SEARCH · Search PubMed

Results for “Switch regions”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed2026

Isolation of region-specific factors driving antibody class-switch recombination from the immunoglobulin heavy chain locus.

Activation-Induced Cytidine Deaminase (AID) induces DNA double-strand breaks (DSBs) at the switch (S) regions of the Immunoglobulin heavy chain (IgH) locus, which are essential for class switch recombination (CSR) and somatic hypermutation (SHM), key processes for effective antibody production. While AID activity is critical, its off-target effects, such as DSBs at the Myc locus, can cause chromosomal translocations like IgH-Myc fusions, contributing to B-cell lymphomas. The factors assembled on the IgH locus that help restrict AID-induced DSBs and subsequently CSR, remain unknown. To address this, we developed a method to isolate CSR-specific factors by inserting a 5×-GAL4-UAS sequence at the switch-mu (Sμ) region in CH12 cells. This engineered site enables recruitment of a 3-FLAG-GAL4 DNA-binding protein (3F-GAL4-DBD), allowing specific pulldown of proteins enriched at the Sμ region. Successful recovery of the known CSR regulator BRD2 from the Sμ region, along with enrichment of the DNA repair factors 53BP1 and gH2AX, validated this approach. Identification and characterization of IgH-enriched factors establish a validated methodological framework to facilitate future proteomic discovery of CSR regulators and highlight mechanisms that balance antibody diversification with genomic integrity in B cells.

Immunoglobulin Class Switching↗

PubMed2026

R-loops and D-loops: a delicate balance in genomic stability and instability.

R-loops and D-loops are three-stranded nucleic acid structures that have emerged as central regulators of genome stability, gene expression, and DNA metabolism. R-loops form co-transcriptionally or post-transcriptionally when nascent RNA re-anneals with the template DNA strand, generating an RNA: DNA hybrid that displaces the non-template strand into a single-stranded state. These structures are enriched at CpG island promoters, transcription termination sites, and immunoglobulin class-switch regions, where they coordinate transcription regulation, chromatin remodeling, and DNA damage signaling. D-loops are formed when a single-stranded DNA segment pairs with one strand of a duplex and displaces the other, arising through context-dependent mechanisms that include RAD51- or DMC1-mediated strand invasion in homologous recombination, shelterin-assisted invasion at telomeres, and replication-coupled strand displacement at the mitochondrial DNA origin. They serve as indispensable intermediates in double-strand break repair, telomere maintenance, and mitochondrial DNA replication. Recent cryo-electron microscopy studies have resolved the stepwise RAD51-mediated strand exchange mechanism at near-atomic resolution, substantially advancing structural understanding of D-loop biogenesis. Despite their differences in molecular composition, both structures remodel Watson-Crick base pairing and, when dysregulated, are associated with replication fork stalling, transcription-replication conflicts, and aberrant recombination. This review systematically compares the structural features, formation mechanisms, regulatory networks, and biological functions of R-loops and D-loops, with emphasis on their convergent roles in safeguarding genome integrity. We further discuss rapidly evolving detection technologies and emerging therapeutic strategies targeting these structures in cancer and neurodegeneration, identifying key unresolved questions for future investigation.

Genomic Instability↗

PubMed2026

A Cis-Regulatory Duplication in a Hox Hotspot Implicated in Mimetic Convergence in the Bumble Bee Bombus flavifrons.

Several species of North American bumble bees spanning the Pacific Coastal and Rocky Mountain regions converge onto distinct mimetic abdominal colour forms for each region by switching abdominal coloration from black to red. Previous genome-wide association studies (GWAS) of red and black transitions in two mimics (Bombus melanopygus and Bombus vancouverensis) revealed that black forms were generated by independently deleting a portion of the same cis-regulatory region near the Hox gene Abdominal-B (Abd-B). Here, we test the genetic basis of these mimetic colour forms in a third co-mimic, Bombus flavifrons, that has continuous variation in red and black that is shifted posteriorly one segment compared to its co-mimics. Using genome-wide association of red and black forms, we identified a structural variant < 50 bp away from the deletions in B. melanopygus and B. vancouverensis that was strongly associated with the colour phenotype. Sequencing across mimicry zones and closely related taxa revealed that all red forms of B. flavifrons and monomorphic red close relative Bombus centralis have a 319 bp tandem duplication at this locus that has extensive modification to the duplicated copy. Black forms of B. flavifrons from the Cascades also have this duplication but without the modifications, while black forms in the western Rockies mostly lack this duplication, similar to ancestral black forms. This suggests independent mechanisms may regulate the black phenotypes in different populations and that ancestral sorting of variation and/or adaptive introgression generated these phenotypes. This study strengthens support for this Abd-B cis-regulatory region being a hotspot for regulating abdominal coloration in bumble bees, and features the role of regulatory region duplication in creating novel phenotypes.

Animals↗

PubMed2022

Inhibition of RAS-driven signaling and tumorigenesis with a pan-RAS monobody targeting the Switch I/II pocket.

RAS mutants are major therapeutic targets in oncology with few efficacious direct inhibitors available. The identification of a shallow pocket near the Switch II region on RAS has led to the development of small-molecule drugs that target this site and inhibit KRAS(G12C) and KRAS(G12D). To discover other regions on RAS that may be targeted for inhibition, we have employed small synthetic binding proteins termed monobodies that have a strong propensity to bind to functional sites on a target protein. Here, we report a pan-RAS monobody, termed JAM20, that bound to all RAS isoforms with nanomolar affinity and demonstrated limited nucleotide-state specificity. Upon intracellular expression, JAM20 potently inhibited signaling mediated by all RAS isoforms and reduced oncogenic RAS-mediated tumorigenesis in vivo. NMR and mutation analysis determined that JAM20 bound to a pocket between Switch I and II, which is similarly targeted by low-affinity, small-molecule inhibitors, such as BI-2852, whose in vivo efficacy has not been demonstrated. Furthermore, JAM20 directly competed with both the RAF(RBD) and BI-2852. These results provide direct validation of targeting the Switch I/II pocket for inhibiting RAS-driven tumorigenesis. More generally, these results demonstrate the utility of tool biologics as probes for discovering and validating druggable sites on challenging targets.

Biological Products↗

PubMed2026

Direct interaction between RSV polymerase L and active Rab11a mediates viral ribonucleoprotein transport to assembly sites.

Respiratory syncytial virus (RSV) is an enveloped, negative-sense, single-stranded RNA virus whose ribonucleoproteins (vRNPs) must be transported from cytoplasmic viral factories to the plasma membrane for efficient virion assembly. Viral vRNPs comprise genomic RNA encapsidated by nucleoprotein N and associated with the polymerase complex (L, P, and M2-1). It was previously demonstrated that newly synthesized vRNPs are transported along microtubules by hijacking Rab11a, a small GTPase involved in the regulation of recycling endosomes. In our previous study, we showed an interaction between Rab11a and vRNPs in infected cells by immunoprecipitation assays, nevertheless the molecular mechanisms underlying Rab11a viral hijacking remained unknown. Here, we provide the first comprehensive characterization of the interaction between RSV vRNPs and Rab11a using immunoprecipitation, immunofluorescence colocalization, GST pull-down assays, and biolayer interferometry. We demonstrate that the viral polymerase L is the sole vRNPs component responsible for Rab11a recognition: immunoprecipitation of L specifically co-precipitates HA-tagged Rab11a, whereas other vRNPs proteins show no interaction. In vitro binding studies confirm that L interacts directly and specifically with the active, GTP-bound form of Rab11a with sub-micromolar affinity. Domain mapping using truncated constructs reveals that this interaction requires the C-terminal methyltransferase and CTD domains of L (residues 1756-2165) and depends on Rab11a's Switch I region, known to mediate interactions with cellular Rab11a partners. Mutagenesis further highlights leucine 1860 in the L polymerase as critical for Rab11a binding. Competitive inhibition of the interaction between Rab11a and L using the minimal Rab11a-binding domain significantly impairs vRNP dynamics during infection, indicating that Rab11a-L binding is involved in the transport of vRNPs. Together, these findings establish RSV polymerase L as the key mediator of Rab11a engagement, define the molecular interface of their interaction, and reveal a potentially conserved viral strategy for genome transport. Targeting the L-Rab11a interaction could therefore be a promising strategy for the development of RSV-specific or broad-spectrum antiviral therapies.

rab GTP-Binding Proteins↗

PubMed2026

Full-length single-cell spatial transcriptomics reveals spatial and cell-type-specific transcript isoforms in the primate brain.

The primate brain exhibits complex RNA alternative splicing heterogeneity crucial for functional complexity, yet systematic spatial isoform characterization has been lacking. We developed Fullscope-seq, a full-length single-molecule large field-of-view spatial transcriptomics sequencing method at single-cell resolution, based on programmed concatenation cDNA for multiple long-read sequencing platforms. Applying Fullscope-seq to the macaque brain, we uncovered thousands of genes exhibiting differential transcript usage (DTU) across cortical layers, cell types and brain regions. Fullscope-seq resolved hundreds of major isoform switches across distinct brain regions and identified DTUs between superficial and deep cortical layers. Cortical layer-specific DTUs showed cell-composition dependence, whereas regional DTUs were regulated according to both cellular composition and spatial contexts. These isoform variations showed substantial enrichment for neuropsychiatric disorder-associated genes and were conserved across platforms and species. Our study establishes a scalable framework for spatial isoform analysis and provides a resource for understanding transcriptomic diversity in complex tissues.

Animals↗

PubMed2026

Mammalian DNA methyltransferases in DNA methylation and imprinted gene expression in extraembryonic ectoderm of post-implantation embryos.

DNA methylation in mammals is mainly catalyzed by three DNA methyltransferases (DNMTs). Conventionally, DNMT1 is considered the primary DNMT protein for maintenance DNA methylation, whereas DNMT3A and DNMT3B function in de novo DNA methylation. In two previous studies, we demonstrated that DNMT3A and DNMT3B maintain genome-wide DNA methylation in embryonic stem (ES) cells and in the epiblast of post-implantation embryos. Interestingly, DNMT3A and DNMT3B also sustain genome-wide DNA methylation in the extraembryonic ectoderm (EXE) of post-implantation embryos, including repeats, genic and intergenic regions. Although DNMT1 plays a major role in maintaining DNA methylation at the imprinting control regions (ICRs) in the imprinted regions, DNMT3A and DNMT3B are required for preserving DNA methylation at the ICRs of a subset of imprinted regions in EXE, similar to the observations in ES cells and epiblast. Surprisingly, de novo DNA methylation mediated by DNMT3A and DNMT3B leads to increased DNA methylation at a large subset of imprinted regions. These results are consistent with what we previously elucidated in the epiblast of post-implantation embryos. Importantly, loss of DNA methylation at the ICR of an imprinted region, resulting from the absence of DNMT1 or two DNMT3 proteins, causes allelic expression switch of the corresponding imprinted genes in that imprinted region. This study provides further evidence that DNMT3A and DNMT3B exert both maintenance and de novo DNA methylation functions across the genome in post-implantation embryos. It also validates some previous findings for DNA methylation-dependent allelic expression switch of imprinted genes.

DNA methylation↗

PubMed2026

TNFα-dependent modulation of WT1-MMP9 regulatory axis links developmental and inflammatory pathways in glaucoma.

Glaucomas are heterogeneous optic neuropathies associated with extracellular matrix dysregulation, abnormal ocular morphogenesis, and inflammatory signaling. Targeted deep sequencing of 586 primary congenital glaucoma (PCG) cases and 1,757 controls identified rare pathogenic variants in multiple genes, including WT1 and MMP9. Notably, WT1 variants clustered within the nuclear export sequence. Further, functional analyses showed that combined wt1-pax6 suppression in zebrafish disrupted ocular morphogenesis, highlighting developmental interdependence. In human trabecular meshwork cells, WT1 acted as a transcriptional repressor of MMP9, while TNF-α signaling triggered nitric oxide-dependent nuclear export of WT1, resulting in delayed MMP9 upregulation. This effect was reversible by inhibiting nuclear export or nitric oxide synthase. A patient-derived mutation in the nuclear-export region of WT1, disrupted this regulatory switch, causing abnormal MMP9 expression. These findings position WT1 as an important regulator linking developmental and inflammatory mechanisms in glaucoma pathogenesis.

anterior segment dysgenesis↗

PubMed2026

Long-read proteogenomic atlas of human neuronal differentiation reveals isoform diversity informing neurodevelopmental risk mechanisms.

RNA splicing shapes neuronal identity and disease risk, yet current maps lack the developmental resolution and depth to resolve this complexity. Here, we integrate deep long-read RNA sequencing and proteomics in induced pluripotent stem cell-derived cortical neurons to generate a high-resolution proteogenomic atlas of human neuron development. We identify 182,371 mRNA isoforms (over half previously unknown) and provide direct peptide evidence for the translation of hundreds of novel protein-coding sequences. Population genetics demonstrates that variants affecting novel exons and splice sites are under negative selection, underscoring the potential significance of these isoforms. During neuronal maturation, we observe that autism risk genes undergo dynamic isoform switching, including microexon inclusion and intron retention, that remodel key protein domains and regulatory regions. Furthermore, we uncover widespread, long-range coordination between alternative transcript processing events, including transcription start sites, exon splicing, and polyadenylation. Finally, our atlas enables variant reinterpretation in autism, highlighting the value of an isoform-centric view for interpreting pathogenic variation in neurodevelopment.

Humans↗

PubMed2026

Activation of mTOR pathway by human cytomegalovirus promoting host ribosomal protein expression by coordinated transcriptional and translational controls.

Human cytomegalovirus (HCMV) profoundly reprograms host transcription and RNA metabolism, yet its impact on transcription start site (TSS) regulation of host genes remains poorly understood. Here, we employed NanoCap Analysis of Gene Expression sequencing (NanoCAGE-seq) to investigate HCMV-driven changes in alternative TSS usage across the host transcriptome. We identified widespread TSS switching, with ribosomal protein genes (RPGs) emerging as a highly enriched category. Alternative TSS usage produced isoforms with distinct 5'untranslated regions (UTRs), thereby altering cis-regulatory elements that shape translational efficiency. Integrative transcriptomic and proteomic analyses revealed a paradoxical accumulation of RPG proteins despite transcriptional downregulation during infection. Using 5' Rapid Amplification of cDNA Ends (5'RACE), we characterized four RPGs of RPL4, RPS11, RPS23, and RPS24 that generated 5'UTR variants through alternative TSS usage. Notably, isoforms containing a 5'terminal oligopyrimidine (5'TOP) motif were significantly enriched, correlating with mTOR activation induced by HCMV. Functional assays with bicistronic reporter constructs in HEK293 cells and infection models in human embryonic lung fibroblasts demonstrated that the RPL4 5'TOP isoform exhibited enhanced mTORC1-driven translation compared with non-5'TOP counterparts. Importantly, RPL4 upregulation facilitated viral protein synthesis and boosted production of infectious virions. Together, our findings reveal that dynamic TSS switching of RPGs provides a simple, yet effective, mechanism for fine-tuning mTORC1-responsive translation. By co-opting host transcriptional and translational programs, HCMV enhances ribosome function to optimize the cellular environment for productive viral replication.

Humans↗

PubMed2022

High prevalence of Pfcrt 76T and Pfmdr1 N86 genotypes in malaria infected patients attending health facilities in East Shewa zone, Oromia Regional State, Ethiopia.

BACKGROUND: Plasmodium falciparum resistance to series of anti-malarial drugs is a major challenge in efforts to control and/or eliminate malaria globally. In 1998, following the widespread of chloroquine (CQ) resistant P. falciparum, Ethiopia switched from CQ to sulfadoxine-pyrimethamine (SP) and subsequently in 2004 from SP to artemether-lumefantrine (AL) for the treatment of uncomplicated falciparum malaria. Data on the prevalence of CQ resistance markers after more than two decades of its removal is important to map the selection pressure behind the targets codons of interest. The present study was conducted to determine the prevalence of mutations in Pfcrt K76T and Pfmdr1 N86Y codons among malaria-infected patients from Adama, Olenchiti and Metehara sites of East Shewa zone, Oromia Regional State, Ethiopia. METHODS: Finger-prick whole blood samples were collected on 3MM Whatman ® filter papers from a total of 121 microscopically confirmed P. falciparum infected patients. Extraction of parasite DNA was done by Chelex-100 method from dried blood spot (DBS). Genomic DNA template was used to amplify Pfcrt K76T and Pfmdr1 N86Y codons by nested PCR. Nested PCR products were subjected to Artherobacter protophormiae-I (APoI) restriction enzyme digestion to determine mutations at codons 76 and 86 of Pfcrt and Pfmdr1 genes, respectively. RESULTS: Of 83 P. falciparum isolates successfully genotyped for Pfcrt K76T, 91.6% carried the mutant genotypes (76T). The prevalence of Pfcrt 76T was 95.7%, 92.5% and 84.5% in Adama, Metehara and Olenchiti, respectively. The prevalence of Pfcrt 76T mutations in three of the study sites showed no statistical significance difference (χ2 = 1.895; P = 0.388). On the other hand, of the 80 P. falciparum samples successfully amplified for Pfmdr1, all carried the wild-type genotypes (Pfmdr1 N86). CONCLUSION: Although CQ officially has been ceased for the treatment of falciparum malaria for more than two decades in Ethiopia, greater proportions of P. falciparum clinical isolates circulating in the study areas carry the mutant 76T genotypes indicating the presence of indirect CQ pressure in the country. However, the return of Pfmdr1 N86 wild-type allele may be favoured by the use of AL for the treatment of uncomplicated falciparum malaria.

Antimalarials↗

PubMed2026

Suppression of AAV-Delivered Transgene Expression Using Artificial MicroRNAs Delivered by an Alternative AAV Serotype.

Adeno-associated virus (AAV) gene transfer vectors mediate long-term expression in nondividing cells, an advantage for treating chronic disorders. However, current platforms lack a way to selectively shut down transgene expression if adverse effects arise. To create an "off switch," we hypothesized that incorporating unique artificial microRNA (amiRNA) target sequences into an AAV expression cassette would allow subsequent suppression of transgene expression using a second AAV vector encoding the cognate amiRNA. We introduced 22-nt sequences absent from human and mouse transcriptomes into the 3' untranslated region (UTR) of a therapeutic AAV cassette. To identify optimal amiRNAs, two tandem copies of each amiRNA were cloned into the 3'UTR of an mCherry reporter gene. In vitro assessment of six amiRNA/target pairs using a dual luciferase assay identified four amiRNAs that efficiently suppressed reporter expression. Cells cotransfected with target site 3 (TS3) and amiRNA-T3B showed the greatest reduction in luciferase activity (80%, p < 0.0001) and were selected for further study. The "off-switch" system was then evaluated using an AAV5 therapeutic vector expressing a recombinant humanized anti-IgE monoclonal antibody (AAV5-TBG-anti-IgE-TS3), designed for long-term suppression of allergen-induced reactions. Co-transfection of HEK293T cells with anti-IgE-TS3 and amiRNA-T3B significantly reduced anti-IgE mRNA and protein levels relative to a control amiRNA (p < 0.0001). In vivo testing in Balb/c mice (n = 5) involved intravenous administration of AAV5-anti-IgE-TS3 (3.2 × 1010 gc), followed 4 weeks later by an AAVrh.10 amiRNA vector (AAVrh.10-TBG-amiRNA-T3B; 1 × 1011 gc). Control mice receiving only the therapeutic vector expressed 18.4 ± 13.8 µg/mL serum anti-IgE at 10 weeks. In contrast, mice receiving the amiRNA "off" vector showed marked suppression of anti-IgE (0.3 ± 0.15 µg/mL, p < 0.0001). These findings provide proof-of-concept that AAV-delivered amiRNAs can selectively switch off transgene expression, offering a strategy to improve the safety of AAV-mediated gene therapies.

Dependovirus↗

PubMed2026

Repeated drought induces a reproducible DNA methylation response associated with gene expression in Quercus lobata.

UNLABELLED: Long-lived trees must continually adjust to environmental change and face sustained climatic shifts over their lifetimes. One increasingly important challenge is the rising frequency of drought caused by climate change. Environmentally responsive DNA methylation is widespread in plants, but whether it contributes to gene expression during environmental stress remains unclear, particularly in long-lived trees. Here, we integrated long read methylomes and transcriptomes from valley oak ( Quercus lobata ) seedlings exposed to repeated drought and well-watered treatments. Repeated drought induced a reproducible DNA methylation response that repeatedly targeted the same genomic regions despite turnover of individual methylated sites. These repeatedly targeted regions were transposable elements (TEs) located near genes. Genes adjacent to CHH-methylated TEs were enriched for core drought-response pathways, including abscisic acid signaling, osmotic adjustment and cell-wall remodeling, and remained transcriptionally activated under drought. However, higher CHH methylation levels were associated with progressively smaller transcriptional responses, suggesting that environmentally responsive DNA methylation influences how strongly drought- response genes are activated rather than simply switching them on or off. At the same time, greater CHH methylation was associated with continued repression of nearby TEs, suggesting that this response may simultaneously regulate gene activity while maintaining genome stability. Together, these findings identify a reproducible genome- regulatory response associated with repeated environmental stress in a long-lived tree. By repeatedly targeting the same genomic regions despite turnover of individual sites, this response provides a framework for how long-lived trees repeatedly adjust gene expression while maintaining genome stability during environmental change. SIGNIFICANCE STATEMENT: Plants cannot escape environmental change, and trees must repeatedly respond to stresses, such as drought, over lifetimes spanning decades to centuries. Yet little is known about the molecular mechanisms that make this remarkable resilience possible. Using a widespread California oak, we show that repeated drought repeatedly induced the same DNA methylation pattern in the same parts of the genome, even though the differentially methylated individual sites changed between drought events. This pattern was linked to how strongly drought-response genes were activated, suggesting that trees repeatedly deploy the same molecular program to respond to environmental stress. Our findings provide a new framework for understanding how long-lived organisms repeatedly adjust to changing climates.

Journal Article↗

PubMed2026

Lineage-associated small inversions disrupt dosT, dnaE2, and a promoter-adjacent region in some Mycobacterium tuberculosis isolates.

UNLABELLED: Large molecular inversions in the genome of Mycobacterium tuberculosis (Mtb) due to factors like the presence of insertion sequences and transposases are widely known. However, smaller inversions within coding sequences and non-coding control elements are rarely reported. The present study aims to identify inversions and their potential impact on Mtb biology in a lineage-specific manner. Structural variants (SVs) could only be detected by long reads. For this, we simulated long reads by de novo assembling the short-read sequencing data sets and subsequently aligned representative strains from each lineage using the Progressive Mauve algorithm. Independently, long-read sequencing from the Pacific Biosciences platform was acquired and analyzed using the structural variant identification method. Variants were merged, and Fisher's exact test was carried out to identify the inversion association with lineages. To visualize deoxyribonucleic acid (DNA) features, the DNA-features-viewer tool was used. Simulated reads from short-read sequencing gave indications of lineage (L)-specific inversions. The long-read sequencing approach led to the identification of seven unique inversions: two positively associated with L1, one positively associated with L3, two negatively associated with L4, and two positively associated with L3 but negatively associated with L4 (P < 0.05). The inversions encompassed primarily non-essential genes like sdaA, dosT, Rv2026c, dnaE2, Rv1341, Rv1342, and lprD. An interesting inversion was observed in the upstream control element of purB and Rv0776c. The study sheds light on small inversions that may be causing alterations in expression, formation of fusion genes, and nonsense mutations that may have a role in lineage-specific phenotypic changes. IMPORTANCE: The role of mutations like SNPs and INDELs and their association with drug resistance is well known in Mycobacterium tuberculosis (Mtb). However, structural variations, especially inversions, are largely overlooked and unreported. In this paper, publicly available whole-genome sequencing datasets from Illumina and Pacific Biosciences-Oxford Nanopore Technologies platform have been used to detect inversions and report seven unreported Mtb lineage-specific small inversions.

Mycobacterium tuberculosis↗

PubMed2016

17q21 asthma-risk variants switch CTCF binding and regulate IL-2 production by T cells.

Asthma and autoimmune disease susceptibility has been strongly linked to genetic variants in the 17q21 haploblock that alter the expression of ORMDL3; however, the molecular mechanisms by which these variants perturb gene expression and the cell types in which this effect is most prominent are unclear. We found several 17q21 variants overlapped enhancers present mainly in primary immune cell types. CD4+ T cells showed the greatest increase (threefold) in ORMDL3 expression in individuals carrying the asthma-risk alleles, where ORMDL3 negatively regulated interleukin-2 production. The asthma-risk variants rs4065275 and rs12936231 switched CTCF-binding sites in the 17q21 locus, and 4C-Seq assays showed that several distal cis-regulatory elements upstream of the disrupted ZPBP2 CTCF-binding site interacted with the ORMDL3 promoter region in CD4+ T cells exclusively from subjects carrying asthma-risk alleles. Overall, our results suggested that T cells are one of the most prominent cell types affected by 17q21 variants.

Asthma↗

PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗

PubMed2025

Phosphorylation as a regulatory mechanism of HP1 protein multifunctionality.

The Heterochromatin Protein 1 (HP1) family proteins are key regulators of chromatin structure and genome function, acting as "reader" proteins that recognize and bind to histone H3 lysine 9 methylation (H3K9me). Beyond their canonical role in heterochromatin formation and transcriptional repression, HP1 proteins exhibit functional versatility, participating in transcriptional activation, RNA processing, DNA repair, and chromosome segregation. This multifunctionality is mediated partially by post-translational modifications (PTMs), with phosphorylation emerging as a central regulatory mechanism. This review explores the diverse effects of HP1 phosphorylation on protein function and chromatin interactions, focusing on Drosophila melanogaster HP1a and its orthologs, mammalian HP1α and S. pombe Swi6. Phosphorylation in the N-terminal tail enhances HP1's affinity for H3K9me, promoting transcriptional silencing. Mitotic phosphorylation of serine residues in the hinge region, regulated by kinases such as AURKB and NDR1/2, leads to chromatin release and relocalization to the kinetochore, enabling proper chromosome segregation. Additionally, phosphorylation modulates HP1 phase separation dynamics, influencing nuclear compartmentalization and chromatin condensation. These findings highlight phosphorylation as a versatile molecular switch that enables HP1 proteins to transition between structural and regulatory roles, contributing to their evolutionary conserved multifunctionality in genome regulation and cell division. Further investigation into HP1 phosphorylation across species and contexts is essential to fully understand its contributions to chromatin biology.

Phosphorylation↗

PubMed2026

Post-transcriptional regulation of Profilin-2 by microRNAs and RNA-binding proteins forms a critical regulatory node for early embryonic cell fate decisions.

Post-transcriptional control by RNA binding proteins (RBPs) and microRNAs play central roles in mRNA stability and translation, yet how RBPs and microRNAs coordinate in developmental time to regulate cell fate remains poorly understood. Here, we demonstrate that post-transcriptional regulation of the Profilin 2 (Pfn2) transcript is essential for differentiation of embryonic stem cells (ESCs) into the primary germ layer lineages. The Pfn2 3'untranslated region has both an Iron Regulatory Protein binding site (IRE) and a nearby binding site for ESC enriched microRNAs. Deletion of this microRNA site leads to increased PFN2 and reduced FGF signaling during pluripotency transition prior to germ layer formation. In contrast, deletion of the IRE leads to decreased PFN2, a Wnt signaling defect, reduced nuclear beta-catenin, and a subsequent block in mesendodermal lineages during early germ layer formation. We further find that loss of the IRE site results in a cell autonomous defect in Wnt signaling and mesendodermal differentiation. The IRE site acts to stabilize beta-catenin, as disruption of the site leads to reduced nuclear beta-catenin levels. Together, these findings reveal the Pfn2 microRNA-IRE regulatory axis as a critical post-transcriptional regulatory node governing the switch from pluripotency to somatic differentiation.

MicroRNAs↗