Search PubMed⌕ Search

Biomedical subjects

J W Shay

Publications and source records attributed to J W Shay.

At least 163 records · Page 9Linked to original sources
PubMed1993

Heterogeneity of transcriptional activity of mutant p53 proteins and p53 DNA target sequences.

Transcriptional activity of p53 was monitored by cotransfection of pCMV expression vectors containing wild-type and mutant p53 cDNAs into the p53-null H1299 lung cancer cells along with luciferase reporter plasmids containing different p53 target sequences in the 5' regulatory region: fragment A of the ribosomal gene cluster (RGC); p53 consensus sequence (p53CON); or a tandemly linked RGC+p53CON sequence. Our results show: (1) wild-type p53 stimulates the transcription of reporter genes with p53CON and RGC in their 5' region while most p53 mutants occurring in human cancers have lost this activity; (2) the R273H mutant retains transcriptional activity for the p53CON sequence but not RGC; (3) some mutants are temperature-sensitive for the transcriptional activity with the p53CON but not the RGC sequence; (4) p53 mutants vary in their ability to inhibit wild-type p53 transactivation but there is no difference between p53CON and RGC sequences; (5) lung cancer cells with endogenous mutant p53 proteins (M246I in H23 cells and R248L in H322 cells) retain transcriptional activity for the p53CON but not the RGC sequence. We conclude that p53 DNA target sequences vary in their response to mutant p53 proteins, and that p53 mutants vary in several transactivation related functions.

Base Sequence↗
PubMed1993

Novel DNA binding of p53 mutants and their role in transcriptional activation.

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

Amino Acid Sequence↗
PubMed1993

E6 of human papillomavirus type 16 can overcome the M1 stage of immortalization in human mammary epithelial cells but not in human fibroblasts.

Immortalization is the consequence of the inactivation or bypass of two mortality stage mechanisms, M1 and M2, which are controlled by several genes including Rb and p53 in human fibroblasts. Abrogation of the M1 controls can be obtained through the activity of DNA tumor virus genes such as E6 and E7 of human papillomavirus 16 (HPV16). Fibroblasts expressing both E6 (which binds p53) and E7 (which binds Rb) bypass M1 and continue replicating (exhibit an extended lifespan) until an independent mechanism, M2, is activated. The inactivation of the M2 mechanism finally results in cell immortalization. The present study establishes a difference in the tissue-specific mechanisms for the control of the M1 stage of cellular senescence. The expression of HPV16 E6 was sufficient to bypass the M1 stage of cellular senescence and confer an extended lifespan in human mammary epithelial cells but not in fibroblasts. This implies that the M1 mechanism in human mammary epithelial cells does not involve the constitutive activation of Rb function as it does in fibroblasts. In addition, the results confirmed that the expression of HPV16 E6 (or both E6 and E7) did not directly immortalize the human mammary epithelial cells, since the inactivation of a second event, M2, was required to achieve immortalization. These observations are considered in the context of the telomere shortening model of cellular senescence.

Blotting, Northern↗
PubMed1992

Cellular and molecular advances in elucidating p53 function.

The finding that in many human tumors there is allelic loss and/or mutations in p53, in combination with recognition that these events may play a role in multi-stage carcinogenesis, has focused considerable interest on this gene. To help keep abreast of this rapidly expanding field, recent experiments on the role and potential regulation of p53 are described: these include discussions of p53 as an anti-proliferative agent, the p53 mutations found in human tumors and tumor cell lines, the conformational states of p53, phosphorylation of p53 by p34cdc2, and signals for the nuclear localization of p53. p53 may act as a transcriptional activator and the specific DNA sequences to which p53 protein binds are also discussed as is the importance of abrogation of p53 function in overcoming cellular senescence.

Base Sequence↗
PubMed1992

Telomere positional effects and the regulation of cellular senescence.

Normal cells have a limited capacity to proliferate but the molecular clock that regulates the onset of cellular senescence remains unidentified. The ends of chromosomes--telomeres--have been shown to shorten progressively with age in normal cells. Here, we present a working model of how telomeric shortening may induce programmed changes in the regulation of cellular proliferation.

Cell Death↗
PubMed1992

New evidence for the insertion of mitochondrial DNA into the human genome: significance for cancer and aging.

We have observed and characterized in detail two cases of mitochondrial DNA fragments which have inserted into the nucleus of HeLa cells. In one case three non-sequential but contiguous regions of mitochondrial DNA with 92% homology to human cytoplasmic mitochondrial DNA inserted into the nuclear genome. In the second case the mitochondrial DNA sequence encoding cytochrome c oxidase subunit III was contiguous with and 5' of exons 2 and 3 of the c-myc oncogene and the chimeric gene was transcribed. Models are presented that describe mechanisms for the transfer of mitochondrial DNA into the nucleus involving fragmentation of mitochondrial DNA through aging and/or oxidative damage, anomalous processing or escape of mitochondrial DNA and RNA fragments from autophagic vacuoles, and insertion of mitochondrial DNA sequences, in some instances after reverse transcription of mitochondrial RNA, into the nuclear genome.

Adult↗
PubMed1992

A transcriptionally active DNA-binding site for human p53 protein complexes.

Recent studies have demonstrated transcriptional activation domains within the tumor suppressor protein p53, while others have described specific DNA-binding sites for p53, implying that the protein may act as a transcriptional regulatory factor. We have used a reiterative selection procedure (CASTing: cyclic amplification and selection of targets) to identify new specific binding sites for p53, using nuclear extracts from normal human fibroblasts as the source of p53 protein. The preferred consensus is the palindrome GGACATGCCCGGGCATGTCC. In vitro-translated p53 binds to this sequence only when mixed with nuclear extracts, suggesting that p53 may bind DNA after posttranslational modification or as a complex with other protein partners. When placed upstream of a reporter construct, this sequence promotes p53-dependent transcription in transient transfection assays.

Base Sequence↗
PubMed1992

Complexes containing the retinoblastoma gene product recognize different DNA motifs related to the E2F binding site.

The retinoblastoma tumor-suppressor gene encodes a 105-kDa nuclear phosphoprotein (RB) that can associate with DRTF-1 and E2F. These two transcription factors can recognize the same DNA motif in the adenovirus E2A promoter and can bind to it by themselves or in association with RB. In the present report, we describe the use of CASTing (cyclic amplification and selection of targets) to determine the consensus binding site of RB-containing complexes. An anti-human RB antibody was used to isolate RB-containing complexes formed after mixing nuclear extracts obtained from human diploid fibroblasts with a pool of random oligonucleotides flanked with polymerase chain reaction (PCR) primers. After the immunoselection, the DNA was isolated, amplified, mixed with fresh nuclear extract and reselected. After six CASTing cycles, the DNA was cloned and sequenced. We found that the highest affinity motifs recognized by RB-containing complexes are related to the E2F/DRTF-1 binding site and fall into three classes: TTTTCCCGCCAAAA, TTTTCCCGCCTTTTTT or TTTTCCCGCGCTTTTTT. Competition experiments revealed that these three classes are functionally equivalent to each other and to the E2F/DRTF-1 binding site in the adenovirus E2A promoter. Screening these sequences against a DNA database identified their presence in non-coding regions of many oncogenes, growth factor genes and in the RB gene itself.

Adenosine Triphosphate↗
PubMed1991

Defining the molecular mechanisms of human cell immortalization.

Although the immortalization of human cells is a key step in oncogenic progression, the molecular mechanisms underlying this event are poorly understood. After reviewing the use of chemicals, physical agents, oncogenes and DNA tumor viruses as immortalizing agents, we consider the importance of negative regulators of cell growth (RB and p53), their inactivation, as well as genomic instability in the pathogenesis of cancer. Finally, a molecular model for human cell immortalization that integrates many of the above observations is presented along with supporting evidence.

Cell Transformation, Neoplastic↗
PubMed1991

Tumor suppression by chromosome 11 is not due to cellular senescence.

Previous hybrid studies involving fusion of normal with immortal human cells indicated that the phenotype of cellular senescence is dominant and that immortality results from recessive changes in normal growth regulatory genes. We have further assigned 28 different immortal human cell lines to at least four complementation groups for indefinite division. In order to identify the chromosomes involved in regulating cell proliferation, we have introduced single human chromosomes by microcell fusion into immortal human cells representative of the different complementation groups. Our results demonstrate that the introduction of chromosome 11, implicated in tumor suppression, does not cause cellular senescence in three different immortal human cell lines tested.

Animals↗
PubMed1991

A role for both RB and p53 in the regulation of human cellular senescence.

We present evidence for the possible involvement of both the RB and p53 proteins in the regulation of cellular senescence. Human fibroblasts immortalized with an inducible SV40 T-antigen become senescent following the de-induction of T-antigen. Plasmids expressing an alternative source of intact T-antigen restore proliferation but T-antigen deletion mutants lacking either the RB or p53 binding domains are unable to do so. Similarly, combinations of adenovirus E1A + E1B or human papillomavirus E6 + E7 genes are able to replace T-antigen functions and permit cell proliferation, whereas the individual genes do not. These results are discussed in terms of a two-stage model for the escape from in vitro cellular senescence.

Adenoviruses, Human↗
PubMed1991

Temperature-dependent modulation of lipopolysaccharide-induced interleukin-1 beta and tumor necrosis factor alpha expression in cultured human astroglial cells by dexamethasone and indomethacin.

In bacterial meningitis, LPS induces production in cerebrospinal fluid of the cytokines IL-1 beta and tumor necrosis factor alpha (TNF alpha), which are the principle mediators of meningeal inflammation. IL-1 beta and TNF alpha induce fever, and elevated temperature may affect cytokine expression. Dexamethasone treatment improves outcome in bacterial meningitis possibly by inhibiting IL-1 beta and TNF alpha. In this report, the effects of elevated temperature and dexamethasone on LPS-stimulated IL-1 beta and TNF alpha mRNA gene expression and protein synthesis were studied in human astrocytoma cell lines and primary cultures of human fetal astrocytes. Cells cultured at 40 degrees C exhibited smaller peaks of IL-1 beta and TNF alpha transcription and protein synthesis compared with cells cultured at 37 degrees C. The addition of dexamethasone before, during, or after exposure of the cells to LPS resulted in temperature-dependent inhibition of IL-1 beta transcription and protein synthesis. The most extensive inhibition occurred in pretreated cells cultured at 37 degrees C. Cotreatment with LPS and dexamethasone also inhibited TNF alpha mRNA transcription at both temperatures. The effects of another antiinflammatory agent, indomethacin, on LPS induction of IL-1 beta and TNF alpha mRNA were temperature and cell line dependent. These findings provide a possible explanation for the efficacy of dexamethasone treatment of bacterial meningitis and support the proposal that fever may be beneficial to the host in this disease.

Astrocytes↗
PubMed1991

HeLaTG cells have mitochondrial DNA inserted into the c-myc oncogene.

To determine whether mitochondrial DNA (mtDNA) fragments found within the nucleus are transcribed, we have differentially screened a HeLaTG cDNA library. A clone that hybridized to mtDNA as well as to c-myc was identified. Analysis of the cDNA disclosed that it contained a mtDNA sequence, encoding cytochrome-c oxidase subunit III (coxIII) that was contiguous with and 5' of a c-myc sequence corresponding to part of exon 2 and exon 3. Hybridization of ScaI-digested DNA with a 1.05 kb c-myc probe revealed a unique band in HeLaTG cells, as well as a band common to HeLaTG and 13 other cell types examined. Solution hybridization of HeLaTG RNA with a radiolabeled, single-stranded cDNA probe containing the coxIII-c-myc junction demonstrated a nuclease-resistant band that matched the full length of the junctional cDNA probe. A smaller band that equaled the size of the c-myc portion alone was also detected. Only the smaller band coinciding with the c-myc sequences was protected from nuclease digestion by RNA from other cells. When a radiolabeled probe synthesized in the opposite orientation was used, nuclease-resistant bands equal in length to the coxIII portion of the probe were detected after hybridization with RNA from all cells. These results indicate that insertion of mtDNA fragments into nuclear genes occurs and that subsequent transcription of a 'chimaeric' or 'fusion' mRNA containing both mitochondrial and nuclear sequences can ensue.

Base Sequence↗
PubMed1990

Mitochondrial DNA copy number is proportional to total cell DNA under a variety of growth conditions.

Analyses of populations of NIH/3T3 cells for mitochondrial DNA under various conditions were made by use of an improved procedure. Cells were examined at different cell densities, at different stages of cell growth, and after the cells had been incubated with a carcinogen reported to affect mitochondrial DNA replication, benzo[a]pyrene-epoxide. In addition, the analysis was performed on three tumorigenic NIH/3T3 cell lines and one mouse bladder epithelial cell line and its tumorigenic derivative. Small variations of mitochondrial DNA under these various conditions were detected easily and revealed a linear relationship between mitochondrial DNA and total cell DNA.

Animals↗
PubMed1990

Suppression of the progression phenotype in somatic cell hybrids occurs in the absence of altered adenovirus type 5 gene expression.

In the present study we have analyzed the genetic regulation of increased expression of transformation-associated traits, a process termed progression, in adenovirus type 5 (Ad5)-transformed secondary rat embryo cells. Somatic cell hybrids were formed between a highly progressed neomycin-resistant Ad5-transformed cloned cell line (E11-NMTneo) and an untransformed chloramphenicol-resistant rat embryo fibroblast cell line (CREFcap). Parental E11-NMTneo cells grew with high efficiency in agar, exhibited reduced 125I-epidermal growth factor (EGF) binding, and were tumorigenic in nude mice. Parental CREFcap cells exhibited phenotypes opposite to those of E11-NMTneo cells. A high proportion (84%) of the presumptive hybrid cell types obtained after fusion and genetic selection (G418 and chloramphenicol) displayed a flat morphological phenotype intermediate between CREFcap and E11-NMTneo cells, suggesting that a trans-dominant extinction phenomenon had occurred. Two hybrids with a round morphology (R), which still exhibited the progressed phenotype, and two hybrids with a flat morphology (F), which had lost the progressed phenotype, were chosen for detailed analysis. Both R hybrids grew efficiently in agar, exhibited low 125I-EGF binding, and were tumorigenic in nude mice, whereas both F hybrids grew poorly in agar, displayed increased 125I-EGF binding in comparison with E11-NMTneo and R hybrids, and were nontumorigenic in nude mice. An analysis of the viral DNA integration patterns and the rates of transcription, steady-state mRNA accumulation, and relative levels of the Ad5 E1A and E1B gene products revealed no differences among the parental and hybrid cells. These studies indicate that normal CREF cells may contain a suppressor gene(s) which can inhibit the expression of specific traits of the progression phenotype in Ad5-transformed cells and that this suppression is not associated with changes in the expression of Ad5 transforming genes.

Adenoviridae↗
PubMed1990

An improved procedure for quantitating mitochondrial DNA in cultured mammalian cells.

A new improved method that reproducibly measures small perturbations of mitochondrial DNA in populations of cells has been developed. It is based on first obtaining a cell count and then analyzing three aliquots of cells: one for total DNA per cell by fluorometry, one for total protein per cell and one for the amount of mitochondrial DNA per microgram of total cell DNA. To quantitate mitochondrial DNA, 0, 1, 2, and 3 nanograms of mouse mtDNA purified from a plasmid are added as internal standard DNA to four 1.0-microgram samples of purified total cell DNA containing an unknown amount of mitochondrial DNA (a sample set). Three sample sets are electrophoresed in an agarose gel devoid of ethidium bromide. Following Southern transfer to nitrocellulose and hybridization to purified 32P-labeled mouse mitochondrial DNA, an autoradiogram is prepared for use as a template to locate the mitochondrial DNA bands. These bands are cut out of the nitrocellulose filters, and their 32P-content is determined using a liquid scintillation counter. For each sample set, the counts per minute is plotted against the amount of mitochondrial DNA added. The plot is linear and the negative average of the values for the three intercepts on the x-axis yields the amount of nanograms of mitochondrial DNA per microgram of total cell DNA. The method is highly reproducible with a standard deviation of approximately 9 percent. The advantages of using this method over others that have been reported are discussed.

Animals↗
PubMed1989

Three separate mitochondrial DNA sequences are contiguous in human genomic DNA.

We isolated from a HeLa genomic library 38 plaques that hybridized to total mitochondrial (mt) DNA isolated from human placenta. One clone (HLmt-17.8) hybridized to a 740 base-pair (12 S ribosomal RNA gene and displacement loop) mtDNA probe and was characterized in more detail. Within its 17.8 x 10(3) base-pair insert a 1.6 x 10(3) base-pair mtDNA fragment was similar to three non-sequential coding genes of human mtDNA, including a part of the 12 S ribosomal RNA (684-971), the cytochrome oxidase I (6553-7302), and two NADH dehydrogenase [ND4L/ND4] (10,606-11,159). The similarity to human mtDNA sequences was 92.0%, 92.3% and 92.4%, respectively, the highest degree of similarity to human mtDNA so far reported. This is also the first report of several adjacent mtDNA-like sequences in cellular chromosomes. The mtDNA-like sequences in HLmt-17.8 was found in the DNAs of human placenta, freshly isolated human leukocytes, foreskin and several human cell lines; but it was not present in other primates or lower organisms. The HLmt-17.8 mtDNA-like region appears to be a pseudogene that transferred into the nucleus in humans more recently than nine million years ago.

Base Sequence↗