new method for hybridization analysis of nucleic acids is proposed on the basis of the ability of site-specific nickases to cleave only one DNA strand. The method is based on the use of a labeled oligonucleotide with the recognition site of the nickase hybridized with the target (DNA or RNA) at an optimal temperature of the enzyme (55 degrees C). The two shorter oligonucleotides formed after the cleavage with the nickase do not complex with the target. Thus, a multiple cleavage of the labeled oligonucleotide takes place on one target molecule. The cleavage of the nucleotide is recorded either by polyacrylamide gel electrophoresis (when a radioactive labeled oligonucleotide is used) or by fluorescence measurements (if the oligonucleotide has the structure of a molecular beacon). The new method was tested on nickase BspD6I and a radioactive oligonucleotide complementary to the polylinker region of the viral DNA strand in bacteriophage M13mp19. Unfortunately, nickase BspD6I does not cleave DNA in the RNA-DNA duplexes and therefore cannot be used for detection of RNA targets.

Bacteriophages↗

PubMed2001

Site-specific nickase from bacillus species strain d6.

Three site-specific endonucleases were found in thermophilic strain Bacillus species D6. One of them, BspD6II, is an isoschizomer of Eco57I. The second, BspD6III, is present in the strain in very small amount; therefore, it has not been characterized. This paper is devoted to the third, BspD6I, which recognizes pentanucleotide site 5'-GAGTC-3' and cleaves only one DNA strand at a distance of 4 nucleotides from the site in the 3'-direction in the chain with the GAGTC sequence, i.e., it behaves as a site-specific nickase. Nickase N.BspD6I cleaves one DNA strand only in double-stranded DNA and does not cleave single-stranded DNA. Site-specific methylase SscL1I (an isohypectomer of M*HinfI) that methylates adenine in the sequence 5'-GAGTC-3' prevents DNA hydrolysis by nickase BspD6I.

Bacillus↗

PubMed2000

Two new site-specific endonucleases from Staphylococcus species strain D5.

Staphylococcus species strain D5 containing two site-specific endonucleases, SspD5 I and SspD5 II, was found during screening of a bacterial strain collection from soil. These endonucleases were purified to functional homogeneity by sequential chromatography. Site-specific endonuclease SspD5 I recognizes sequence 5;-GGTGA(8N/8N) downward arrow-3; on DNA. Unlike Hph I, it cleaves DNA at a distance of 8 nucleotides from the recognized sequence on both chains producing blunt-end DNA fragments, while endonuclease Hph I cleaves DNA forming mononucleotide 3;-OH protruding ends. Thus, endonuclease SspD5 I is a new type II site-specific endonuclease and a neoschizomer of endonuclease Hph I. The advantage of this new endonuclease is that the blunt-end DNA products of this enzyme can be inserted without additional treatment into vector DNAs cleaved with endonucleases yielding DNA blunt-ends. Endonuclease SspD5 II recognizes site 5'-ATGCA T-3' and thus is an isoschizomer of endonuclease Nsi I. The molecular mass of SspD5 I is about 35 kD and that of SspD5 II is 40 kD. The enzymes exhibit maximal activity at 37 degrees C. The optimal buffer for the reaction is HRB (10 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 100 mM NaCl, and 1 mM dithiothreitol).

Base Sequence↗

PubMed2000

Cloning and expression of a new site-specific methyltransferase M.SscL1I from Staphylococcus sp. L1.

The gene of the new site-specific methyltransferase M.SscL1I belonging to the same modification-restriction system as the previously described by us site-specific endonuclease SscL1I has been cloned from the natural strain Staphylococcus sp. L1. A plasmid to express the methylase gene under control of the T7 phage-specific promotor has been constructed. Conditions were found to express the recombinant methylase M.SscL1I and to purify it to near homogeneity. It is shown that the methylase modifies the adenine base in the recognition site 5;-GANTC-3;.

Chromatography, Gel↗

PubMed1999

Independent in vitro assembly of all three major morphological parts of the 30S ribosomal subunit of Thermus thermophilus.

Fragments of the 16S rRNA of Thermus thermophilus representing the 3' domain (nucleotides 890-1515) and the 5' domain (nucleotides 1-539) have been prepared by transcription in vitro. Incubation of these fragments with total 30S ribosomal proteins of T. thermophilus resulted in formation of specific RNPs. The particle assembled on the 3' RNA domain contained seven proteins corresponding to Escherichia coli ribosomal proteins S3, S7, S9, S10, S13, S14, and S19. All of them have previously been shown to interact with the 3' domain of the 16S RNA and to be localized in the head of the 30S ribosomal subunit. The particle formed on the 5' RNA domain contained five ribosomal proteins corresponding to E. coli proteins S4, S12, S17, S16, and S20. These proteins are known to be localized in the main part of the body of the 30S subunit. Both types of particle were compact and had sedimentation coefficients of 15.5 S and 13 S, respectively. Together with our recent demonstration of the reconstitution of the RNA particle representing the platform of the T. thermophilus 30S ribosomal subunit [Agalarov, S.C., Zheleznyakova, E.N., Selivanova, O.M., Zheleznaya, L.A., Matvienko, N.I., Vasiliev, V.D. & Spirin, A.S. (1998) Proc. Natl Acad. Sci. USA 95, 999-1003], these experiments establish that all three main structural lobes of the small ribosomal subunit can be reconstituted independently of each other and prepared in the individual state.

Centrifugation, Density Gradient↗

PubMed1999

Site-specific endonuclease NspLKI is an isoschizomer of endonuclease HaeIII.

Site-specific endonuclease NspLKI has been isolated and purified to functionally pure state from soil bacterium Nocardia species LK by successive chromatography on columns with phosphocellulose, HTP hydroxyapatite, and heparin-Sepharose. The isolated enzyme recognizes the 5'-GG downward arrowCC-3' sequence on DNA and cleaves it as indicated by the arrow, i.e., it is an isoschizomer of HaeIII. The final enzyme yield is 1.105 units per gram of wet biomass. The enzyme is active in the temperature range of 25-60 degrees C with an optimum at 48-55 degrees C; it does not lose activity on storage for three days at room temperature. An optimal buffer is HRB containing 10 mM Tris-HCl, pH 7.4, 200 microgram/ml albumin, 10 mM MgCl2, and 100 mM NaCl.

Chromatography, Ion Exchange↗

PubMed1999

PCR fragmentation of DNA.

A method has been developed to prepare random DNA fragments using PCR. First, two cycles are carried out at 16 degrees C with the Klenow's fragment and oligonucleotides (random primers) with random 3'-sequences and the 5'-constant part containing the site for cloning with the site-specific endonuclease. The random primers can link to any DNA site, and random DNA fragments are formed during DNA synthesis. During the second cycle, after denaturation of the DNA and addition of the Klenow's fragment, the random primers can link to newly synthesized DNA strands, and after DNA synthesis single-stranded DNA fragments are produced which have a constant primer sequence at the 5'-end and a complementary to it sequence at the 3'-end. During the third cycle, the constant primer is added and double-stranded fragments with the constant primer sequences at both ends are formed during DNA synthesis. Incubation for 1 h at 37 degrees C degrades the oligonucleotides used at the first stage due to endonuclease activity of the Klenow's fragment. Then routine PCR amplification is carried out using the constant primer. This method is more advantageous than hydrodynamic methods of DNA fragmentation widely used for "shotgun" cloning.

Base Sequence↗

PubMed1999

A site-specific endonuclease from the thermophilic strain Bacillus species F4.

A strain producing the site-specific endonuclease BspF4I was found during screening of thermophilic bacteria isolated from soil. The restriction endonuclease, free from contaminant nonspecific nucleases, was purified using three steps of column chromatography--on hydroxyapatite, blue agarose, and DEAE-Trisacryl. The enzyme is stable on storage and exhibits maximal activity at 48-56 degrees C in the presence of albumin in buffer containing 10 mM Tris-HCl (pH 7.5) and 10 mM MgCl2. BspF4I recognizes the sequence 5;-GGNCC-3; on DNA and is an isomer and not an isoschizomer of the endonuclease Sau96I. Unlike the prototype, BspF4I does not cleave the site in a defined way. A strand with purine in the center of the sequence is cleaved after the first G, as in the case of the prototype, while the strand with pyrimidine is cleaved either before or after the first G.

Bacillus↗

PubMed1998

In vitro assembly of a ribonucleoprotein particle corresponding to the platform domain of the 30S ribosomal subunit.

A fragment of the 16S RNA of Thermus thermophilus corresponding to the central domain (nucleotides 547-895) has been prepared by transcription in vitro. Incubation of this fragment with the total 30S ribosomal proteins has resulted in the formation of a compact 12S ribonucleoprotein particle. This particle contained five T. thermophilus proteins corresponding to Escherichia coli ribosomal proteins S6, S8, S11, S15, and possibly S18, all of which were previously shown to interact with the central domain of the 16S RNA and to be localized in the platform (side bulge) of the 30S ribosomal subunit. When examined by electron microscopy, isolated particles have an appearance that is similar in size and shape to the corresponding morphological features of the 30S subunit. We conclude that the central domain of the 16S RNA can independently and specifically assemble with a defined subset of ribosomal proteins into a compact ribonucleoprotein particle corresponding to the platform (side bulge) of the 30S subunit.

Base Sequence↗

PubMed1998

Isolation and characterization of site-specific endonuclease Bsp123 I from thermophilic strain Bacillus species 123.

The preparation of site-specific endonuclease Bsp123 I was isolated and purified from the thermophilic strain Bacillus species 123. Endonuclease Bsp123 I recognizes the sequence CGCG and cleaves it in the middle between nucleotides G and C, producing blunt ends. Thus, Bsp123 I is an isoschizomer of FnuDII. The maximal activity of the enzyme is displayed at 42 degrees C, pH 8.0, 100 mM NaCl, 10 mM MgCl2.

Bacillus↗