Search PubMed⌕ Search

Biomedical subjects

J Brown

Publications and source records attributed to J Brown.

At least 667 records · Page 37Linked to original sources
PubMed1991

Curricula of doctoral programs in nursing.

Each doctoral program possesses unique features that reflect the special characteristics of the faculty, the environment, and the students of its respective institution. This study focused more narrowly on the formalized structure of programs of study available in printed literature which does not fully capture the richness of doctoral education. While most doctoral programs in this country appear to possess curricular elements of quality previously identified by AACN with respect to curricular issues in the areas of research, theory construction, and philosophy, there was much more variation in the curricular content focusing on areas of substantive nursing knowledge, and data management, tools, and technology.

Curriculum↗
PubMed1991

Effects of bacterial infection and castration on prostatic tissue zinc concentration in dogs.

An Escherichia coli bacterial prostatitis was experimentally induced to determine the effect of bacterial infection on prostatic tissue zinc concentrations in castrated and gonadally intact male dogs. Five of the 22 mixed-breed dogs (group 1) had no culture evidence of infection 2 weeks after the instillation of bacteria into the prostate gland. The remaining 17 infected dogs were allotted to 2 groups; 1 group of dogs was subjected to castration (group CA, 7 dogs), and the other group of dogs was subjected to sham operation (group SO, 10 days). The groups were divided into groups of dogs with prostatic infection at necropsy (groups CA-I and SO-I), and those dogs without prostatic infection at necropsy (groups CA-N and SO-N). Urine, prostatic fluid, and prostatic tissue (week 0, 7, +/- 12) specimens were obtained for bacteriologic culturing to determine whether prostatic infection was present. Prostatic tissue was obtained at necropsy (week less than 6, 7, or 12) for analysis of zinc concentration by atomic absorption spectrophotometry. The logarithmic mean prostatic tissue zinc concentrations were compared between groups. Group CA had a significantly lower prostatic zinc concentration than all other groups. Zinc concentrations were not statistically different between any of the other groups. Castration did decrease the prostatic tissue concentration of zinc, a known natural antibacterial factor. However, resistance to infection and resolution of infection were not correlated with prostatic tissue zinc concentrations in this experimental model.

Analysis of Variance↗
PubMed1991

Effects of mechanical and pharmacologic manipulations on portal pressure, central venous pressure, and heart rate in dogs.

Central venous pressure (CVP), portal pressure (PP), and heart rate (HR) were monitored in 6 female, sexually intact, middle-age Beagles during temporary portal vein obstruction, anesthetic recovery, abdominal bandaging, and propranolol administration. Intraoperative baseline PP was 7.3 mm of Hg (+/- 1.7 SD). Portal pressure was significantly increased throughout portal vein occlusion, but returned to baseline values 2 minutes after release of the ligature. Central venous pressure was significantly decreased throughout portal vein occlusion, but did not differ significantly from baseline values 3 minutes after release of the portal vein ligature. Portal pressure increased significantly (8 +/- 3.3 mm of Hg) over baseline values after application of an abdominal bandage; however, CVP did not change significantly. During postoperative monitoring, CVP and PP did not change significantly from respective 18-hour mean postoperative values in resting dogs. At 60 and 75 minutes after surgery, heart rate was significantly increased over the 18-hour mean. Portal pressure and CVP, respectively, were significantly increased over intraoperative baseline values in the first hour and the first 8 hours after surgery. Postoperative CVP and HR were significantly correlated. Individual measurements of PP in dogs that were abdominal pressing during barking or defecation were significantly increased (9 +/- 3 mm of Hg) above measurements taken after cessation of abdominal press. Portal pressure measurements in standing dogs decreased 7.5 +/- 2 mm of Hg, compared with measurements of the same dog in lateral recumbency. Central venous pressure was inaccurate in dogs performing abdominal press. Portal pressure did not decrease significantly from baseline after injection of propranolol (2 mg/kg, IV).(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed1991

Comparison of phenotypic characteristics of Salmonella spp isolated from healthy and ill (infected) chickens.

Phenotypic characteristics of 12 paired, Salmonella serotypes isolated from healthy and ill chickens were compared. Variables compared included antibiotic resistance profiles, production of colicins and siderophores, mannose-sensitive hemagglutination of erythrocytes, resistance to serum complement, carbon source utilization, presence and transmissibility of R plasmids, and invasiveness in primary chicken kidney cell culture. Differences were found between pairs for utilization of carbon sources, mannose-sensitive hemagglutination of erythrocytes, and invasiveness in cell culture.

Animals↗
PubMed1990

The protean manifestations of hemorrhagic fever with renal syndrome. A retrospective review of 26 cases from Korea.

Twenty-six cases of hemorrhagic fever with renal syndrome from 1981 to 1986 were retrospectively reviewed to determine the scope of clinical presentation and the unique complications of the illness. The diagnosis was confirmed by detection of Hantaan virus antibody in 25 cases and by characteristic autopsy findings in 1 case. The illness could be classified into three distinct clinical subgroups. Fever was universally present. Two patients presented with intractable shock and diffuse hemorrhage and died within 6 days from multi-organ system failure, mimicking the clinical picture of overwhelming sepsis. Eighteen patients presented with acute renal failure with an illness lasting a mean of 21 days (range, 10 to 36 days). Resolution of thrombocytopenia heralded recovery of renal function. At discharge, the serum creatinine level was normal in 13 patients; 5 patients had evidence of minimal renal dysfunction. Acute pulmonary edema requiring hemodialysis and retroperitoneal hemorrhage were the major complications in this subgroup. Six patients had an undifferentiated febrile illness with normal renal function. Fever, thrombocytopenia, abnormal urinalysis, hypertransaminasemia, and a benign clinical course characterized the third clinical pattern. The recent availability of serodiagnostic methods to detect Hantavirus group antibody facilitates the diagnosis of hemorrhagic fever with renal syndrome. Application of this test in the described clinical settings will identify unsuspected cases, broaden the knowledge of the geographic distribution of Hantavirus infection, and increase physician awareness of its protean manifestations.

Acute Kidney Injury↗
PubMed1990

Tumour-induced host stromal-cell transformation: induction of mouse spindle-cell fibrosarcoma not mediated by gene transfer.

Tumour-induced host-cell transformation has been addressed by examining human tumours in situ and following xenograft to nude mice. We have found evidence for the transformation of host stromal fibroblasts both in vivo and following the introduction of the tumours to in vitro culture. The in vitro culture of one such xenograft--derived from a human prostatic adenocarcinoma--resulted in the outgrowth of a transformed aneuploid mouse cell line. This transformed line was tumourigenic both in BALB/c nu/nu (nude) mice and in heterozygous nu/+mice, with the morphology of a spindle-cell sarcoma. The cell line did not express human isozymes or human histocompatibility antigens, nor were human chromosomes present. Moreover, human DNA sequences were not detected by human Alu repeat sequence element probing in the transformed cell line grown either in vitro or in vivo. The line contained retroviral long terminal repeat sequences but there was no evidence of proviral activation. These findings indicate that tumour cells may cause transformation of neighbouring stromal cells; that this transformation may proceed in the absence of DNA transfer or activation of endogenous proviruses; and that the means of this observed transformation may involve humoral factors elaborated by the tumour cells.

Adenocarcinoma↗
PubMed1990

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

Base Sequence↗
PubMed1990

Regeneration and soma size changes following axotomy of the trochlear nerve.

The effects of CNS and PNS axotomy of the IVth nerve on cell death, soma size, axon size, and axon number were investigated. In adult cats, the IVth nerve was axotomised by using four surgical paradigms: (1) peripheral IVth nerve crush, (2) peripheral IVth nerve cut, (3) peripheral IVth nerve resection, and (4) a CNS IVth nerve cut in the velum. The extent of cell death resulting from each surgical paradigm was determined. Following axotomy distal to the decussation of the IVth nerves, cell death was least after nerve crush, intermediate after nerve cut, and maximal after resection of 5-7 mm of the nerve. Following axotomy at the decussation--a CNS lesion--most cells died but some successful regeneration was observed. Soma size measurements following a short-term survival (3 days to 4 weeks) before the regenerating axons reached their target muscle revealed that somas of axotomised cells underwent hypotrophy within 1 week of axotomy and then gradually increased in size. They re-attained normal size by 4 weeks postoperative when regenerating axons first reach their target. Following a long-term survival (greater than 2 months), somas were significantly hypertrophied, and the degree of hypertrophy was inversely related to the extent of cell survival up to a limit of 40% soma size increase. Counts and measurements of axons revealed that mean axon diameter of regenerated axons was much smaller than normal 3 months after axotomy, increased during the third to sixth postoperative months, but then showed no subsequent increase and remained below normal. In animals with cell death varying from 10% to 70%, the number of axons in the nerve was maintained constant at approximately 1,000. These data indicate that there is a mechanism for the production and maintenance of the appropriate number of regenerative axonal branches following axotomy. In animals in which cell death exceeded 70%, the number of axons was controlled by a maximum ratio of 3 to 4 axon branches per surviving cell. The results suggest that axon number is strongly influenced by the target muscle and that hypertrophy of regenerated cells is related to the number of axonal sprouts each cell has to produce and support in order to re-establish the preoperative number of axons in the regenerated trochlear nerve.

Animals↗
PubMed1990

Clinical evaluation of a cryptococcal antigen latex agglutination test for diagnosis of cryptococcosis in cats.

A commercial cryptococcal antigen latex agglutination test was used to evaluate sera from 20 cats with cryptococcosis and 184 cats without cryptococcosis. Cryptococcal antigen was detected in the sera from 19 of 20 cats with cryptococcosis. Antigen was not detected in sera from any of the cats without cryptococcosis. The test had sensitivity of 95% and specificity of 100%.

Animals↗
PubMed1990

Effect of atrial natriuretic peptide on renin release in rat isolated glomeruli.

Effects of atrial natriuretic peptide (ANP) on renin release in isolated rat glomeruli were investigated. ANP suppressed renin release by 25% at 5 x 10(-8) M when glomeruli were incubated in a medium containing 1.26 mM calcium (p = 0.0019). When glomeruli were incubated in a calcium free medium containing 2 mM EGTA, ANP suppressed stimulated renin release significantly at 5 x 10(-8) and 5 x 10(-9) M by 25% (p = 0.0204, and p = 0.0101, respectively). These results indicate that ANP suppresses renin release in a dose dependent manner, probably through a calcium independent process.

Animals↗
PubMed1990

Binding of atrial and brain natriuretic peptides in brains of hypertensive rats.

Displacement of bound [125I]alpha-atrial natriuretic peptide (alpha-ANP) by brain natriuretic peptide (BNP) was used to map receptors common to both peptides in rat brain by in vitro autoradiography. Both spontaneously hypertensive rats (SHR) and the normotensive Wistar-Kyoto control strain (WKY) were studied. In both strains, [125I]alpha-ANP bound densely to subfornical organ, choroid plexus and arachnoid mater. Binding at these sites in either strain was displaced similarly by 1 microM unlabelled alpha-ANP or BNP. However, no [125I]alpha-ANP was displaced by peptides unrelated to alpha-ANP or BNP. In WKY, both alpha-ANP and BNP competed with similarly high affinities for binding sites occupied by [125I]alpha-ANP. This was also true for SHR. However, SHR showed a substantial reduction in the maximum number of binding sites in the subfornical organ and choroid plexus which were competed for by the peptides. Therefore, BNP may be a significant high affinity ligand for brain receptors previously thought specific for atrial natriuretic peptides, including receptors which vary between WKY and SHR.

Animals↗
PubMed1990

Left ventricular hypertrophy in men with normal blood pressure: relation to exaggerated blood pressure response to exercise.

OBJECTIVE: To determine whether normal, nonhypertensive subjects who have unusually large increases of systolic blood pressure with exercise have left ventricular hypertrophy (LVH). DESIGN: Case-comparison using echocardiography as a criterion standard for measurement of left ventricular mass and the diagnosis of LVH. SETTING: Population-based health fitness screening program and referral Veterans Affairs Hospital. SUBJECTS: Thirty-nine men (average age, 44.6 +/- 8.5 years; range, 34 to 71 years) were studied, including 25 participants in a health fitness screening program and an additional 14 normal men with atypical chest pain. Twenty-two subjects with a systolic blood pressure during peak exercise of 210 mm Hg or greater were compared with 17 others with systolic pressure less than 210 mm Hg during exercise. MEASUREMENTS AND MAIN RESULTS: Left ventricular hypertrophy (left ventricular mass index greater than 134 g/m2) was found in 14 of 22 men with a systolic blood pressure of 210 mm Hg or greater (present in 6.3% of normotensive healthy male volunteers in a health screening program) but in only 1 person with a lower exercise blood pressure. Left ventricular mass index was linearly correlated (r = 0.65, n = 39, P less than 0.001) with maximum exercise blood pressure. Whereas LVH was mild in about 50%, substantial LVH was present in the others. The presence of LVH was not related to superior physical conditioning and was accompanied by increased left atrial size suggesting impaired left ventricular filling. CONCLUSIONS: Even in the absence of hypertension, exaggerated blood pressure responses during exercise testing suggest a probability of 0.64 (95% CI, 0.41 to 0.83) of LVH, a finding associated with the cardiac "end-organ" manifestations of hypertension.

Adult↗
PubMed1990

Beta-lactam antibiotic biosynthetic genes have been conserved in clusters in prokaryotes and eukaryotes.

A cosmid clone containing closely linked beta-lactam antibiotic biosynthetic genes was isolated from a gene library of Flavobacterium sp. SC 12,154. The location within the cluster of the DNA thought to contain the gene for delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase (ACVS), the first step in the beta-lactam antibiotic biosynthetic pathway, was identified by a novel method. This DNA facilitated the isolation, by cross-hybridization, of the corresponding DNA from Streptomyces clavuligerus ATCC 27064, Penicillium chrysogenum Oli13 and Aspergillus nidulans R153. Evidence was obtained which confirmed that the cross-hybridizing sequences contained the ACVS gene. In each case the ACVS gene was found to be closely linked to other beta-lactam biosynthetic genes and constituted part of a gene cluster.

Anti-Bacterial Agents↗
PubMed1990

DOPA decarboxylase inhibition does not influence the diuretic and natriuretic response to exogenous alpha-atrial natriuretic peptide in man.

The role of dopamine synthesis in the renal actions of human alpha-atrial natriuretic peptide (alpha ANP) was investigated in six dehydrated volunteers using the DOPA decarboxylase inhibitor carbidopa. Each subject received oral placebo or carbidopa (100 mg) followed by an infusion of alpha ANP 10 pmol.kg-1.min-1 for 1 h. The responses to placebo alone and to carbidopa alone were investigated on separate occasions. alpha ANP produced a similar increase in plasma immunoreactive alpha ANP whether placebo or carbidopa pretreatment had been given. Urinary dopamine excretion was increased by alpha ANP. Carbidopa pretreatment substantially attenuated this increase without affecting the natriuretic or water-diuretic response to alpha ANP. Carbidopa also failed to alter the change in filtration fraction produced by alpha ANP. The results suggest that increased synthesis of intrarenal dopamine is not required for the renal effects of alpha ANP in man.

Adult↗
PubMed1990

Spatial and biological characterisation of the complete quinic acid utilisation gene cluster in Aspergillus nidulans.

Heterologous probing of restriction digests of chromosomal DNA from Aspergillus nidulans with radioactively labelled probes encoding dehydroshikimate dehydratase (QA-4) and a repressor gene (QA1-S) from Neurospora crassa revealed a pattern of hybridisation inconsistent with an equivalent single copy of each gene in A. nidulans. Screening of size-selected and total genome A. nidulans DNA libraries allowed the isolation of four unique classes of sequence, two of which hybridised to the QA-4 probe, and two of which hybridised to the QA1-S probe. In each case, one of each pair of unique sequences was able to complement the equivalent mutations qutC (= QA-4) and qutR (= QA1-S) in A. nidulans, whereas the second of each pair was unable to complement the same mutation. The complementing sequences were physically mapped relative to the previously cloned A. nidulans QUT gene cluster, demonstrating that QUTR is distal and divergently transcribed from QUTA with approximately 3.6 kb between the ATG translational start codons, and that QUTC is transcribed in the same direction as QUTD on the other side of the cluster, approximately 1.65 kb downstream of the QUTD TAA translational stop signal. The physical and genetic maps of the QUT gene cluster correlate precisely. The non-complementing A. nidulans DNA sequences that hybridise to the N. crassa QA-4 (= QUTC) and QA1-S (= QUTR) fulfill many of the criteria characteristic of pseudogenes.(ABSTRACT TRUNCATED AT 250 WORDS)

Amino Acid Sequence↗