Search PubMed⌕ Search

Biomedical subjects

M Fry

Publications and source records attributed to M Fry.

At least 19 recordsLinked to original sources
PubMed2001

Cloning and expression of three K+ channel cDNAs from Xenopus muscle.

Embryonic Xenopus muscle cells grown in culture express voltage-gated K+ currents with inactivating and non-inactivating kinetics. Here we report the cloning of three K+ channel cDNAs, designated XKv1.2', XKv1.4 and XKv1.10, from muscle which may underlie these currents. XKv1.2' cDNA appears to be an allelic variant of the XKv1.2 previously cloned from Xenopus. The second cDNA encodes a homologue of Kv1.4 that has not been previously cloned from Xenopus. The predicted XKv1.4 protein shows 73% overall similarity to mouse and chick Kv1.4, but shows significant divergence in the region corresponding to the chain of the inactivating 'ball and chain' domain. The third K+ channel cDNA isolated from Xenopus muscle is a novel Kv1 isoform designated XKv1.10. The predicted protein shares about 70% similarity with other members of the Kv1 subfamily, and about 40% with members of the Kv2, Kv3 and Kv4 subfamilies. XKv1.4 mRNA appears as early as stage 10.5 in whole embryos and is prominent in muscle throughout development from stage 14 to adult. XKv1.2' mRNA is detected by stage 11.5 in whole embryos, but remains at low levels in embryonic skeletal muscle (stages 14 and 21), and is absent from adult muscle. XKv1.10 mRNA is first detected at stage 21 in whole embryos, and is present in muscle from this stage onwards. All three transcripts are present in spinal cord at stage 21. The results support the notion that channels encoded by XKv1.4 contribute to the inactivating K+ current observed in embryonic muscle cells in culture.

Animals↗
PubMed2001

Interactions between the Werner syndrome helicase and DNA polymerase delta specifically facilitate copying of tetraplex and hairpin structures of the d(CGG)n trinucleotide repeat sequence.

Werner syndrome (WS) is an inherited disorder characterized by premature aging and genomic instability. The protein encoded by the WS gene, WRN, possesses intrinsic 3' --> 5' DNA helicase and 3' --> 5' DNA exonuclease activities. WRN helicase resolves alternate DNA structures including tetraplex and triplex DNA, and Holliday junctions. Thus, one function of WRN may be to unwind secondary structures that impede cellular DNA transactions. We report here that hairpin and G'2 bimolecular tetraplex structures of the fragile X expanded sequence, d(CGG)(n), effectively impede synthesis by three eukaryotic replicative DNA polymerases (pol): pol alpha, pol delta, and pol epsilon. The constraints imposed on pol delta-catalyzed synthesis are relieved, however, by WRN; WRN facilitates pol delta to traverse these template secondary structures to synthesize full-length DNA products. The alleviatory effect of WRN is limited to pol delta; neither pol alpha nor pol epsilon can traverse template d(CGG)(n) hairpin and tetraplex structures in the presence of WRN. Alleviation of pausing by pol delta is observed with Escherichia coli RecQ but not with UvrD helicase, suggesting a concerted action of RecQ helicases and pol delta. Our findings suggest a possible role of WRN in rescuing pol delta-mediated replication at forks stalled by unusual DNA secondary structures.

Base Sequence↗
PubMed2001

Using the Delphi technique to design a self-reporting triage survey tool.

A useful addition to any researcher's methodological repertoire is the Delphi technique. This technique facilitates group communication to develop research items that are contextually specific. For the first time this method was utilised to develop a self-reporting triage survey tool that would explore current practice and begin to explore triage decision-making. The triage role is complex, often crisis-driven and demands speed and accuracy on the part of the triage nurse. This role involves patient assessment, initiating investigations, patient referral and management. The study used the Delphi technique to produce a triage survey tool that would assist in broadening our understanding of current triage practice within Australia.

Australia↗
PubMed2001

Current triage practice and influences affecting clinical decision-making in emergency departments in NSW, Australia.

In Australia, as elsewhere, the nature of triage decision making, patient referral, investigations, physical resources, triage policies, educational requirements and clinical expertise is often unclear and differs between organizations (Gerdtz & Bucknell 2000; Standen 1998). The study described here was undertaken in order to explore current triage practices throughout New South Wales (NSW) and to describe the range of clinical reasoning tasks performed by nurses.

Adult↗
PubMed2001

Triage nurses order x-rays for patients with isolated distal limb injuries: A 12-month ED study.

OBJECTIVES: To determine whether triage nurses could safely, accurately, and appropriately order x-rays for patients with distal limb injuries. METHODS: All adult patients presenting to the emergency department of a tertiary teaching hospital for 12 months with distal limb injuries were eligible for the study. Patients with severe pain or evidence of acute neurovascular compromise were excluded. Triage nurses who had completed a training workshop offered patients the option of having an x-ray obtained before seeing a physician. Data were collected regarding the number and type of x-rays ordered, the number of positive x-ray findings on radiologic review, and violations of x-ray ordering guidelines. All ED distal limb x-rays ordered during the 12-month study period were analyzed for type, frequency, and abnormality. To determine the impact of the project on practice, all triage nurses were given the opportunity to complete a questionnaire, patient satisfaction surveys were conducted, and structured interviews were conducted with senior ED medical and radiography personnel. RESULTS: During the 12-month study, triage nurses ordered 876 x-rays (49%), whereas physicians ordered 930 x-rays (51%). Medical staff and triage nurses ordered equal proportions of upper and lower limb x-rays. The abnormality rate in the total study group was 699 (39%). The abnormality rate for x-rays when comparing nursing and medical staff was 43% (390) and 33% (309), respectively (x(2) = 23.4; P <.0001). The triage x-ray abnormality rate for the upper limb was 51%, compared with 31% for the lower limb. Data indicated that all staff believed that this new triage practice had increased patient satisfaction and improved patient flow and waiting times. CONCLUSION: With structured education, triage nurses at one institution safely assessed patients and ordered appropriate distal limb x-rays prior to physician assessment.

Adult↗
PubMed2000

Human Ku antigen tightly binds and stabilizes a tetrahelical form of the Fragile X syndrome d(CGG)n expanded sequence.

Hairpin and tetrahelical structures of a d(CGG)(n) sequence in the FMR1 gene have been implicated in its expansion in fragile X syndrome. The identification of tetraplex d(CGG)(n) destabilizing proteins (Fry, M., and Loeb, L. A.(1999) J. Biol. Chem. 274, 12797-12803; Weisman-Shomer, P., Naot, Y., and Fry, M. (2000) J. Biol. Chem. 275, 2231-2238) suggested that proteins might modulate d(CGG)(n) folding and aggregation. We assayed human TK-6 lymphoblastoid cell extracts for d(CGG)(8) oligomer binding proteins. The principal binding protein was identified as Ku antigen by its partial amino acid sequence and antigenicity. The purified 88/75-kDa heterodimeric Ku bound with similar affinities (K(d) approximately 1. 8-10.2 x 10(-9) mol/liter) to double-stranded d(CGG)(8).d(CCG)(8), hairpin d(CGG)(8), single-stranded d(CII)(8), or tetraplex structures of telomeric or IgG switch region sequences. However, Ku associated more tightly with bimolecular G'2 tetraplex d(CGG)(8) (K(d) approximately 0.35 x 10(-9) mol/liter). Binding to Ku protected G'2 d(CGG)(8) against nuclease digestion and impeded its unwinding by the tetraplex destabilizing protein qTBP42. Stabilization of d(CGG)(n) tetraplex domains in FMR1 by Ku or other proteins might promote d(CGG) expansion and FMR1 silencing.

Amino Acid Sequence↗
PubMed2000

Interruption of the fragile X syndrome expanded sequence d(CGG)(n) by interspersed d(AGG) trinucleotides diminishes the formation and stability of d(CGG)(n) tetrahelical structures.

Fragile X syndrome is caused by expansion of a d(CGG) trinucleotide repeat sequence in the 5' untranslated region of the first exon of the FMR1 gene. Repeat expansion is thought to be instigated by formation of d(CGG)(n)secondary structures. Stable FMR1 d(CGG)(n)runs in normal individuals consist of 6-52 d(CGG) repeats that are interrupted every 9-11 triplets by a single d(AGG) trinucleotide. By contrast, individuals having fragile X syndrome premutation or full mutation present >54-200 or >200-2000 monotonous d(CGG) repeats, respectively. Here we show that the presence of interspersed d(AGG) triplets diminished in vitro formation of bimolecular tetrahelical structures of d(CGG)(18)oligomers. Tetraplex structures formed by d(CGG)(n)oligomers containing d(AGG) interspersions had lower thermal stability. In addition, tetraplex structures of d(CGG)(18)oligomers interspersed by d(AGG) triplets were unwound by human Werner syndrome DNA helicase at rates and to an extent that exceeded the unwinding of tetraplex form consisting of monotonous d(CGG)(18). Diminished formation and stability of tetraplex structures of d(AGG)-containing FMR1 d(CGG)(2-50)tracts might restrict their expansion in normal individuals.

Base Sequence↗
PubMed2000

Tetrahelical forms of the fragile X syndrome expanded sequence d(CGG)(n) are destabilized by two heterogeneous nuclear ribonucleoprotein-related telomeric DNA-binding proteins.

Formations of hairpin and tetrahelical structures by the trinucleotide repeat sequence d(CGG)(n) might contribute to its expansion in fragile X syndrome. Here we show that tetraplex structures of d(CGG)(n) are destabilized by two mammalian heterogeneous nuclear ribonucleoprotein-related tetraplex telomeric DNA-binding and -stabilizing proteins, quadruplex telomeric DNA-binding protein 42 (qTBP42) (Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474-4482) and unimolecular quadruplex telomeric DNA-binding protein 25 (uqTBP25) (Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 15881-15890). Blunt-ended and 3'-tailed or 3'- and 5'-tailed bimolecular tetraplex structures of d(CGG)(n) and guanine-sparse 20-/46-mer partial DNA duplex were progressively destabilized by increasing amounts of qTBP42 or uqTBP25 in time-dependent and ATP- or Mg(2+)-independent reactions. By contrast, tetraplex structures of telomeric and IgG sequences or guanine-rich double-stranded DNA resisted destabilization by qTBP42 or uqTBP25. Increased stability of tetraplex d(CGG)(n) in the presence of K(+) or Na(+) ions or at lowered reaction temperature diminished the destabilizing activity of uqTBP25. The contrasting stabilization of tetraplex telomeric DNA and destabilization of tetraplex d(CGG)(n) by qTBP42 and uqTBP25 suggested that sequence or structural differences between these tetraplexes might serve as cues for the differential stabilizing/destabilizing activities.

Adenosine Triphosphate↗
PubMed1999

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n.

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.

Base Sequence↗
PubMed1999

Localization of sodium and potassium currents at sites of nerve-muscle contact in embryonic Xenopus muscle cells in culture.

Macro-patch current recordings were used to determine the spatial distribution of INa, inactivating (IIK) and non-inactivating (IK) outward potassium currents on nerve-contacted Xenopus muscle cells grown in culture. Sites of nerve contact were identified under 400x magnification and macroscopic currents recorded from cell-attached membrane patches ranging in diameter from 2 microm to 6 microm. Membrane patch (n=133) recordings revealed no detectable current, or INa and/or IIK, or just IK. More than 85% of the membrane patches from which INa (n=35) could be recorded occurred within 40 microm of the position of nerve contact. In addition, more than 90% of the membrane patches which contained INa also contained IIK. The density of IIK in these membrane patches that also contained INa was significantly higher than the density of IIK or IK in membrane patches without INa. Sites of ACh receptor localization at nerve-muscle contacts, identified by labelling with rhodamine-alpha-bungarotoxin, were also found to contain both INa (4/5 cells) and IIK (5/5 cells). These results suggest that in Xenopus muscle cells in culture the channels mediating IIK along with sodium channels are clustered at sites of nerve contact and synaptic specializations.

Animals↗
PubMed1998

Werner syndrome protein. I. DNA helicase and dna exonuclease reside on the same polypeptide.

Werner Syndrome (WS) is a human progeroid disorder characterized by genomic instability. The gene defective in WS encodes a 3' --> 5' DNA helicase (Gray, M. D., Shen, J.-C., Kamath-Loeb, A. S., Blank, A. , Sopher, B. L., Martin, G. M., Oshima, J., and Loeb, L. A.(1997) Nat. Genet. 17, 100-103). Sequence alignment analysis identified an N-terminal motif in WRN that is homologous to several exonucleases. Using combined molecular genetic, biochemical, and immunochemical approaches, we demonstrate that WRN also exhibits an integral DNA exonuclease activity. First, whereas wild-type recombinant WRN possesses both helicase and exonuclease activities, mutant WRN lacking the nuclease domain does not display exonucleolytic activity. In contrast, WRN proteins with defective helicase activity are active in exonucleolytic digestion of DNA. Second, the exonuclease co-purifies with the 160-kDa WRN protein and its associated DNA helicase and ATPase activities through successive steps of ion exchange and affinity chromatography, suggesting that all three activities are physically associated. Lastly, anti-WRN antiserum specifically co-precipitates the WRN helicase and exonuclease activities indicating that both activities reside on the same antigenic WRN polypeptide. The association of an exonuclease with WRN distinguishes it from other RecQ homologs and raises the possibility that the distinct phenotypic characteristics of WS may be due in part to a defective exonuclease.

Chromatography, Affinity↗
PubMed1998

Werner syndrome protein. II. Characterization of the integral 3' --> 5' DNA exonuclease.

In addition to its DNA helicase activity, Werner syndrome protein (WRN) also possesses an exonuclease activity (Shen, J.-C., Gray, M. D., Kamath-Loeb, A. S., Fry, M., Oshima, J., and Loeb, L. A. (1998) J. Biol. Chem. 273, 34139-34144). Here we describe the properties of nearly homogeneous WRN exonuclease. WRN exonuclease hydrolyzes a recessed strand in a partial DNA duplex but does not significantly digest single-stranded DNA, blunt-ended duplex, or a protruding strand of a partial duplex. Although DNA is hydrolyzed in the absence of nucleoside triphosphates, nuclease activity is markedly stimulated by ATP, dATP, or CTP. WRN exonuclease digests DNA with a 3' --> 5' directionality to generate 5'-dNMP products, and DNA strands terminating with either a 3'-OH or 3'-PO4 group are hydrolyzed to similar extents. A recessed DNA strand with a single 3'-terminal mismatch is hydrolyzed more efficiently by WRN than one with a complementary nucleotide, but the enzyme fails to hydrolyze a DNA strand terminating with two mismatched bases. WRN exonuclease is distinguished from known mammalian DNA nucleases by its covalent association with a DNA helicase, preference for a recessed DNA strand, stimulation by ATP, ability to equally digest DNA with 3'-OH or 3'-PO4 termini, and its preferential digestion of DNA with a single 3'-terminal mismatch.

Base Sequence↗
PubMed1998

Tetanus--the silent killer: how safe are you?

Despite the fact that tetanus is entirely preventable, mortality and morbidity as a result of this disease remain significant. The tetanus toxoid is one of the most potent poisons known. While immunisation programs focus on children, the elderly remain at risk of contracting immunisable diseases. Tetanus often leads to prolonged hospital stays and requires emergency and intensive care intervention and management. This case study illustrates a number of important points concerning the recognition, treatment, management and prevention of tetanus poisoning, and highlights the importance of considering the immunisation status of our elderly patients.

Aged↗
PubMed1997

Leadership. The personal touch.

The government is likely to move from a centralised corporatist form of governance to a more collaborative approach. This will require chief executives to rely on a style of leadership which derives more from personal influence than positional forms of power. It may be time to discuss the future of politically appointed chairs and whether the chief executive should be the sole local leader. The government's commitment to delegating power to regional tiers is likely to have a major impact on the nature of leadership in the NHS.

Administrative Personnel↗
PubMed1997

Telomeric and tetraplex DNA binding properties of qTBP42: a homologue of the CArG box binding protein CBF-A.

qTBP42, a rat liver binding protein of telomeric and of guanine-rich single stranded or tetraplex DNA (Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474-4482), is identified here by its partial amino acid sequence as a homologue of the mouse muscle cell CArG box binding protein CBF-A. Complexes of qTBP42 with single stranded telomeric DNA or with double or single stranded CArG DNA are formed non-cooperatively and have a similar nanomolar-range dissociation constants, Kd. Double stranded telomeric or Plasmid DNA or poly d[(I-C)] are bound by qTBP42 less tightly. Analysis of the binding of tetramolecular quadruplex structures of the IgG switch sequence indicates that one molecule of qTBP42 associates with a single cluster of guanine quartets. The tight binding by qTBP42 of CArG box DNA, telomeric DNA and quadruplex DNA suggests that this protein may bind multiple targets in cellular DNA.

Amino Acid Sequence↗
PubMed1997

Sequence-specific binding protein of single-stranded and unimolecular quadruplex telomeric DNA from rat hepatocytes.

A rat liver nuclear protein, unimolecular quadruplex telomere-binding protein 25, (uqTBP25) is described that binds tightly and specifically single-stranded and unimolecular tetraplex forms of the vertebrate telomeric DNA sequence 5'-d(TTAGGG)n-3'. A near homogeneous uqTBP25 was purified by ammonium sulfate precipitation, chromatographic separation from other DNA binding proteins, and three steps of column chromatography. SDS-polyacrylamide gel electrophoresis and Superdex copyright 200 gel filtration disclosed for uqTBP25 subunit and native Mr values of 25.4 +/- 0.5 and 25.0 kDa, respectively. Sequences of uqTBP25 tryptic peptides were closely homologous, but not identical, to heterogeneous nuclear ribonucleoprotein A1, heterogeneous nuclear ribonucleoprotein A2/B1, and single-stranded DNA-binding proteins UP1 and HDP-1. Complexes of uqTBP25 with single-stranded or unimolecular quadruplex 5'-d(TTAGGG)4-3', respectively, had dissociation constants, Kd, of 2.2 or 13.4 nM. Relative to d(TTAGGG)4, complexes with 5'-r(UUAGGG)4-3', blunt-ended duplex telomeric DNA, or quadruplex telomeric DNA had >10 to >250-fold higher Kd values. Single base alterations within the d(TTAGGG) repeat increased the Kd of complexes with uqTBP25 by 9-215-fold. Association with uqTBP25 protected d(TTAGGG)4 against nuclease digestion, suggesting a potential role for the protein in telomeric DNA transactions.

Animals↗