Search PubMed⌕ Search

Biomedical subjects

K Yamane

Publications and source records attributed to K Yamane.

At least 325 records · Page 18Linked to original sources
PubMed1983

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.

Amino Acid Sequence↗
PubMed1983

Fibronectin binds to C1q: possible mechanisms for their co-precipitation in cryoglobulins from patients with systemic lupus erythematosus.

Fibronectin and C1q frequently co-precipitated in cryoglobulins from patients with SLE. As a portion of the C1q molecule is similar to collagen to which fibronectin has a high affinity, we studied whether fibronectin specifically bound to C1q. Fibronectin was found to bind to both native and heat-inactivated C1q. The binding was enhanced by Ca++ and low ionic strength. We have also demonstrated that fibronectin is capable of binding to C1q fixed to immune complexes. The interaction between fibronectin and C1q may play a role in cryoglobulin formation and in clearance of immune complexes by reticuloendothelial system.

Antigen-Antibody Complex↗
PubMed1983

[Case of spontaneous ventriculocisternostomy: with special reference to a CT finding].

Spontaneous ventriculocisternostomy rarely occurs in obstructive hydrocephalus. The authors experienced a case of spontaneous ventriculocisternostomy diagnosed by CT scan with metrizamide and Conray. Patient was 23-year-old male who had been in good health until one month before admission, when he began to have headache and tinnitus. He noticed bilateral visual acuity was decreased about one week before admission and vomiting appeared two days before admission. He was admitted to our hospital because of bilateral papilledema and remarkable hydrocephalus diagnosed by CT scan. On admission, no abnormal neurological signs except for bilateral papilledema were noted. Immediately, right ventricular drainage was performed. Pressure of the ventricle was over 300 mmH2O and CSF was clear. PVG and PEG disclosed an another cavity behind the third ventricle, which was communicated with the third ventricle, and occlusion of aqueduct of Sylvius. Metrizamide CT scan and Conray CT scan showed a communication between this cavity and quadrigeminal and supracerebellar cisterns. On these neuroradiological findings, the diagnosis of obstructive hydrocephalus due to benign aqueduct stenosis accompanied with spontaneous ventriculocisternostomy was obtained. Spontaneous ventriculocisternostomy was noticed to produce arrest of hydrocephalus, but with our case, spontaneous regression of such symptoms did not appeared. In the literature, arrest of hydrocephalus was noted in 50 per cent of 14 cases of obstructive hydrocephalus with spontaneous ventriculocisternostomy. By surgical ventriculocisternostomy (method by Torkildsen, Dandy, or Scarff), arrest of hydrocephalus was seen in about 50 to 70 per cent, which was the same results as those of spontaneous ventriculocisternostomy. It is concluded that VP shunt or VA shunt is thought to be better treatment of obstructive hydrocephalus than the various kinds of surgical ventriculocisternostomy.

Adult↗
PubMed1983

[Central pontine myelinolysis--pathogenesis and review of the literature].

A 77-year-old, nonalcoholic man was admitted to the Omiya Red Cross Hospital with the complaint of fever and delirium state of two days' duration. Two months prior to admission he had had cough and sputum. Chest X-ray revealed honey comb lungs. Cultures of sputum revealed mycobacterium tuberculosis after eight weeks incubation. He had no liver disease in his past history. The patient appeared cachetic. His vital signs were as follows; temperature 38 degrees C, blood pressure 132/68 mmHg, with a pulse rate of 84/min. He was delirium and excited. Findings of the cranial, motor and sensory nerve examination were normal. Initial laboratory studies showed a serum sodium value of 133 mEq/l, potassium 4.5 mEq/l, chloride 98 mEq/l; a serum GOT value of 51 units, GPT 36 units; a total protein content of 7.8 g/dl and ESR rate of 87 mm/hr. Six days after admission, the patients' consciousness level began to stupor and nuchal rigidity was appeared. Spinal fluid examination revealed opening pressure 270 mm H2O, cell counts 720 (N 712, L 8)/cumm, sugar 57 mg/dl and protein 170 mg/dl. Spinal fluid cultures were positive in mycobacterium tuberculosis after eight weeks incubation. Laboratory studies showed a serum sodium value of 114 mEq/l, potassium 4.4 mEq/l, chloride 86 mEq/l, a serum osmorality (SeOs) 225 mOsm/l and urine osmorality (UOs) 958 mOsm/l.(ABSTRACT TRUNCATED AT 250 WORDS)

Aged↗
PubMed1982

Complement-mediated solubilization of immune complexes in systemic lupus erythematosus.

The capacity of complement-mediated solubilization of immune complexes (complex releasing activity: CRA) was studied in 63 sera from eight systemic lupus erythematosus (SLE) patients. CRA in sera of active SLE (35 +/- 17.%) was significantly lower than that of inactive SLE (64.1 +/- 24.1%, P less than 0.001). In addition, 20 of 23 sera collected during active diseases demonstrated CRA values less than 50% of the control pooled serum. On the other hand, CRA of 29 of 40 sera from inactive disease exceeded the 50% level. CRA in SLE sera correlated with complement component levels and in particular with the CH50. Serial determination of CRA and of levels of circulating immune complexes (CIC), C4 and C3 in two active patients indicated that the correlation between CRA and the complement components was positive, while that between CRA and CIC was negative. These studies provide evidence that CRA may be useful for following the activity of SLE and that CRA reflects the levels of the complement components of both classical and alternative pathways. The possibility that CIC may be solubilized and opsonized by complement and cleared by the reticuloendothelial system was discussed.

Adrenal Cortex Hormones↗
PubMed1979

Thermosensitive, extracellular neutral proteases in Bacillus subtilis: isolation, characterization, and genetics.

Two mutants (NT02 and NT17), each producing a thermosensitive neutral protease, were isolated from Bacillus subtilis NP58, a transformant which acquired the property of hyperproduction of neutral protease from Bacillus natto IAM 1212. The neutral proteases produced by these two mutants were partially purified and enzymologically characterized. The two mutant neutral proteases displayed increased thermosensitivity as well as altered pH optima compared with those of the NP58 enzyme. In addition, the hydrolytic activity of the thermosensitive neutral proteases on synthetic peptide substrates was found to be extremely different. These results strongly suggest that the site of mutation in each of the temperature-sensitive strains is located within the structural gene for neutral protease (nprE). Previous studies indicated the existence of a specific regulator gene (nprR) in addition to the structural gene for neutral protease. Phage PBS1-mediated transduction and deoxyribonucleic acid-mediated transformation studies with the parental and mutant strains suggest that the chromosomal order of these genes is recA-pyrA-nprR-nprE-fruB-metC. Moreover, the results of these genetic analyses imply that the mutations to thermosensitivity are located proximate to each other within the nprE gene.

Bacillus subtilis↗