Search PubMed⌕ Search

Biomedical subjects

G Manzini

Publications and source records attributed to G Manzini.

At least 37 records · Page 2Linked to original sources
PubMed1991

Effect of 5-methylcytosine on the stability of triple-stranded DNA--a thermodynamic study.

We have previously shown that the pyrimidine oligonucleotide 5'CTTCCTCCTCT (Y11) recognizes the double-helical stem of hairpin 5'GAAGGAGGAGA-T4-TCTCCTCCTTC (h26) by triple-helix formation (1). In this paper, we report the effect on triplex formation of substituting the cytosine residues of Y11 with 5-methylcytosines (5meY11). In addition, we have studied the thermodynamics of the interaction between h26 and 5meY11. The results can be summarised as follows: (i) gel electrophoresis shows that at T = 5 degrees C and pH 5, both Y11 and 5meY11 form DNA triple helices with h26, whereas at pH 6.8 only the methylated strand binds to h26; (ii) pH-stability curves of the DNA triplexes formed from h26 + Y11 and h26 + 5meY11 show that Y11 and 5meY11 are semi-protonated at pH 5.7 and 6.7, respectively. Thus, it is concluded that cytosine methylation expands the pH range compatible with triplex formation by one pH unit; (iii) as the unmethylated triplex (h26:Y11), the methylated one (h26:5meY11) denatures in a biphasic manner, in which the low temperature transition results from the dissociation of 5meY11 from h26. The Tm of the triplex to h26 plus 5meY11 transition is strongly enhanced (about 10 degrees C) by cytosine methylation. A van 't Hoff analysis of denaturation curves is presented; (iv) DSC experiments show that triplex formation between 5meY11 and h26 is characterized by delta H = -237 +/- 25 kJ/mol and delta S = -758 +/- 75 J/Kmol, corresponding to an average delta H of -21 kJ/mol and delta S of -69 J/Kmol per Hoogsteen base pair; (v) the thermodynamic analysis indicates that the extra stability imparted to the triplex by methylcytosine is entropic in origin.

5-Methylcytosine↗
PubMed1991

DNA hairpin loops in solution. Correlation between primary structure, thermostability and reactivity with single-strand-specific nuclease from mung bean.

Hairpin structures formed by seven DNA inverted repeats have been studied by PAGE, UV(CD)-spectroscopy and nuclease cleavage. The hairpins consisted of (CG)3 stems and loops of 2, 3 and 4 residues. Thermal stabilities (Tm) have been determined in low and high ionic strength buffers, where the hairpins were structured in the B- and Z-DNA form respectively. The thermodynamic parameters of hairpin formation have been obtained by a two-state analysis of the hairpin-coil transitions. It is found that, on increasing the number of bases in the loop from 2 to 3 and 4, the Tms of the B-hairpins decrease, whereas the Tms of the same hairpins in the Z-form increase. This confirms previous evidence (1,2) that in a hairpin molecule the size and structure of the loop are modulated by the conformation of the helical stem. Moreover, B-hairpins with loops comprising 2, 3 and 4 bases have been digested with the single-strand-specific nuclease from mung bean. In our experimental conditions (0 degrees C) the nuclease preferentially cleaves the unbonded nucleotides of the loops. However, the rates of loop hydrolysis, which roughly follow a first-order kinetics, markedly depend on the size of the loop. At a ratio of 3 enzyme units/micrograms DNA, the half-lives of hairpins which are expected to form loops of 4, 3 and 2 residues are 90, 145 and 440 minutes respectively. Thermostability and enzymatic digestion data suggest that two-membered loops can be formed in B-hairpins but not in Z-hairpins.

Base Sequence↗
PubMed1991

Limiting-laws of polyelectrolyte solutions. Ionic distribution in mixed-valency counterions systems. I: The model.

An extension of the counterion-condensation (CC) theory of linear polyelectrolytes has been developed for the case of a system containing a mixture of counterions of different valency, i and j. The main assumption in the derivation of the model is that the relative amount of the condensed counterions of the type i and j is strongly correlated and it is determined by the overall physical bounds of the system. The results predicted by the model are consistent, in the limiting cases of single species component, with those of the original CC theory. The most striking results are obtained for the cases of low charge density and excess of counterion species: in particular, an apparent positive "binding" cooperativity of divalent ions is revealed for small, increasing additions of M2+ ions to a solution containing a swamping amount of monovalent salt and a polyelectrolyte of low charge density. Apparent "competitive binding" of mono- and divalent ions derives as a bare consequence of the electrostatic interactions. Theoretical calculations of experimentally accessible quantities, namely single-(counter) ion activity coefficients, confirm the surprising predictions at low charge density, which qualitatively agree with the measured quantities.

Journal Article↗
PubMed1990

Spectroscopic and calorimetric investigation on the DNA triplex formed by d(CTCTTCTTTCTTTTCTTTCTTCTC) and d(GAGAAGAAAGA) at acidic pH.

The equimolar mixture of d(CTCTTCTTTCTTTTCTTTCTTCTC) (dY24) and d(GAGAAGAAAGA) (dR11) [designated (dY24).(dR11)], forms at pH = 5 a DNA triplex, which mimicks the H-DNA structure. The DNA triplex was identified by the following criteria: (i) dY24 and dR11 co-migrate in a poly-acrylamide gel, with a mobility and a retardation coefficient comparable to those observed for an 11-triad DNA triplex, previously characterized in our laboratories (1); (ii) the intercalator ethidium bromide shows a poor affinity for (dR11).(dY24) at pH = 5, and a high affinity at pH = 8; (iii) the (dR11).(dY24) mixture is not a substrate for DNase I at pH = 5; (iv) the CD spectrum of (dR11).(dY24), at pH = 5, is consistent with those previously reported for triple-stranded DNA. The (dR11).(dY24) mixture exhibits a thermally induced co-operative transition, which appears to be monophasic, reversible and concentration dependent. This transition is attributed to the disruption of the DNA triplex into single strands. The enthalpy change of the triplex-coil transition was measured by DSC (delta Hcal = 129 +/- 6 kcal/mol) and, assuming a two-state model, by analysis of UV-denaturation curves (average of two methods delta HUV = 137 +/- 13 kcal/mol). Subtracting from delta Hcal of triplex formation the contributions due to the Watson-Crick helix and to the protonation of the C-residues, we found that each pyrimidine binding into the major groove of the duplex, through a Hoogsteen base pair, is accompanied by an average delta H = -5.8 +/- 0.6 kcal/mol. The effect on the stability of the (dR11).(dY24) triplex due to the substitution of a T:A:T triad with a T:T:T one was also investigated.

Base Sequence↗
PubMed1990

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior.

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

Base Sequence↗
PubMed1990

[Spontaneous esophageal rupture or Boerhaave's syndrome. Presentation of a case].

A case of spontaneous oesophageal rupture or Boerhaave syndrome is described. The absence of the typical initial vomiting together with a clinical picture that successively indicated repeated myocardial infarction, pancreatitis and pulmonary abscess delayed diagnosis by 4 days, after which emergency thoracotomy, performed on the identification of extravisceral overflow by contrast radiography using a water-soluble medium, revealed necrotic inflammation of the oesophagus, mediastinum and left lung that was so severe that only thoracic drainage was possible. After an initial improvement the patient died of septic shock on the 16th postoperative day.

Aged↗
PubMed1989

A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment.

The duplex of d(GGTACGCGCGTGCGCGATGG) and d(CCATCGCGCGTGCGCGTACC) containing an inverted repeat has been studied by spectroscopic and electrophoretic techniques. Prior to melting this DNA fragment, like many other palindromes, transforms into hairpin structures but with four non-self-complementary bases ("dangling ends") at their termini. Most surprisingly, it is found that these dangling ends promote an unusually facile hairpin-duplex interconversion in contrast to very slow ones found in all the "blunt end" palindromes studied so far. Kinetic studies provide evidence, for the first time in a linear DNA fragment, that a cruciform intermediate is involved in the hairpin to duplex interconversion.

Animals↗
PubMed1989

Hairpin structures in synthetic oligodeoxynucleotides: sequence effects on the duplex-to-hairpin transition.

We have synthesized and examined a number of fully and partly self-complementary palindromic oligodeoxynucleotides for their ability to assume in solution a unimolecular hairpin structure. The main results obtained by a combined optical and electrophoresis investigation show that: (i) DNA folding needs not be driven by mismatched base pairings over the dyad; fully self-complementary palindromic duplexes, comprising regular (CG)n DNA fragments, possess a considerable intrinsic propensity to make intramolecular base pairings; (ii) The duplex-hairpin interconversion is, in general, a slow process independent of the length and base composition of the palindrome; (iii) The palindromic sequences energetically least favored to form hairpin structures consist of C:G base pairs around the dyad axis and of T:A blocks in the arms of the inverted repeat; (IV) The base composition of the stem strongly influences the hairpin thermal stability. For instance, the substitution of one C:G with one A:T base pair in the stem helix of d(CG)7 diminishes the stability of the hairpin by 9 degrees C. It is found that the stability of the stem helix, in hairpins of defined sequence and with the same loop length, decreases in the order alternating-CG greater than homo-CG greater than AC(GT) greater than alternating-AT, i.e. as in polynucleotides. The thermodynamic parameters for the hairpin-coil transition are reported.

Base Composition↗
PubMed1989

The left-handed Z-DNA conformation in oligodeoxynucleotides containing different amounts of AT base pairs: a far UV circular dichroism study.

A number of fully self-complementary oligodeoxynucleotides have been synthesized and examined for their ability to assume the left-handed Z-DNA conformation in high salt solutions. The B- and Z-forms are identified by circular dichroism spectra, covering both the long- (220-300 nm) and short-wavelength (185-220 nm) regions, the latter showing CD bands very useful for identifying the sense of the helix winding. The main results of the study can be summarized as follows: a) sequences composed by AT and CG blocks do support the B to Z transition, even when the AT contents amounts to 50%; b) the occurrence of consecutive purine-purine or pyrimidine-pyrimidine dyads does not inhibit the B to Z transition, although a stronger reduction of water activity is required; c) (AC)n and (GT)n containing oligonucleotides do undergo the B to Z transition in solution; d) a millimolar quantity of Ni2+ concomitant with 5 M NaClO4 is found to be very effective in bringing about the B to Z transition in most of the sequences considered in this study.

Adenine↗
PubMed1988

Oligodeoxynucleotide folding in solution: loop size and stability of B-hairpins.

The secondary structures of the synthetic DNA fragments d(CGCGCGTTTTTCGCGCG) (T5), d(CGCGCGAAAAACGCGCG) (A5), d(CGCGCGTACGCGCG) (TA), and d(CGCGCGATCGCGCG) (AT) were investigated in a combined electrophoretic and spectroscopic study. All the oligomers exist, at low temperature and over a wide range of ionic strength (0.5-100 mM salt) and of nucleotide concentration [0.1-2.0 mM (phosphate)], as a mixture of two slowly interconverting species, identified as the dimeric duplex and the monomeric hairpin structure. The thermodynamic parameters for hairpin denaturation of T5, A5, TA, and AT and for duplex denaturation of d(CGCGCG) show that (a) the hairpins are more stable than the reference hexamer duplex at all accessible nucleotide concentrations; (b) the loop contributes favorably to the enthalpy change of hairpin denaturation in the four DNA fragments; (c) the base composition of the loop (A vs T) and the size of the loop (A5/T5 vs TA/AT) do not appreciably influence the enthalpic contents of the hairpins; (d) hairpins TA and AT, with two AT bases intervening in the CG self-complementary part of the molecule, exhibit a markedly higher thermal stability than hairpins T5 and A5, which is entropic in origin. These findings are consistent with the presence of two-residue loops in the tetradecamers TA and AT.

Base Composition↗
PubMed1988

The B-Z conformational transition in folded oligodeoxynucleotides: loop size and stability of Z-hairpins.

The capacity to assume a left-handed conformation and the thermodynamics of loop formation in concentrated aqueous NaClO4 have been investigated for the following palindromic sequences: d-(CGCGCGAAAAACGCGCG) (A5), d(CGCGCGTTTTTCGCGCG) (T5), d(CGCGCGTACGCGCG) (TA), and d(CGCGCGATCGCGCG) (AT). The results show that (a) each oligomer assumes a Z conformation upon exposure to increasing NaClO4 concentrations; the salt concentration at the transition midpoint is 1.8 M for both A5 and T5 and 3 and 3.5 M for TA and AT, respectively; (b) in high salt the four oligomers exist, over a wide range of nucleotide concentrations (up to 10(-3) M) and of temperature (greater than 0 degrees C), as unimolecular hairpin structures; (c) hairpins TA and AT exhibit, in buffer A, a lower thermal stability with respect to A5 and T5 (delta T about 16 degrees C), contrary to what is observed at low ionic strength; (d) on hairpin formation, the enthalpic term is about -52 kcal/mol for the two 17-mers and -38 kcal/mol for the two 14-mers, while the change in entropy is found to be around -150 eu for A5 and T5 and -115 eu for TA and AT. This thermodynamic picture suggests that a two-residue loop for TA and AT, found at low ionic strength [see preceding paper (Xodo, L.E., Manzini, G., Quadrifoglio, F., van der Marel, G.A., & van Boom, J.H. (1988) Biochemistry (preceding paper in this issue)], is substituted by a longer one including two additional residues from a missing dC.dG base pairing at the top of the stem.

Base Sequence↗
PubMed1988

The duplex-hairpin conformational transition of d(CGCGCGATCGCGCG) and d(CGCGCGTACGCGCG): a thermodynamic and kinetic study.

We have studied the duplex-hairpin conformational transition in two perfectly palindromic sequences, d(CGCGCGATCGCGCG)(I) and d(CGCGCGTACGCGCG)(II), by means of UV-melting, electrophoretic and T-jump experiments. Both tetradecamers exhibit biphasic thermal profiles. The lower temperature transition is concentration dependent whereas the higher temperature transition is not. The former transition has been characterized by gel electrophoresis and shows two distinct bands, whose intensity depends on temperature. This behavior is due to the occurrence of a slow premelting interconversion between the duplex and hairpin forms in both tetradecamers. The kinetics of hairpin formation from the duplex is studied by T-jump experiments. Relaxation spectra are well reproduced by a single relaxation time with rate constants characterized by a high temperature coefficient. In 10 mM NaCl, the duplex-hairpin conversion of I is characterized by an apparent activation energy of 96 +/- 6 kcal/mol, a value rather close to the expected denaturation enthalpy. In 1 mM NaCl a value slightly lower has been obtained. The rate of duplex-hairpin interconversion has been found to decrease as the salt concentration is raised. These data suggest that the transformation from the duplex to the hairpin form should imply a transition state with a simultaneous breaking of most base pairs, if not total strand separation.

Base Sequence↗
PubMed1987

Base specificity in the interaction of ethidium with synthetic polyribonucleotides.

Base specificity in the interaction of ethidium with double stranded synthetic RNA homopolymers has been studied by means of spectroscopic (UV-visible absorption and fluorescence), microcalorimetric and dilatometric techniques. The results show a strong base specificity in this interaction, the association constant with poly A:poly U being more than three order of magnitude higher than with poly O:poly C. The interaction is mainly enthalpy driven, the differences in affinity being essentially entropic in origin. These evidences along with the dilatometric data suggest that the observed base specificity may arise from the different extent of water release upon intercalation.

Ethidium↗
PubMed1987

dC-dG alternating oligonucleotides: thermodynamic and kinetic aspects of the B-Z transformation.

The alternating cytosine-guanine oligodeoxyribonucleotides (dCdG)n, (dGdC)n, (dCdG)ndC (n = 3,4), (dGdC)7 and dG(dCdG)3 have been studied by UV and CD spectroscopy at different temperatures and NaCl concentrations. The analysis of the melting data, assuming an all-or-none model, reveals that in the B-conformation the 5'G/C3' stacking interactions are enthalpically favoured with respect to the 5'C/G3' one. The CD investigation of the B-Z equilibrium shows that the Z-conformation is enthalpically stabilized, while the B-conformation is entropically favoured, in the range of NaCl concentration considered (1 to 5 M). The kinetic data for the B-Z transformation, obtained with a salt-jump technique for the hexamer (dCdG)3, support a mechanism by which the Watson-Crick hydrogen bonds are broken before the bases flip over separately and eventually stack, reforming the H-bonds, in the new helix.

Base Sequence↗
PubMed1986

Thermodynamic behaviour of the heptadecadeoxynucleotide d(CGCGCGTTTTTCGCGCG) forming B and Z hairpins in aqueous solution.

UV and CD data of the partially self-complementary heptadecadeoxynucleotide d(CGCGCGTTTTTCGCGCG), obtained as a function of temperature, salt and strand concentration, show that: at low NaCl and strand concentration the oligomer exhibits, on increasing the temperature, a biphasic thermal profile which is indicative of two structural transitions, from dimeric duplex to hairpin and from hairpin to coil; the loop stabilizes enthalpically both B and Z hairpin structures with respect to the corresponding unconstrained hexamer d(CGCGCG) by a few Kcal/mol; the oligomer undergoes a B-Z transition which appears to be complete, at 0 degree C, when induced by NaClO4; by contrast the B-Z transition induced by NaCl does not reach completeness even at salt saturation. The independence of the denaturation temperature, at high salt conditions, on the oligomer concentration indicates that the Z structure is present also in the hairpin.

Circular Dichroism↗