Search PubMed⌕ Search

Biomedical subjects

M Sawada

Publications and source records attributed to M Sawada.

At least 505 records · Page 28Linked to original sources
PubMed1983

Concentrations of a new antitumor agent, 1-hexylcarbamoyl-5-fluorouracil in serum and gynecologic tumor tissue.

The concentrations of 1-hexylcarbamoyl-5-fluorouracil (HCFU), were determined in sera and in tissues of patients with gynecologic cancers. In patients who received a single administration of 600 mg of HCFU, the concentrations of 5FU in tissues were higher than 0.05 microgram/g, which has been appreciated as a sufficiently effective concentration to act on cancer cells. The concentration of 5FU in tissues ranged from one-fifth to one-tenth of those in sera. In patients who received daily administrations of 600 mg of HCFU for more than 28 days, the concentrations of 5FU in tissues were about 0.05 microgram/g, while serum concentrations were lower than 0.02 microgram/ml. The concentrations of 5FU in tissues of patients who received daily administrations of 600 mg of HCFU for more than 28 days and a single additional administration of 200 mg of HCFU were the same as those in patients who received a single administration of 600 mg of HCFU immediately before the determinations. In patients who received 400 mg of HCFU per day divided into 4 doses, the concentrations of 5FU in tissue might be higher than 0.05 microgram/g, based on the concentrations in sera. HCFU might be effective against gynecologic cancers when used in maintenance therapy at a lower dosage (300--400 mg) than previously estimated.

Antineoplastic Agents↗
PubMed1983

[Pregnancy-associated alpha 2-glycoprotein in patients with gynecologic cancer].

Pregnancy-associated alpha 2-glycoprotein (alpha 2-PAG) levels were measured in human sera by a modification of Laurell's electroimmunoassay using rabbit anti-alpha 2-PAG serum. Sera were obtained from healthy controls (68 females), patients with myoma uteri (25 cases), patients with benign ovarian tumors (23 cases) and patients with cervical (19 cases), endometrial (4 cases) or ovarian (23 cases) cancers. The mean values of alpha 2-PAG in patients with myoma uteri (7.3 +/- 2.3U/microliters), benign ovarian tumors (5.0 +/- 3.1U/microliters), cervical cancer (8.8 +/- 4.4U/microliters), endometrial cancer (17.5 +/- 7.6U/microliters) and ovarian cancer (12.0 +/- 4.0U/microliters) were statistically significantly higher than that of controls (2.0 +/- 2.8U/microliters). Elevated levels of alpha 2-PAG were found in sera of 44% patients with myoma uteri, 17% of benign ovarian tumors, 63% of cervical cancer, 100% of endometrial cancer and 83% of ovarian cancer. Elevation of alpha 2-PAG was recognized in 100% patients with endometrial cancer and in 67% patients with ovarian cancer in stage I, while no patient with cervical cancer in stage I showed elevated alpha 2-PAG. No clear relationship of the alpha 2-PAG levels with the stages of the patients nor with the histological types of tumor was found. Serial alpha 2-PAG determination appeared to provide a useful marker in cancer patients. The measurement of serum alpha 2-PAG is recommended as an addition to the conventional diagnostic system.

Adenocarcinoma↗
PubMed1983

[Variations in the level of immunosuppressive acidic protein in patients with gynecologic tumors and pregnant women].

Immunosuppressive acidic protein (IAP) was determined in sera of patients with gynecologic tumors and pregnant women using the single radial immunodiffusion method. The normal limit of IAP of 490 micrograms/ml was derived from the mean value +2S.D. of IAP in 150 healthy females. Among 141 patients with gynecologic cancers, serum IAP was elevated in 87 patients (62%). Among 190 patients with benign tumors (98 uterine myoma, 92 benign ovarian tumors) serum IAP was elevated in 14 patients (7%). The level of IAP in sera of 201 pregnant women was almost identical with that of the healthy females. Elevated levels of IAP were recognized in 43% of 77 patients with cervical cancer, in 55% of 11 endometrial cancer patients and in 91% of 53 ovarian cancer patients. IAP determination was most effective in ovarian cancer for the early detection of cancer. IAP determinations may provide a useful method for the detection of recurrence of cervical cancer.

Adult↗
PubMed1982

Excitatory and inhibitory effects of acetylcholine on the anterior aorta muscle of Aplysia.

The acetylcholine (ACh) responses of anterior aorta muscle cells of Aplysia kurodai were studied by intracellular recording and ACh iontophoresis. Three different types of membrane potential change were observed in response to ACh pulses: a rapid Na+-mediated depolarizing response, a slow, mainly Cl-, in part K+-mediated, hyperpolarizing response, and Na+ (for depolarizing component) and Cl- (for hyperpolarizing component)-mediated biphasic response. The depolarizing response and the depolarizing component of the biphasic response were effectively blocked by hexamethonium or atropine. The hyperpolarizing response and the hyperpolarizing component of the biphasic response were completely blocked by tubocurarine. Low concentrations of ACh inhibited and relaxed the anterior aorta muscle; high concentrations of ACh excited the muscle and initiated contraction. The biphasic responses to ACh are likely due to the presence of more than one ACh receptor type on the same cell membrane of the anterior aorta muscle fiber.

Acetylcholine↗
PubMed1982

The ionic selectivity of two voltage activated channels and an acetylcholine activated channel in an Onchidium neuron.

1. The selectivities of the ion channels underlying the action potential and the hyperpolarizing response to acetylcholine of the GH cell of Onchidium have been analysed. 2. The rising phase of the action potential is due to an increase in the permeability of the membrane to both Na+ and Ca2+. The Na+ channel is permeable to Li+ and is somewhat permeable to formamidinium, guanidinium and ammonium ions. The Ca2+ channel is permeable to Sr2+ and Ba2+, but not to Mn2+ and Mg2+. 3. The Cl- channel operated by ACh is permeable to chlorate, but not to formate and propionate ions. 4. The selectivities of these channels are similar to those of a number of other channels in other organisms.

Acetylcholine↗
PubMed1982

Multivariate analysis using a linear discriminant function for predicting the prognosis of congestive heart failure.

Some of cases of congestive heart failure (CHF) are intractable or refractory and respond poorly to conventional treatment. We have examined factors which may influence the clinical course and prognosis. The subjects were 114 hospitalized patients with CHF. Of these, 77 had a good response to treatment and were classified as the curative group (Group C) while the remaining 37 who were difficult to treat, including those with poor prognosis, were designated the refractory group (Group R). Of the various clinical background factors including the findings of laboratory and other examinations, the following 8 variables made a significant contribution to differentiation between the 2 groups: 1) heart rate (X1), 2) hemoglobin content (X2), 3) serum K (X3), 4) serum total protein (X4), 5) A/G (X5), 6) BUN (X6), 7) grade of hepatomegaly (X7), and 8) number of previous CHF episodes (X8). The linear discriminant function represented by the following equation using these 8 variables showed an excellent result in differentiating the 2 groups. Y = - 9.64 - 0.0686X1 + 0.345X2 + 1.351X3 + 1.513X4 + + 1.988X5 - 0.0876X6 - 0.792X7 - 0.737X8. When Y value is over 0, Group C is judged. When Y value is under 0, group R is judged. We concluded that the discriminant equation covering these 8 factors is a useful means of predicting the prognosis in CHF and the response to treatment.

Adult↗
PubMed1982

Thiolactomycin, a new antibiotic. I. Taxonomy of the producing organism, fermentation and biological properties.

A strain of actinomycetes, isolated from a soil sample, has produced a novel antibiotic (C11H14O2S) containing a unique thiolactone moiety in its molecule. On the basis of taxonomic studies the producing organism was identified as belonging to the genus Nocardia. The antibiotic, named thiolactomycin, exhibits a broad antibacterial spectrum and particularly potent activity against Salmonella, Serratia and Bacteroides. Furthermore, the acute toxicity is weak in experimental animals. These results indicate that thiolactomycin is distinct from other known antibiotics and represents a new type of antibiotic.

Anti-Bacterial Agents↗
PubMed1982

Cyanocycline A, a new antibiotic. Taxonomy of the producing organism, fermentation, isolation and characterization.

A new antibiotic, cyanocycline A, was isolated from the fermentation broth of Streptomyces flavogriseus strain No. 49, a soil isolate. The molecular formula of cyanocycline A was determined to be C22H26N4O5. The antibiotic has a cyano group and a N-heterocyclic quinone moiety in its structure. Cyanocycline A was found to have broad spectrum antimicrobial and antitumor activity.

Animals↗
PubMed1982

[Antitumor effects of human interferon on human tumors heterotransplanted into nude mice].

The effects of human interferon on the growth of xenografted human tumors were studied. Human lymphoblastoid interferon (IFN) was administered intraperitoneally to nude mice with yolk sac tumors of the ovary (YST-1 and YST-2) and endometrial carcinoma (AD-19). IFN inhibited the growth of YST-1 tumor at a dose of 1.0 X 10(6)u/kg/day for twenty one days, and AD-19 tumor at a dose of 1.0 X 10(6)u/kg/day for twenty eight days. On the other hand, IFN failed to inhibit the growth of YST-2 tumor at a dose of 1.0 X 10(6)u/kg/day for eight days. The coefficient of correlation between tumor volume and serum alpha-fetoprotein of tumor-bearing mice was 0.51 in YST-1 and 0.42 in YST-2. No morphologic difference was observed between tumor cells from IFN-treated mice and control tumor-bearing mice. No severe weight loss of tumor-bearing mice was recognized after treatment with IFN. From these results, the usefulness of IFN for clinical treatment was suggested.

Animals↗
PubMed1982

[Pharmacokinetics of cis-platinum diammine dichloride].

Levels of cis-platinum diammine dichloride (CPDD) were determined in the serum, urine and ascites by the flameless atomic absorption spectrophotometry. Samples were obtained from the patients with ovarian cancer (5 cases) and cervical cancer (1 case). The patients were given CPDD by infusion every three weeks. The treatment schedules were as follows: A, 14-16 mg/body/day X 5 days; B, 20 mg/body/day X 5 days; C, 50 mg/body X 1 day. The levels of CPDD in the serum of the patients treated under schedules A and B became higher after the repeated administration from day 1 through 5. In the patients treated under schedules A and B, a more complex serum elimination curve was seen, while a simple biphasic clearance pattern was observed in the patient treated under schedule C. The concentration of CPDD in the serum arose with the increase of doses. A measurable concentration of CPDD was still detected 14 days after the end of administration. The urinary recovery at 24 hours after administration of CPDD ranged from 17.0 to 21.0% under schedules A and B. On the other hand, it was 54.2% under schedule C. The overall urinary recovery of CPDD ranged from 25.3 to 35.3% which suggested the retention of CPDD. The urinary excretion of CPDD and the concentration of CPDD in urine showed close relation with a urine volume per hour. The levels of CPDD remained lower in the ascites compared to those of the serum. No significant elevation in the serum creatinine or BUN were recognized in all patients.

Ascites↗
PubMed1981

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

Base Sequence↗