Biomedical subjects

G Manzini

Publications and source records attributed to G Manzini.

At least 19 recordsLinked to original sources

PubMed2002

APE/Ref-1 is controlled by both redox and cAMP-dependent mechanisms in rat thyroid cells.

APE/Ref-1 is a multifunctional protein possessing both redox and DNA repair functions. Through its redox activity, APE/Ref-1 controls the DNA-binding function of several transcriptional regulators (AP1, NF-kappaB, p53, Pax proteins). We have previously shown that APE/Ref-1 upregulates the transcriptional activity of the thyroid-specific transcription factor Pax8. In thyroid cells, APE/Ref-1 can be detected both in the nuclear and cytoplasmatic compartments. In this study regulatory mechanisms acting on APE/Ref-1 were revealed using the FRTL-5 cell line. TSH induces both cytoplasm-to-nucleus translocation and neosynthesis of APE/Ref-1 protein. Interestingly, only neosynthesis is dependent on cAMP signalling. In contrast, the cytoplasm-to-nucleus translocation is dependent on redox-mediated mechanisms. Based upon the data shown in this study and in others, a bimodal control of APE/Ref-1 by TSH can be delineated.

Animals↗

PubMed2001

Mitochondrial localization of APE/Ref-1 in thyroid cells.

Mutations of mitochondrial DNA (mtDNA) are associated with different human diseases, including cancer and aging. Reactive oxygen species produced during oxidative phosphorylation are a major source of mtDNA damage. It is not clear, however, whether DNA repair mechanisms, able to abolish effects due to oxidative damage, are present in mitochondria. APE/Ref-1 is a nuclear protein possessing both redox activity (by which activates, "in vitro", the DNA-binding functions of several transcription factors) and DNA repair activity over apurinic/apyrimidinic sites. Immunohistochemical evidences indicate that in follicular thyroid cells, APE/Ref-1 is located in both nucleus and cytoplasm. Electronmicroscopy immunocytochemistry performed in the rat thyroid FRTL-5 cell line, indicates that part of the cytoplasmatic APE/Ref-1 is located in mitochondria. The presence of APE/Ref-1 inside mitochondria is further demonstrated by western blot analysis after cell fractionation. In the Kimol cell line (which is derived from FRTL-5, transformed by the Ki-ras oncogene) the amount of mitochondrial APE/Ref-1 is reduced by three to fourfold with respect to the normal FRTL-5 cells. These results suggest that: (i) a machinery capable of repairing DNA damaged by oxidative stress is present in mitochondria and (ii) mtDNA repair mechanisms may be impaired during cell transformation.

Animals↗

PubMed2001

ApeI/Ref-I expression and cellular localization in human thyroid carcinoma cell lines.

For its DNA repair, transcription factor regulation and anti-apoptotic activity, the apurinic/apirimidinic ApeI/Ref-I endonuclease is thought to play a relevant role in human tumorigenesis. In human thyroid tumors, we demonstrated an altered nuclear/cytoplasmic ratio in all the carcinomas examined but not in follicular adenomas. In this study, Ref-I expression and cellular localization were analyzed in a series of human thyroid carcinoma cell lines. We found a reduced nuclear/cytoplasmic ratio in BCPAP, TPC I and ARO cells and not in WRO cells. Such a pattern of expression corresponds to that observed in thyroid tumoral tissues except for the WRO cells which behave as the follicular adenomas rather than carcinomas. Thus, these cell lines represent an excellent in vitro model to analyze the molecular mechanisms involved in Ref-I regulation and activity and clarify its role in thyroid tumorigenesis.

Adenoma↗

PubMed2001

A chicken hnRNP of the A/B family recognizes the single-stranded d(CCCTAA)(n) telomeric repeated motif.

With the aim of identifying proteins able to interact with the C-rich single-stranded telomeric repeated motif, three nuclear polypeptides, CBNP alpha, CBNP beta and CBNP gamma, with apparent mobilities in SDS/PAGE of 38, 44 and 55 kDa, respectively, were isolated from mature chicken erythrocytes by affinity chromatography. In situ UV-cross-linking experiments demonstrated that CBNP alpha and CBNP gamma interact directly with the telomeric d(CCCTAA)n repeat, whereas CBNP beta does not. Moreover, they provided information on the protein components responsible for each electrophoretic mobility-shift assay signal. Ion spray and matrix-assisted laser desorption ionization MS allowed us to identify CBNP alpha with single-stranded D-box-binding factor (ssDBF), a protein previously characterized as a transcription factor belonging to the A/B family of heterogeneous nuclear ribonucleoproteins, and CBNP beta with an isoform of this protein containing an extra exon. Similarly, CBNP gamma was shown to be probably the chicken homolog of hnRNP K, a ribonuclear protein able to bind to polyC oligonucleotides. The relation of CBNP alpha (i.e. ssDBF), CBNP beta and CBNP gamma to a number of similar proteins in the protein and nucleotide sequence databank is discussed. A rather diversified spectrum of functional roles has been assigned to some of these proteins despite the strong sequence homology among them.

Amino Acid Sequence↗

PubMed2001

Targeting neighbouring poly(purine.pyrimidine) sequences located in the human bcr promoter by triplex-forming oligonucleotides.

Most poly(purine.pyrimidine) [poly(R.Y)] sequences in eukaryotic genomes are interrupted by one or more base pair inversions. When the inversions are centrally located, the poly(R.Y) sequences can be regarded as the sum of two abutting sites, each potentially capable of forming a triple helix. Employing band-shift, footprinting and modeling methods we examined the formation of triple helices at a critical 27 bp poly(R.Y) sequence interrupted by two adjacent CG inversions, and located in the promoter of the human bcr gene at transcription initiation. We designed several 13-mer and 14-mer triplex-forming oligonucleotides (TFOs) capable of binding the bcr abutting sites, thereby generating different base juxtapositions at the triple helical junction, to examine whether triplex formation occurs in a cooperative manner. It is found that in 50 mM Tris/HCl, pH 7.4, 10 mM MgCl2, 2 mM spermine, 37 degrees C, the 13-and the 14-mer TFOs bind to one half of the bcr site with Delta G between -30 and -35 kJ x mol-1. However, when different 13-mer/14-mer combinations of TFOs were directed against the abutting poly(R x Y) sites, triplex formation has been found to be enhanced only for the triple helical junction formed by the 5'-A-T-3' base juxtaposition, in keeping with a partial stacking suggested from modeling analysis. On the other hand, a longer 24-mer TFO, binding noncooperatively to the same abutting sites, forms a much more stable triplex (Delta G = -51 kJ x mol-1), notwithstanding the two T x CG triads in the middle. Modeling investigations reveal that there is no continuity or propagation of base stacking involving adjacent bases of the third strand at the site of base inversion as well as on the 5' side. The data indicate that the entropy penalty of forming a triplex with two oligonucleotides is much higher than the energy gained from base stacking interactions at the triplex junction formed between the two TFOs.

Base Sequence↗

PubMed1999

Effect of cations on purine.purine.pyrimidine triple helix formation in mixed-valence salt solutions.

The effect of various monovalent, divalent and oligovalent cations on the reaction of triplex formation by GT and AG motif triplex-forming oligonucleotides, designed to bind to biologically relevant polypurine-polypyrimidine sequences occurring in the promoters of the murine Ki-ras and human bcr genes, has been investigated by means of electrophoresis mobility shift assays (EMSA) and DNase I footprinting experiments. We found that in the presence of 10 mm MgCl2 the triple helices were progressively destabilized by adding increasing amounts of NaCl, from 20 to 140 mm, to the solution. We also observed that, while the total monovalent-ion concentration was constant at 100 mm, the exchange of sodium with potassium, but not lithium, results in a further destabilization of the triple helices, due to self-association equilibria involving the G-rich triplex-forming oligonucleotides. Potassium was found to destabilize triplex DNA even when the triple helices are preformed in the absence of K+. However, footprinting experiments also showed that the inhibitory effect of K+ on triplex DNA is partially compensated for by millimolar amounts of divalent transition metal ions such as Mn2+ and Ni2+, which upon coordinating to N7 of guanine are expected to enhance hydrogen-bond formation between the target and the third strand, and to reduce the assembly in quadruple structures of G-rich triplex-forming oligonucleotides. Triplex enhancement in the presence of potassium was also observed, but to a lesser extent, when spermine was added to the reaction mixture. Here, the ion effect on triplex DNA is rationalized in terms of competition among the different valence cations to bind to triplex DNA, and differential cation stabilization of unusual quadruplex structures formed by the triplex-forming oligonucleotides.

Amino Acid Sequence↗

PubMed1998

Widespread presence in mammals and high binding specificity of a nuclear protein that recognises the single-stranded telomeric motif (CCCTAA)n.

We have recently identified a protein in HeLa nuclear extracts which recognises the single-stranded telomeric sequence (CCCTAA)n in vertebrates [Marsich, E., Piccini, A., Xodo, L. E. & Manzini, G. (1996) Nucleic Acids Res. 24, 4029-4033]. In this paper we provide further experimental evidence, using electrophoretic mobility shift assays, SDS/PAGE after ultraviolet cross-linking, and gel permeation chromatography techniques, that: (a) this protein displays remarkably stringent requirements for the telomeric motif sequence, as (CCCTAAA)n, (CCCCAA)n and (TCCCAA)n are tightly bound, but (CCTAA)n is not; (b) it requires at least four CCC-block repeats properly spaced to bind strongly to DNA, e.g. the polypurine stretch of the murine Ki-ras promoter d(CTCCCTCCCTCCCTCCTTCCCTCCCTCCC), the CarG-motif-containing sequence d(CCATTTCCTAATTAGGTAAAAG), and d(C)22 are not recognised by this protein; (c) it is present in nuclear extracts from several vertebrate sources including human, rat, pig, hamster and chicken; (d) its molecular mass is about 40 kDa, as determined by SDS/ PAGE and non-denaturing gel permeation chromatography, suggesting that this protein is monomeric under native conditions.

Animals↗

PubMed1998

Formation of stable DNA triple helices within the human bcr promoter at a critical oligopurine target interrupted in the middle by two adjacent pyrimidines.

Antigene strategies based on the use of triplex-forming oligonucleotides (TFO) as artificial repressors are constrained by the need for genomic targets with a polypurine-polypyrimidine [poly (R.Y)] DNA motif. In this study, we demonstrate that both A/G and G/T motif oligonucleotides recognize and bind strongly to a critical polypurine sequence interrupted in the middle by two adjacent cytosines and located in the promoter of the human bcr gene at the transcription initiation. The interaction between the designed TFO and this irregular poly (R.Y) target has been studied using a number of techniques, including electrophoretic mobility shift assay (EMSA), circular dichroism (CD), DNase I, and dimethyl sulfate (DMS) footprinting. Although CD shows that the 24-mer TFO self-aggregate in solution, they bind to the bcr target at 37 degrees C, forming stable triplexes that do not dissociate during electrophoretic runs performed up to 50 degrees C in 50 mM Tris-acetate, pH 7.4, 10 mM MgCl2, 50 mM NaCl (buffer A). We used EMSA to determine the equilibrium dissociation constants (Kd) for the reaction T <==> D + TFO at 37 degrees C, either in buffer A or in 50 mM Tris-acetate, pH 7.4, 10 mM MgCl2, 5 mM NaCl (buffer B). The triplexes were found to be more stable in buffer B, a behavior that can be rationalized in terms of monovalent and divalent cation competition for binding to DNA. Footprinting experiments showed that the TFO interact with the irregular poly (R.Y) target in a highly sequence-specific way and that the A/G motif oligonucleotide, juxtaposing T to the double CG inversions of the target, formed the most stable triplex (e.g., 1 microM TFO promoted strong footprints at 37 degrees C). These triplexes, except the one containing two A.C.G mismatched triads, are not destabilized under near physiologic conditions, that is, in 50 mM Tris-acetate, pH 7.4, 80 mM KCl, 20 mM NaCl, 2 mM spermidine. Moreover, we found that guanine N7 in T.C.G and guanine N7 in A.C.G are both accessible to DMS and that the first is less reactive than the second. In conclusion, the results of this study indicate that a critical sequence in the human ber promoter may be used as a potential binding site for TFO designed to repress artificially the transcription of the fused bcr/abl gene expressed in leukemia cells.

Base Sequence↗

PubMed1996

(A,G)-oligonucleotides form extraordinary stable triple helices with a critical R.Y sequence of the murine c-Ki-ras promoter and inhibit transcription in transfected NIH 3T3 cells.

The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.

3T3 Cells↗

PubMed1996

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.

DNA, Single-Stranded↗

PubMed1996

Guanine-rich oligonucleotides targeted to a critical R . Y site located in the Ki-ras promoter. The effect of competing self-structures on triplex formation.

The promoter of the murine Ki-ras proto-oncogene contains a (C+G)-rich homopurine . homopyrimidine (R . Y) sequence that is essential for transcription activity. We have designed two G-rich oligonucleotides, d(TGGGTGGGTGGTTGGGTGGG) (20GT) and d(AGGGAGGGAGGAAGGGAGGG) (20AG), that have the potential to bind the critical Ki-ras sequence via triplex-helix formation. Band-shift experiments have shown that 20GT binds the Ki-ras R . Y duplex with a delta G value of -40 +/- 5 kJ/mol, while 20AG appeared to have a lower affinity under the experimental conditions adopted: 50 mM Tris/HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2, 25 degrees C. In the absence of Mg2+, 20GT did not bind to the Ki-ras R . Y target, while 20AG exhibited the same affinity observed in the magnesium-containing buffer. To gain insight into the solution properties of 20GT and 20AG, we have performed several experiments including polyacrylamide gel electrophoresis (PAGE), hydroxyapatite chromatography, ultraviolet absorption melting and circular dichroism (CD). We found that 20AG rapidly self-associates into presumably a duplex, even at low concentration (< 1 microM), while 20GT forms aggregates slowly, a process favoured by high oligonucleotide concentrations (> 25 microM). The critical Ki-ras sequence was inserted in Bluescript KS+, downstream from the T7 promoter, to investigate to what extent 20AG and 20GT, which are directed against the R . Y target, are able to inhibit T7 RNA polymerase transcription, under near-physiological conditions. Transcription experiments conducted in vitro at pH 7.4 have shown that oligonucleotide 20GT produced a remarkable repression of T7 RNA polymerase activity in the concentration range (10-25 microM), whereas 20AG had little effect on transcription. In conclusion, the results of this work together with other data reported in the literature [Olivas, W. M. & Maher, L. J. III (1995) Biochemistry 34, 278-284; Noonberg, S. B., François, J.-C., Garestier, T. & Hélène, C. (1995) Nucleic Acids Res. 23, 1956-1963], demonstrate that G-rich oligonucleotides, in particular (G,A)-sequences, may raise problems for in vivo application due to self-aggregation.

Absorption↗

PubMed1994

Inhibition of T7 RNA polymerase transcription by phosphate and phosphorothioate triplex-forming oligonucleotides targeted to a R.Y site downstream from the promoter.

The effect of triplex-forming oligonucleotides (TFO) on the transcription activity of T7 RNA polymerase has been investigated by an in vitro assay. The TFOs, either containing only phosphate (PO2) or phosphate and phosphorothioate (POS) internucleotide linkages, were targeted to a 30-bp homopurine. homopyrimidine (R.Y) site cloned in plasmid Bluescript KS+ about four helical turns downstream from the T7 RNA promoter. Band-shift and ultraviolet absorption melting experiments showed that the designed pyrimidine PO2 and POS TFOs form stable triple-helical complexes with the R.Y target duplex (the delta GTFO values of triplex formation vary from -42 to -63 kJ/mol). The triple-helical complexes resulting from POS oligonucleotides were less stable (by 4-12 kJ/mol) than those obtained with PO2 analogues, the magnitude of destabilization being dependent on the number of POS groups present in the third strand. The designed TFOs were shown to efficiently repress bacteriophage T7 RNA polymerase transcription under different experimental conditions. The repression depended on pH, TFO concentration and temperature. When the TFO/template ratio was fixed to 100, a strong repressive effect was observed with normal and phosphorothioate pyrimidine TFOs, also under physiological conditions. In contrast, a purine-rich oligonucleotide containing 44% of guanine residues promoted only a weak transcription inhibition, even at a TFO/template ratio as high as 750. Both PO2- and POS-containing pyrimidine TFOs produced their strong repressive effect on T7 RNA polymerase transcription even when they were added to the reaction mixture simultaneously with the polymerase. A mechanism of transcription repression is discussed. The data reported in this paper are useful for designing oligonucleotides acting as artificial repressors in the antigene strategy and indicate that the R.Y target need not to be precisely confined to the promoter.

Base Sequence↗

PubMed1994

Evidence for intramolecularly folded i-DNA structures in biologically relevant CCC-repeat sequences.

The structural behaviour of repetitive cytosine DNA is examined in the oligodeoxynucleotide sequences of (CCCTAA)3CCCT (HTC4), GC(TCCC)3TCCT(TCCC)3 (KRC6) and the methylated (CCCT)3TCCT(CCCT)3C (KRM6) by circular dichroism (CD), gel electrophoresis (PAGE), and ultra violet (UV) absorbance studies. All the three sequences exhibit a pH-induced cooperative structural transition as monitored by CD. An intense positive CD band around 285 nm develops on lowering the pH from 8 to slightly acidic condition, indicative of the formation of base pairs between protonated cytosines. The oligomers are found to melt in a fully reversible and cooperative fashion, with a melting temperature (Tm) of around 50 degrees C at pH 5.5. The melting temperatures are independent from DNA concentration, indicative of an intramolecular process involved in the structural formation. PAGE experiments performed with 32P-labeled samples as well as with normal staining procedures show a predominantly single band migration for all the three oligomers suggestive of a unimolecular structure. From pH titrations the number of protons required for generating the structures formed by HTC4, KRC6 and KRM6 results to be around six. These findings strongly suggest that all the three sequences adopt an intramolecular i-motif structure. The demonstration of i-motif structure for KRC6, a critical functional stretch of the c-ki-ras promoter proto-oncogene, besides the human telomeric sequence HTC4, may be suggestive of larger significance in the functioning of DNA.

Base Sequence↗

PubMed1994

Pyrimidine phosphorothioate oligonucleotides form triple-stranded helices and promote transcription inhibition.

The ability of phosphorothioate (POS) oligonucleotides to recognise and bind to homopurine-homopyrimidine DNA double-stranded sites via triple helix formation has been investigated. It has been found that the homologous pyrimidine POS sequences Y11-Si (i = 0, 1,2,3,4,10), which have been obtained by an increasing sulphur substitution in the sugar-phosphate backbone of d(CTTCCTCCTCT) (Y11), and the target hairpin duplex d(GAAGGAGGAGA-T4-TCTCCTCCTTC) (h26) can form stable triple helices, as indicated by PAGE, CD and UV melting experiments. The thermal stability of the triple helices depends on the number of POS linkages in the third Y11 strand, varying from 48 degrees C (Y11, with only phosphate groups, PO2) to 31 degrees C (Y11-S10 containing exclusively thioate groups). On average, a Tm depression of about 2 degrees C per POS linkage introduced in Y11 was observed. CD data indicate that the sulphurization of the third strand results in minimal changes of triple-stranded structures. The energetics of the triplex-to-hairpin plus single-strand transition has been determined by van't Hoff analyses of the melting curves. In free energy terms, the POS triplexes h26.Y11-Si are less stable than the normal PO2 h26.Y11 triplex by values between 2.7 and 5.4 kcal/mol, depending on the number of POS linkages contained in the third strand. Phosphorothioate oligonucleotides being resistant towards several nucleases offer an interesting choice as gene blockers in antisense strategy. Thus, their ability to inhibit transcription via triple helix formation has been examined in vitro. We found that triplex-forming POS oligonucleotides of 20 bases in length (with a cytosine contents of 45%), containing either 10% or 26% thioate groups, strongly repress the transcription activity of the bacteriophage T7 RNA polymerase at pH 6.9, when used in excess compared to the target (mol oligo/mol template = 125). The here reported data are useful for designing phosphorothioate oligonucleotides targeted to genomic DNA in antigene strategy.

Base Sequence↗

PubMed1994

Effect of 5-methylcytosine on the structure and stability of DNA. Formation of triple-stranded concatenamers by overlapping oligonucleotides.

A triple helix can be formed upon binding of a pyrimidine oligonucleotide to the major groove of a homopurine-homopyrimidine (R.Y) double-stranded DNA target site. Here, we report that this reaction can be influenced by base methylation. The pyrimidine strand 5'-TmCTmCTmCTmCTTmCT (mY12), whose cytosine residues are methylated at C5, does not bind the duplex 5'-AGAGAGAGAAGA.3'-TCTCTCTCTTCT (R12.Y12) to yield a 12-triad triplex, as would be expected from these DNA sequences. Rather, a complex of overlapping oligonucleotides, which we define concatenamer, is formed. The concatenamer is clearly evidenced by polyacrylamide gel electrophoresis (PAGE) since it migrates with a smeared band of very low mobility. The stoichiometry of the concatenamer, determined by both UV mixing curves and electrophoresis, is surprisingly found to be (R12.2mY12)n, thus showing that the unmethylated Y12 strand is excluded from the complex. Denaturation experiments performed by ultraviolet absorbance (UV) and differential scanning calorimetry (DSC) show that the concatenamers melt with a single and highly cooperative transition whose Tm strongly depends on pH. Overall, the data point to the conclusion that the concatenamers are in triple helix, where the methylated mY12 strand is engaged in both Watson-Crick and Hoogsteen base pairings, thus displacing the Y12 strand from the R12.Y12 duplex. A possible mechanism of concatenamer formation is proposed. The results presented in this paper show that 5-methylcytosine brings about a strong stabilizing effect on both double and triple DNA helices, and that pyrimidine oligonucleotides containing 5-methylcytosine can displace from R.Y duplexes the analogous non-methylated strand. The advantage of using methylated oligonucleotides in antisense technology is discussed.

5-Methylcytosine↗

PubMed1993

L-DNAs as potential antimessenger oligonucleotides: a reassessment.

Unnatural L-2'-deoxyribonucleosides L-T, L-dC, L-dA and L-dG were prepared from L-arabinose and assembled, by solution or solid phase synthesis, to give L-oligonucleotides (L-DNAs), which contain all four natural bases. The affinity of these modified oligomers for complementary D-ribo- and D-deoxyribo-oligomers was studied with NMR, UV and CD spectroscopies and mobility shift assay on native PAGE. All experimental results indicate that L-DNAs do not, in general, recognize single-stranded, natural DNA and RNA. Hence, contrary to previous suggestions, it is not possible to envisage their use as wide scope antimessenger agents in the selective control of gene expression.

Base Sequence↗

PubMed1993

Sequence-specific DNA-triplex formation at imperfect homopurine-homopyrimidine sequences within a DNA plasmid.

The ability of pyrimidine-rich and purine-rich oligodeoxynucleotides to form stable triple-helical structures with imperfect R.Y target sites, containing C interruptions in the purine strand (CG inversions) and located within Bluescript KS+, a plasmid of 2959 bp, has been investigated by electrophoresis, ultraviolet absorbance and cleavage-protection experiments. First, we synthesized double-stranded oligonucleotides corresponding to the plasmid sites and studied their interaction with oligopyrimidines which oppose either G or T to CG inversions. The resulting imperfect DNA triplexes were detected by gel-mobility shift. Their melting profiles were found to be biphasic, and the triplex-to-duplex plus single-strand transition was affected by hysteresis. The 21-nucleotide triplex containing three GC.G mismatched triads had tm = 45 degrees C, while the same triplex, but with three GC.T triads, had tm = 31 degrees C. Moreover, replacing C with 5-methylcytosine in the third strand resulted in a significant stabilization of the defective triplex, tm = 49 degrees C. The potential of the 21-nucleotide oligopyrimidines to recognize and bind in a sequence-specific manner to imperfect R.Y sequences in Bluescript KS+ has been investigated by means of a restriction-endonuclease-protection assay, taking advantage of the fact that one R.Y sequence of Bluescript KS+ was partially overlapped with a HaeII site. Effective endonuclease inhibition was observed with oligopyrimidines opposing G-to-GC inversions, at 10-50 microM. By contrast, the oligopyrimidine opposing T-to-CG inversions did not exhibit any interference with endonuclease activity in our standard conditions. Finally, we have tested the ability of purine-rich strands to bind the R.Y sites of Bluescript KS+. A very weak cleavage protection was observed by using an oligomer (130 microM) with a polarity antiparallel to the purine strand of the target site. The resulting Y.R.R triplex was stabilized by CG.G (GC.G) and TA.A base triplets. This triplex denatures with a low cooperative melting profile suggesting the absence of strong interactions between the third strand and the target site.

Base Sequence↗

PubMed1992

Charge effect in the interaction of doxorubicin and derivatives with polydeoxynucleotides.

The equilibrium interaction of doxorubicin and its N-acetyl derivative with a series of purine-pyrimidine alternating polydeoxynucleotides has been studied through spectrofluorometry to assess the relevance of the electrostatic contribution to DNA intercalation. The results have shown that: (a) the suppression of the positive charge on the aminosugar has: (I) a profound negative effect on the free energy of intercalation, as expected, and (II) a negligible influence on the base specificity, which supports the notion of an essentially electrostatic effect of N-acetylation on intercalation; (b) a reasonably good accord with the demands of a polyelectrolytic model, due to Friedman and Manning, is found.

DNA↗