Search PubMed⌕ Search

Biomedical subjects

M Fry

Publications and source records attributed to M Fry.

At least 37 records · Page 2Linked to original sources
PubMed1997

Purification and characterization of qTBP42, a new single-stranded and quadruplex telomeric DNA-binding protein from rat hepatocytes.

Telomeres of vertebrate chromosomes terminate with a short 5'-d(TTAGGG)-3' single-stranded overhang that can form in vitro tetrahelical structures. Here we describe a new protein from rat hepatocyte nuclei designated quadruplex telomere-binding protein 42 (qTBP42) that tightly binds 5'-d(TTAGGG)n-3' and 5'-d(CCCTAA)n-3' single-stranded and tetraplex forms of 5'd(TTAGGG)n-3'. The thermostable qTBP42 was isolated from boiled nuclear extracts and purified to near homogeneity by successive steps of column chromatography on DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. A subunit molecular size of 42.0 +/- 2.0 kDa was determined for qTBP42 by Southwestern blotting and SDS-polyacrylamide gel electrophoresis of the protein and its UV cross-linked complex with labeled telomeric DNA. A native size of 53. 5 +/- 0.9 kDa, estimated by Superdex copyright 200 gel filtration, suggests that qTBP42 is a monomeric protein. Sequences of five tryptic peptides of qTBP42 contained motifs shared by a mammalian CArG box-binding protein, hnRNP A/B, hnRNP C, and a human single-stranded telomeric DNA-binding protein. Complexes of qTBP42 with each complementary strand of telomeric DNA and with quadruplex forms of the guanine-rich strand had 3.7-14.6 nM dissociation constants, Kd, whereas complexes with double-stranded telomeric DNA had up to 100-fold higher Kd values. By associating with tetraplex and single-stranded telomeric DNA, qTBP42 increased their heat stability and resistance to digestion by micrococcal nuclease.

Amino Acid Sequence↗
PubMed1997

Transient paralysis associated with epidural steroid injection.

Epidural steroid therapy is a commonly applied "conservative" therapy, but it is not inherently benign. Although arachnoiditis, infection, and meningitis have been reported, acute paraplegia has not been reported as a complication of either caudal or spinal epidural steroid injection. A unique case of transient, profound paralysis after epidural steroid injection is reported here. The procedure was carried out without fluoroscopic control and was complicated by a puncture of the thecal sack. Radiographic studies demonstrated a focal, space-occupying lesion in the spinal canal at the level corresponding to the neurologic deficit, which spontaneously resolved over the next 2-3 h. Surgical decompression was initially considered and then deferred in favor of observation. The patient recovered motor, sensory, and bowel and bladder function over the next 48 h. The period of recovery was consistent with an acute but brief compressive injury and inconsistent with an anesthetic effect. Radiographic studies suggest three possible explanations: (a) inadvertent thecal penetration during injection may have produced an atypical anesthetic block; (b) loculation of the injected fluid may have caused a transient compressive lesion; or (c) intrathecal injection may have produced an iatrogenic arachnoid cyst. Although pathologic confirmation of the cause was not possible, the potential for this alarming complication should be recognized by physicians prescribing epidural steroid therapy. We do not suggest that epidural steroid therapy is the treatment of choice for patients with multiple back operations or that it is efficacious for these patients. Our purpose is to alert surgeons and therapists to a rare but potentially devastating complication and to provide our experience in treating it.

Adult↗
PubMed1996

Differential growth by growth plates as a function of multiple parameters of chondrocytic kinetics.

Differential elongation of growth plates is the process by which growth-plate chondrocytes translate the same sequence of gene regulation into the appropriate timing pattern for a given rate of elongation. While some of the parameters associated with differential growth are known, the purpose of this study was to test the hypothesis that eight independent variables are involved. We tested this hypothesis by considering four different growth plates in 28-day-old Long-Evans rats. Temporal parameters were provided by means of oxytetracycline and bromodeoxyuridine labeling techniques. Stereological parameters were measured with standard techniques. For all four growth plates, the calculated number of new chondrocytes produced per day approximated the number of chondrocytes lost per day at the chondro-osseous junction. This suggests that the proposed equations and associated variables represent a comprehensive set of variables defining differential growth. In absolute numbers, the proximal tibial growth plate produced about four times as many chondrocytes per day as the proximal radial growth plate (16,400 compared with 3,700). In the proximal tibia, 9% of growth is contributed by cellular division; 32%, by matrix synthesis throughout the growth plate; and 59%, by chondrocytic enlargement during hypertrophy. In the more slowly elongating growth plates, the relative contribution to elongation from cellular enlargement decreases from 59 to 44%, with a relative increase in contribution from matrix synthesis ranging from 32% in the proximal tibia 49% in the proximal radius. This study suggests that differential growth is best depicted as a complex interplay among cellular division, matrix synthesis, and cellular enlargement during hypertrophy. Differential growth is best explained by considering a set of eight independent variables, seven of which vary from growth plate to growth plate. Thus, this study confirms the importance of cellular hypertrophy during elongation and adds to our understanding of the importance of locally mediated regulatory systems controlling growth-plate activity.

Animals↗
PubMed1995

The fragile X syndrome single strand d(CGG)n nucleotide repeats readily fold back to form unimolecular hairpin structures.

Expansion of a d(CGG)n run within the 5'-untranslated region of the X-linked human gene FMR1 blocks FMR1 transcription, delays its replication, and precipitates the fragile X syndrome. We showed previously that d(CGG)n tracts aggregate into interstrand tetrahelical complexes (Fry, M., and Loeb, L. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4950-4954). Here we show that these sequences also form under physiological conditions in in vitro unimolecular hairpin structures. Folding is demonstrated by temperature-dependent mobility of d(CGG)n oligomers in a nondenaturing polyacrylamide gel, by UV-hyperchromicity of thermally denaturing oligomers, and by UV cross-linking of compact forms of d(CGG)n runs interspersed by thymidine clusters. That the compact d(CGG)n structures are unimolecular is suggested by their zero-order kinetics of formation. Diethyl pyrocarbonate modification reveals a single, 4-5 residue-long central or epicentral unpaired loop in folded d(CGG)n oligomers. The position of this loop remains unchanged by insertion of thymidine clusters into 15- or 33-mer d(CGG) tracts as indicated by KMnO4 probing of unpaired thymidines. The presence of a single loop in folded d(CGG)n oligomers and the accessibility of every guanine to dimethyl sulfate modification suggest that they are hairpin and not tetraplex structures. Modeling indicates that different d(CGG)n hairpins are stabilized by guanine-guanine Hoogsteen hydrogen bonds or by Hoogsteen and Watson-Crick bonds. If formed in vivo, d(CGG)n hairpins could entail slippage and trinucleotide expansion during replication and could obstruct FMR1 gene transcription and replication.

Base Sequence↗
PubMed1995

Development and use of ELISA to quantify type II phospholipase A2 in normal and uremic serum.

Previously we reported that uremic plasma contained eight times more phospholipase A2 (PLA2) activity than control plasma (Costello et al., Clin Chem 1990;36:198-200). That study, however, did not distinguish between various PLA2s that could contribute to the observed increase. Therefore, we developed a sandwich ELISA to specifically quantify serum type II PLA2. By ELISA, uremic sera contained significantly more type II PLA2 than control sera (median = 1025 micrograms/L, range = 52-3320 micrograms/L vs median = 9.2 micrograms/L, range = 4.6-17.5 micrograms/L; P = 0.002). When serum samples were incubated with 1-[14C]oleate-labeled autoclaved Escherichia coli, activity was increased 14.6-fold in uremic vs normal serum, with a median of 6.5 mumol/min per liter (range 1.1-16.3) vs a control median of 0.49 mumol/min per liter (range 0.32-0.60; P = 0.002). Thus, ELISA detects about eightfold more immunoreactive type II PLA2 in uremic serum than does enzymatic analysis. Evidently, the increase in PLA2 activity previously observed in uremic plasma is primarily due to increased concentrations of type II PLA2.

Antibodies, Monoclonal↗
PubMed1994

Stabilization of tetrahelical DNA by the quadruplex DNA binding protein QUAD.

The 57-kDa hepatic nuclear protein QUAD binds tightly and specifically a parallel tetrahelical form of the IgG switch region DNA (Weisman-Shomer, P. and Fry, M. (1993) J. Biol Chem. 268, 3306-3312). Here we show that QUAD is a heat-stable protein, maintaining approximately 90% of its tetrahelix binding activity after 10 min at 100 degrees C and becoming fully inactivated only after 30 min at 100 degrees C. To demonstrate that QUAD protects bound quadruplex DNA, naked and QUAD-bound tetrahelices were boiled, the protein residue in the complex was digested with trypsin and quadruplex and single-strand forms of the DNA component were resolved by electrophoresis. Whereas naked quadruplex DNA became fully denatured after 2 min at 100 degrees C, 55% of the QUAD-bound DNA was conserved as a tetrahelix after 6 min at 100 degrees C. These findings support the proposal that QUAD may act in vivo to stabilize tetrahelical DNA.

Base Sequence↗
PubMed1994

The fragile X syndrome d(CGG)n nucleotide repeats form a stable tetrahelical structure.

The fragile X mental retardation syndrome is associated with the expansion of trinucleotide 5'-d(CGG)-3' repeats within the FMR1 gene and with hypermethylation of the cytosine residues of these repeats. The expansion and hypermethylation may account for the suppression of the transcription of the FMR1 gene and for the delay of its replication during the cell cycle. Here we show that d(CGG)n oligomers can form a stable Hoogsteen-bonded structure that exhibits properties consistent with those of tetraplex DNA. Oligomers, d(mCGG)n, (n = 4, 5, or 7), at pH 8.0 and in the presence of an alkali metal ion form stable species exhibiting a reduced electrophoretic mobility in nondenaturing polyacrylamide gels. These species are denatured by heating at 90 degrees C for 10 min. With a short d(mCGG)5 oligomer, the slowly migrating species is formed only when the cytosine residue is 5-methylated, whereas with the longer d(CGG)7 it is generated whether or not cytosine is 5-methylated. By contrast, complementary cytosine-rich oligomers do not form analogous complexes. The second-order association kinetics of the formation of the slowly migrating species of d(mCGG)5 suggests that it is an interstrand complex. Formation of intermediate-size complexes between d(mCGG)5 and d(mCGG)7 indicates that the stoichiometry of the slowly migrating structures is tetramolecular. Protection of the complex from methylation by dimethyl sulfate indicates the involvement of the N-7 positions of the guanine residues in Hoogsteen hydrogen bonding, a characteristic of quadruplex structures. If formed in vivo along the expanded and hypermethylated d(mCGG)n stretch, this tetraplex structure could suppress transcription and replication of the FMR1 gene in the fragile X syndrome cells.

Electrophoresis, Polyacrylamide Gel↗
PubMed1994

Iron-balance and dose-response studies of the oral iron chelator 1,2-dimethyl-3-hydroxypyrid-4-one (L1) in iron-loaded patients with sickle cell disease.

Several life-threatening complications of the common disorder sickle cell disease require management with red blood cell transfusions and, hence, long-term iron-chelating therapy. The efficacy of the oral iron chelator 1,2-dimethyl-3-hydroxypyrid-4-one (L1) has not previously been determined in patients with sickle cell disease. We compared the efficacy of L1 to that of standard-dose subcutaneous deferoxamine in four regularly transfused patients with homozygous sickle cell disease, who had evidence of severe iron overload and a history of poor compliance with deferoxamine. Determination of 24-hour urinary iron excretion conducted over 5 days immediately after transfusion showed that the mean daily urinary iron excretion induced by L1 at 75 mg/kg/d (0.48 +/- 0.23 mg/kg) was equivalent to that induced by deferoxamine at 50 mg/kg/d (0.39 +/- 0.06 mg/kg). In two of three patients studied, a significant (P < .025) increase in mean daily urinary iron excretion was achieved when the dose of L1 was increased to 100 mg/kg/d. Total iron balance studies, which quantitated both urinary and stool iron excretion on L1 and deferoxamine, determined that mean total daily iron excretion induced by deferoxamine (0.88 +/- 0.05 mg/kg) was significantly greater (P < .05) than that induced by L1 (0.53 +/- 0.17 mg/kg), attributable to the significantly greater stool iron excretion during deferoxamine treatment (0.50 +/- 0.16 mg/kg/d) compared with that measured during L1 treatment (0.12 +/- 0.08 mg/kg/d, P < .01). Stool iron excretion accounted for a significantly greater percentage of total iron excretion during deferoxamine treatment (59% +/- 20%) than during L1 treatment (23% +/- 14%, P < .01). These iron balance studies are the first to compare total iron excretion induced by L1 with that achieved by deferoxamine. They demonstrate that the mean total daily iron excretion during L1 treatment (0.53 +/- 0.17 mg/kg) is sufficient to maintain net negative iron balance in most regularly transfused patients with sickle cell disease. Because long-term compliance with L1 has been shown previously to be superior to that with deferoxamine in patients with homozygous beta-thalassemia, the use of L1 should increase the long-term effectiveness of iron chelation in patients with sickle cell disease.

Administration, Oral↗
PubMed1993

Purification and characterization of p27, a protein from hepatocyte chromatin. Evidence suggesting that it binds selectively to guanine-rich single-stranded DNA.

A protein designated p27 that binds preferentially to single-stranded DNA rich in guanine tracts was purified to near homogeneity from rabbit hepatocyte non-histone protein extract. Purified p27 migrated as a 27 kDa polypeptide on denaturing SDS-PAGE and displayed a native molecular mass of approximately 155 kDa on Sephadex G-150 or Sepharose 6B-Cl gel filtration columns. Gel shift analysis indicated that maximum binding of p27 to single-stranded DNA required the presence of tracts of four or more contiguous guanine residues. The lowest found dissociation constant, 1.4 x 10(-8) M/l, was for single-stranded DNA that contained a (dG)17 run.

Animals↗
PubMed1993

Codons 12 and 13 of H-ras protooncogene interrupt the progression of DNA synthesis catalyzed by DNA polymerase alpha.

Mutagenesis of protooncogenes has been postulated to contribute to the initiation and progression of human cancer. Activating mutations in the H-ras gene are predominantly single-base substitutions and are most frequently identified at codons 12, 13, and 61. We have analyzed the effects of DNA sequence context at specific codons that are hot spots for ras mutation with respect to abnormalities in copying by purified DNA polymerase alpha, a major eucaryotic replication enzyme. Exon 1 of H-ras gene was inserted into M13 mp19, single-stranded DNA constructs were isolated, and the progression of synthesis by polymerase alpha was measured. Strong termination sites were found in codons 12 and 13. Pausing at these codons is abolished when the template is mutated at the middle base of codon 12, the same alteration that converts H-ras into an activated oncogene. Resistance of codon 12 in double-stranded constructs to digestion with restriction enzymes and computer investigation of the ras sequence suggest that these termination sites are in a region of secondary structure. The frequency of sequence alterations within DNA chains that have been extended past codons 12 and 13 was found to be < 0.01. We consider a variety of mechanisms by which the potential secondary structure involving codons 12 and 13 may contribute to the pausing of DNA polymerase alpha and to the generation of clustered mutations at this site.

Base Sequence↗
PubMed1993

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA.

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.

Animals↗
PubMed1992

Site of action of the antimalarial hydroxynaphthoquinone, 2-[trans-4-(4'-chlorophenyl) cyclohexyl]-3-hydroxy-1,4-naphthoquinone (566C80).

The site of action of the antimalarial compound 2-[trans-4-(4'-chlorophenyl) cyclohexyl]-3-hydroxy-1,4-naphthoquinone (566C80), would appear to be the mitochondrial respiratory chain. Studies reported herein have demonstrated 566C80 to be a potent and selective mitochondrial inhibitor with mitochondria isolated from Plasmodium falciparum and P. yoelii. Selective assay of individual respiratory chain complexes has shown the primary site of action of 566C80 to be the cytochrome bc1 complex (Complex III): supportive evidence from difference spectroscopy indicates the site of inhibition to lie between cytochromes b and c1 of this complex. Using [14C]566C80, evidence is presented which suggests that 566C80 may become irreversibly bound to a polypeptide with an approximate molecular mass of 11,500 Da.

Animals↗
PubMed1992

A DNA polymerase alpha pause site is a hot spot for nucleotide misinsertion.

In this study we examined whether the arrest of DNA polymerase alpha (pol alpha)-catalyzed DNA synthesis at template pause sites entails terminal nucleotide misincorporation. An approach was developed to identify the 3'-terminal nucleotide in nascent DNA chains that accumulate at pause sites. A radioactive 5'-end-labeled primer was annealed to a bacteriophage M13mp2 single-stranded DNA template and elongated by pol alpha. Individual DNA chains that were accumulated at pause sites were resolved by sequencing gel electrophoresis, isolated, and purified. These DNA chains were elongated by pol alpha by using four annealed synthetic DNA templates, each of which contained a different nucleotide at the position opposite the 3' terminus of the arrested chain. Owing to the high preference of pol alpha for matched-over-mismatched primer termini, only those templates that contain a nucleotide that is complementary to the 3' terminus of the isolated pause-site chain are copied. Electrophoresis of product DNA showed the extent of copying of each template and thus identified the 3'-terminal nucleotide of the pause-site chains. We found that product DNA chains terminate with a noncomplementary 3'-terminal nucleotide opposite pause sites within the sequence 3'-d(AAAA)-5' at positions 6272-6269 of the M13mp2 genome. pol alpha catalyzed misincorporation of dG or dA into the 3' terminus of nascent chains opposite two of the M13mp2 template dA residues. A similar analysis of a different pause site did not reveal significant misincorporation opposite template dC. These results suggest that some but not all sites at which pol alpha pauses may constitute loci of mutagenesis.

Base Sequence↗
PubMed1992

Subcellular fractionation of the two organelle DNAs of malaria parasites.

Malaria parasites contain two extrachromosomal DNAs, a 6 kb repetitive linear molecule which is assigned on the basis of its genetic content to the mitochondria, and a 35 kb transcriptionally active circular molecule whose intracellular location is not known. We used the polymerase chain reaction to detect and estimate the numbers of both molecules in sub-cellular fractions derived from the rodent parasite Plasmodium yoelii. The two DNA molecules were not coordinately partitioned by the fractionation process, the 6 kb molecule being more abundant, relative to the 35 kb circle, in a fraction enriched for mitochondria, the converse being true for a less dense fraction of unknown identity. This implies that the two molecules are located in different cellular compartments, and is consistent with other evidence suggesting they have different evolutionary origins.

Animals↗
PubMed1991

Mitochondria of mammalian Plasmodium spp.

Highly purified mitochondrial fractions have been isolated from the intraerythrocytic stages of two mammalian Plasmodium spp., Plasmodium yoelii of rodents and Plasmodium falciparum of man. Mitochondria of the former parasite are cristate whereas those of the latter are essentially acristate. Isolated mitochondria from both parasite species were heterogeneous with respect to size, shape, density of matrix staining and extent of internal structure. Respiratory assay, by reduction of exogenous cytochrome c, showed NADH, alpha-glycerophosphate and succinate to be the substrates with the greatest potential for metabolism. Additionally, proline, dihydroorotate and glutamate (P. falciparum only) were oxidized at low rates. A number of NAD(+)-linked substrates were not utilized. The NADH-dependent reduction of cytochrome c was insensitive to rotenone and antimycin A. Fumarate inhibited the NADH-dependent reduction of cytochrome c and stimulated the oxidation of NADH, suggestive of an NADH-fumarate reductase pathway. Oxidation of either alpha-glycerophosphate or succinate was fully inhibited by standard mitochondrial electron transport inhibitors, including a number of Complex III inhibitors, although the concentrations required of such inhibitors (notably myxothiazol) were relatively high compared to mammalian mitochondria. Dithionite-reduced minus oxidized difference spectra indicated the presence of cytochromes aa3, b, c and c1 in mitochondria of both parasite species, but at a higher cytochrome to protein ratio in P. yoelii. Freshly isolated mitochondria from either species exhibited only low respiratory control ratios with alpha-glycerophosphate or succinate as substrates. The apparent absence of a respiratory chain 'Site I' in such mitochondria may mean that NADH-fumarate reductase serves to reoxidize mitochondrial NADH.

Animals↗