Search PubMed⌕ Search

Biomedical subjects

J W Shay

Publications and source records attributed to J W Shay.

At least 145 records · Page 8Linked to original sources
PubMed1995

Time, telomeres and tumours: is cellular senescence more than an anticancer mechanism?

Normal diploid cells, by definition, have a limited life span: they senesce after a set number of divisions both in vivo and in culture. It has been hypothesized that the molecular mechanism that measures the life span of a cell probably involves the shortening of telomeres that occurs with each round of DNA replication. This loss of telomeres is thought to induce antiproliferative signals that result in the induction of cellular senescence. In this article, Woodring Wright and Jerry Shay present a hypothesis for the mechanisms by which telomere shortening regulates cellular physiology and argue that cellular senescence is not only an anticancer mechanism but is also the cause of many of the degenerative changes of aging.

Journal Article↗
PubMed1995

Aging and cancer: are telomeres and telomerase the connection?

There is substantial evidence for the progressive loss of the telomeric ends of chromosomes during aging, both in cell culture and in vivo. The loss of telomeres may eventually induce antiproliferative signals that result in cellular senescence. A hypothesis gaining prominence is that the activation of telomerase, a ribonucleoprotein enzyme that is important in maintaining telomere length stability, is necessary for the sustained growth of most tumors. The interrelationships between telomere shortening and aging, and how activation of telomerase may be necessary for cells to become immortal and malignant, are reviewed here.

Aging↗
PubMed1995

Correlating telomerase activity levels with human neuroblastoma outcomes.

Telomerase activity was analysed in 100 neuroblastoma cases. Although telomerase activity was not detected in normal adrenal tissues or benign ganglioneuromas, almost all neuroblastomas (94%) did express it, suggesting an important role for telomerase in neuroblastoma development. Neuroblastomas with high telomerase activity had other genetic changes (for example, N-myc amplification) and an unfavourable prognosis, whereas tumours with low telomerase activity were devoid of such genetic alterations and were associated with a favourable prognosis. Three neuroblastomas lacking telomerase activity regressed (stage IVS). Thus telomerase expression may be required as a critical step in the multigenetic process of tumorigenesis, and two different pathways may exist for the development of neuroblastoma.

Adrenal Gland Neoplasms↗
PubMed1995

Involvement of pRB family in TGF beta-dependent epithelial cell hypertrophy.

Although renal hypertrophy is often associated with the progressive loss of renal function, the mechanism of hypertrophy is poorly understood. In both primary cultures of rabbit proximal tubules and NRK-52E cells (a renal epithelial cell line), transforming growth factor beta 1 (TGF beta) converted epidermal growth factor (EGF)-induced hyperplasia into hypertrophy. TGF beta did not affect EGF-induced increases in c-fos mRNA abundance or cyclin E protein abundance, but inhibited EGF-induced entry into S, G2, and M phases. EGF alone increased the amount of hyperphosphorylated (inactive) pRB; TGF beta blocked EGF-induced pRB phosphorylation, maintaining pRB in the active form. To determine the importance of active pRB in TGF beta-induced hypertrophy, NRK-52E cells were infected with SV40 large T antigen (which inactivates pRB and related proteins and p53), HPV16 E6 (which degrades p53), HPV16 E7 (which binds and inactivates pRB and related proteins), or both HPV16 E6 and E7. In SV40 large T antigen expressing clones, the magnitude of EGF + TGF beta-induced hypertrophy was inhibited and was inversely related to the magnitude of SV40 large T antigen expression. In the HPV16-infected cells, EGF + TGF beta-induced hypertrophy was inhibited in E7- and E6E7-expressing, but not E6-expressing cells. These results suggest a requirement for active pRB in the development of EGF + TGF beta-induced renal epithelial cell hypertrophy. We suggest a model of renal cell hypertrophy mediated by EGF-induced entry into the cell cycle with TGF beta-induced blockade at G1/S, the latter due to maintained activity of pRB or a related protein.

Animals↗
PubMed1995

Restoration of the cellular senescence program and repression of telomerase by human chromosome 3.

Telomeres, at the end of chromosomes, shorten with each cell division, resulting in cellular senescence. Tumor cells, unlike normal somatic cells, express a telomerase that maintains the telomere length. Deletion of a gene(s) on chromosome 3 is common in human renal cell carcinoma (RCC) and reintroduction of a normal chromosome 3 into an RCC immortal cell line restored the program of cellular senescence. The loss of indefinite growth potential was associated with the loss of telomerase activity and shortening of telomeres in the RCC cells with a normal chromosome 3. However, microcell hybrids that escaped from senescence and microcell hybrids with an introduced chromosome 7 or 11 maintained telomere lengths and telomerase activity similar to those of the parental RCC23. Thus, restoration of the cellular senescence program by chromosome 3 is associated with repression of telomerase function in RCC cells.

Base Sequence↗
PubMed1995

Spontaneous in vitro immortalization of breast epithelial cells from a patient with Li-Fraumeni syndrome.

Individuals with germ line mutations in the p53 gene, such as Li-Fraumeni syndrome (LFS), have an increased occurrence of many types of cancer, including an unusually high incidence of breast cancer. This report documents that normal breast epithelial cells obtained from a patient with LFS (with a mutation at codon 133 of the p53 gene) spontaneously immortalized in cell culture while the breast stromal fibroblasts from this same patient did not. Spontaneous immortalization of human cells in vitro is an extremely rare event. This is the first documented case of the spontaneous immortalization of breast epithelial cells from a patient with LFS in culture. LFS patient breast stromal fibroblasts infected with a retroviral vector containing human papillomavirus type 16 E7 alone were able to immortalize, whereas stromal cells obtained from patients with wild-type p53, similarly infected with human papillomavirus type 16 E7, did not. The present results indicate a protective role of normal pRb-like functions in breast stromal fibroblasts but not in breast epithelial cells and reinforces an important role of wild-type p53 in the regulation of the normal growth and development of breast epithelial tissue.

Adult↗
PubMed1995

Telomerase activity in preneoplastic and neoplastic gastric and colorectal lesions.

Recent evidence indicates that telomerase activity may be necessary for cell immortality, which is required for the sustained and indefinite growth of most malignant cells. We analyzed telomerase activity in gastric and colorectal cancers and in gastric and colorectal precancerous lesions to determine whether malignant progression depends on the activation of telomerase and at what stage of carcinogenesis cells have detectable telomerase activity. Telomerase activity was measured by the telomeric repeat amplification protocol assay and was detected in 17 (85%) of 20 primary gastric carcinoma tissues and in 19 (95%) of 20 primary colorectal carcinomas, regardless of tumor staging and histological types. All nodal metastases, peritoneal metastases, and a recurrent gastric cancer tumor were positive. All cell lines established from gastric and colorectal cancers contained telomerase activity. In precancerous lesions, 10 (100%) of 10 colorectal tubular adenomas were telomerase positive, in addition to 3 (23%) of 13 gastric intestinal metaplasias and 1 (50%) of 2 gastric adenomas, whereas the corresponding gastric normal mucosas as well as colorectal mucosas were negative. These results indicate overall that reactivation of telomerase may occur at an early stage of carcinogenesis and may correlate well with malignant progression of gastric cancer. Telomerase activity thus may serve as a powerful additional tool for cancer diagnosis.

Adenocarcinoma↗
PubMed1994

Specific association of human telomerase activity with immortal cells and cancer.

Synthesis of DNA at chromosome ends by telomerase may be necessary for indefinite proliferation of human cells. A highly sensitive assay for measuring telomerase activity was developed. In cultured cells representing 18 different human tissues, 98 of 100 immortal and none of 22 mortal populations were positive for telomerase. Similarly, 90 of 101 biopsies representing 12 human tumor types and none of 50 normal somatic tissues were positive. Normal ovaries and testes were positive, but benign tumors such as fibroids were negative. Thus, telomerase appears to be stringently repressed in normal human somatic tissues but reactivated in cancer, where immortal cells are likely required to maintain tumor growth.

Base Sequence↗
PubMed1994

Transcriptional repression of the D-type cyclin-dependent kinase inhibitor p16 by the retinoblastoma susceptibility gene product pRb.

Progression of the eukaryotic cell division cycle is regulated by a series of structurally related serine/threonine protein kinases known as cyclin-dependent kinases (CDKs). The D-type cyclin-dependent kinases, CDK4 and CDK6, have been strongly implicated in the control of G1 progression and the phosphorylation of the retinoblastoma protein, pRb. The formation of complexes and enzymatic activity of cyclin D-CDK4 and cyclin D-CDK6 kinases is negatively regulated by p16INK4 (MTS1/CDK4I/CDKN2) via its specific interaction with CDK4 and CDK6 catalytic subunits. Here we report that the p16 mRNA accumulates to a high level in cells lacking pRb function and transcription of p16 is repressed by pRb. Our results provide evidence supporting a feedback regulatory loop involving pRb, p16, and cyclin-dependent kinases.

Cyclin-Dependent Kinase 4↗
PubMed1994

Differential expression and cell cycle regulation of the cyclin-dependent kinase 4 inhibitor p16Ink4.

p16Ink4 (inhibitor of cyclin-dependent kinase 4) is a cell cycle regulator that specifically binds to and inhibits Cdk4. Recently, the human mts1 (multiple tumor suppressor 1) gene, deleted or mutated in various primary tumors and in a large number of transformed cell lines, was found to be identical to ink4. In this study we have surveyed by immunoblotting the protein levels of p16Ink4 in normal and transformed human cells. We determined that p16Ink4 was differentially expressed in diploid cells derived from different tissues, in contrast to another cell cycle inhibitor, p21Waf1, which is ubiquitously expressed. In some tumor cell lines p16Ink4 protein was not detected, presumably because of a homozygous deletion of its gene. By contrast, it was found to be overexpressed in other cell lines when compared to levels in their normal counterparts. Interestingly, high levels of p16Ink4 protein correlated with functional inactivation of the retinoblastoma gene product. We also found that p16Ink4 protein expression varies during the cell cycle peaking during S phase. These results show a functional relationship between p16Ink4 and the retinoblastoma gene product and indicate that p16Ink4 is required for Cdk4 inhibition only at the G1-S transition at the time when Cdk4 kinase activity is no longer necessary.

Carrier Proteins↗
PubMed1994

A temperature-sensitive mutant of human p53.

We discovered that the human 'hot-spot' p53 mutant 143Ala is temperature sensitive for the binding of two DNA elements and for mediating the transcription of a downstream luciferase reporter gene. At 32.5 degrees C, 143Ala possesses strong DNA binding ability. In addition, its transcriptional activities are stronger than those of wild-type p53. At 37.5 degrees C, however, both the mutant's DNA binding and transcriptional activation functions are greatly reduced or abolished. The activity differences correlate with the presence of two conformational states of p53, which are recognized by monoclonal antibodies: at 32.5 degrees C, 143Ala is recognized by PAb1620, which is specific for the wild-type conformation, whereas at 37.5 degrees C, 143Ala is almost undetectable by PAb1620-mediated immunoprecipitation. Although 143Ala's binding to p53 DNA recognition elements and its activation of reporter gene transcription at 32.5 degrees C is markedly higher than that of the wild-type p53, 143Ala inhibited proliferation less robustly than wild-type p53 and it did not increase inhibition of ras-induced focus formation. These results indicate a partial correlation between the events involved in transcriptional activation and events involved in the proliferation suppression of p53. 143Ala therefore will be of use in dissecting the relationship between the structure of p53 and its different cellular functions.

Animals↗
PubMed1994

Transformation of human granulosa cells with the E6 and E7 regions of human papillomavirus.

Ovarian granulosa cells are the primary site of estrogen and progesterone synthesis and play an essential role in the maturation of the developing ovum. Freshly isolated granulosa cells are often used to study the regulation of steroid and protein biosynthesis, but the small number of cells available for these cultures has proven inadequate for many detailed gene regulatory studies. The goal of this study was to develop human granulosa (HG) cell lines that maintain differentiated function. The E6 and E7 open reading frames of high risk strains of human papillomavirus have been used to produce immortalized cell lines. Primary cultures of human luteinized granulosa cells were infected with defective retroviruses containing the E6 and E7 regions of human papillomavirus 16 and with the neomycin phosphotransferase gene to confer G418 resistance. Three of eight clones that were isolated after selection in medium containing G418 were found to produce progesterone following treatment with forskolin or dibutyryl cAMP for 48 h. Forskolin caused these cells to retract in the characteristic rounding response, as described in primary HG cultures. One clone, HGL5, was used for a detailed characterization of differentiated function. HGL5 cells retained the ability to increase progesterone production and convert exogenously added androstenedione to estradiol in response to agonists of the protein kinase-A pathway (forskolin and dibutyryl cAMP), but were not responsive to FSH or LH treatment. A key enzyme in the production of estradiol, cytochrome P450 aromatase, has proven difficult to maintain in long term cultures of granulosa cells. For that reason, we examined the expression of aromatase in the transformed HGL5 clone by monitoring mRNA levels. Aromatase mRNA increased by 4- to 5-fold after forskolin treatment, as determined by Northern analysis. This human granulosa cell culture line maintains many of the functions of normal cells and should provide an important model to study the molecular events controlling granulosa cell differentiation and function.

Aromatase↗
PubMed1994

Hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), and their receptors in human breast cells and tissues: alternative receptors.

We sought to determine whether the hepatocyte growth factor/scatter factor (HGF/SF)- and keratinocyte growth factor-receptor systems were expressed in normal breast cells, breast carcinoma cell lines, normal breast tissues, and breast cancer tissues. Reverse transcriptase-polymerase chain reaction and hot blotting were used to detect HGF, HGF/SF (met) receptor, KGF, and KGF receptor mRNAs in human mammary epithelial (HME) and stromal (HMS) cells. We also examined breast carcinoma (MDA-MB-157, SCC 38, and SCC 70) and spontaneously immortalized breast epithelial (HMT 3522) cell lines, as well as normal breast and breast carcinoma tissues. PCR products were also confirmed by nucleic acid sequencing. The effects of HGF and KGF, compared to EGF and heparin-binding EGF, on the proliferation of normal human mammary epithelial cells in serum-free defined medium was determined by cell counting. HGF and KGF mRNAs were detected in HMS cells, but not HME cells. KGF receptor mRNA was detected in HME cells, but not HMS cells. HGF/SF receptor mRNA was detected in both HME and HMS cells. mRNAs were also detected in normal breast and breast carcinoma tissues, as well as breast carcinoma and transformed breast epithelial cell lines. Alternative cDNA sequences that are predicted to code for a soluble KGF receptor and a membrane bound, truncated HGF/SF receptor were detected in breast epithelial cells and breast tissues. HGF and KGF maintained viability and stimulated proliferation of HME cells.

Adult↗
PubMed1994

Differential expression and regulation of Cyclin D1 protein in normal and tumor human cells: association with Cdk4 is required for Cyclin D1 function in G1 progression.

In this study we have surveyed by immunoblotting the protein levels of Cyclin D1, D2, D3 and their catalytic partners, Cdk4 and Cdk6 in normal and transformed human cells. We found that all these proteins were differentially expressed in diploid cells derived from different tissues, in contrast to Cyclin E, Cyclin A and Cdk2 which are ubiquitously expressed. D-type Cyclins were never dramatically overexpressed and often very poorly expressed in tumor cell lines when compared to the levels in their normal counterparts. In contrast, Cdk4 was expressed at high levels in several tumor cell lines and Cdk6 was ectopically expressed in two sarcoma lines, suggesting a possible involvement of these two Cdks in oncogenesis. Interestingly, low levels of Cyclin D1 and D3 proteins always correlated with functional inactivation of the retinoblastoma gene product (pRb). In cells displaying active pRb, Cyclin D1 was found associated with Cdk4 regardless of whether the p53 gene was wild-type or mutant. Microinjection during G1 of Cyclin D1 anti-sense cDNA or anti-Cyclin D1 antibody in these cells arrested the cell cycle in G1. In cells lacking pRb function, Cyclin D1 was dissociated from Cdk4. Microinjection during G1 of Cyclin D1 antisense cDNA or anti-Cyclin D1 antibody in these cells did not affect G1 progression. These results show that (i) in the absence of pRb, Cyclin D1 is expressed at low levels, is dissociated from Cdk4 and becomes dispensable in G1; (ii) Cyclin D1 needs to be associated with its catalytic subunit, Cdk4, to function as a positive regulator of G1 progression.

CDC2 Protein Kinase↗
PubMed1993

Inactive p53 mutants may enhance the transcriptional activity of wild-type p53.

The p53 mutants 248Trp, 175His, and 281Gly fail to activate transcription mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chronic myelogenous leukemia cells. The p53 mutants enhanced the p53CON-mediated gene expression of wild-type p53 but decreased the wild-type p53-activated transcription mediated by ribosomal gene cluster. Thus, p53CON and ribosomal gene cluster represent distinct p53-binding elements. Furthermore, p53 mutants may affect the transcriptional activity of wild-type p53 in either a dominant positive or a dominant negative manner, depending on the binding element present.

Amino Acid Sequence↗
PubMed1993

The frequency of immortalization of human fibroblasts and mammary epithelial cells transfected with SV40 large T-antigen.

SV40 T-antigen-expressing human cells generally have an extension of lifespan until a period called "crisis" begins. On rare occasions a clone of cells emerges from the population in crisis and gives rise to an immortalized cell line. The present study compares the frequency of immortalization of cells from two different human lineages, lung fibroblasts and mammary epithelial cells. Most of the T-antigen-transfected clones from both cell types failed to immortalize, however, within those clones which were immortalization-competent the frequency of escape from crisis was found to be much higher (10(-5)) in mammary epithelial cells than in human fibroblasts (3 x 10(-7)). The frequency of escape from crisis in fibroblasts could be increased by chemical mutagenesis or by infection with a defective retrovirus. T-antigen-transfected fibroblasts were uniformly highly aneuploid both before and after crisis. In contrast, many SV40 T-antigen- and human papilloma virus 16 E6- or E6/E7-transfected mammary epithelial clones maintained a subpopulation of pseudodiploid cells prior to crisis, and the immortal cells that emerged following crisis were generally pseudodiploid. The higher frequency of escape from crisis in mammary epithelial cells is best explained by postulating a mutational inactivation of one allele of a critical gene followed by the elimination of the remaining wild-type alleles, with a much higher frequency of this second event in mammary epithelial cells due to their reduced ploidy compared to that in T-antigen-transfected fibroblasts. The results are discussed in terms of the regulation of telomerase activity and the M1/M2 model of cellular senescence.

Antigens, Polyomavirus Transforming↗
PubMed1993

Toward a molecular understanding of human breast cancer: a hypothesis.

A rate limiting step in most metastatic breast cancers is the development of unlimited proliferative potential by mammary epithelial cells. We describe mechanisms by which these cells can attain this state. The two independent mortality mechanisms controlling fibroblast senescence and immortalization (M1 and M2) are also found in human mammary epithelial cells. However, although both p53 and Rb are involved in the M1 mechanism of fibroblast cellular senescence, in human mammary epithelial cells only p53 is involved. The M1/M2 mechanisms may be induced by the gradual loss of telomere ends that occur as normal cells divide. Loss of telomere ends may result in genomic instability and in altered gene expression due to heterochromatin changes in subtelomeric regions. Events which can abrogate p53 functions are described, as is the current state of knowledge about the function of p53. All these factors are included in a molecular model for the onset of breast cancer.

Breast Neoplasms↗