Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Rudiviridae”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

12 recordsLinked to original sources
PubMed1999

A novel virus family, the Rudiviridae: Structure, virus-host interactions and genome variability of the sulfolobus viruses SIRV1 and SIRV2.

The unenveloped, stiff-rod-shaped, linear double-stranded DNA viruses SIRV1 and SIRV2 from Icelandic Sulfolobus isolates form a novel virus family, the Rudiviridae. The sizes of the genomes are 32. 3 kbp for SIRV1 and 35.8 kbp for SIRV2. The virions consist of a tube-like superhelix formed by the DNA and a single basic 15.8-kD DNA-binding protein. The tube carries a plug and three tail fibers at each end. One turn of the DNA-protein superhelix measures 4.3 nm and comprises 16.5 turns of B DNA. The linear DNA molecules appear to have covalently closed hairpin ends. The viruses are not lytic and are present in their original hosts in carrier states. Both viruses are quite stable in these carrier states. In several laboratory hosts SIRV2 was invariant, but SIRV1 formed many different variants that completely replaced the wild-type virus. Some of these variants were still variable, whereas others were stable. Up to 10% nucleotide substitution was found between corresponding genome fragments of three variants. Some variants showed deletions. Wild-type SIRV1, but not SIRV2, induces an SOS-like response in Sulfolobus. We propose that wild-type SIRV1 is unable to propagate in some hosts but surmounts this host range barrier by inducing a host response effecting extensive variation of the viral genome.

Amino Acid Sequence↗
PubMed2001

Sequences and replication of genomes of the archaeal rudiviruses SIRV1 and SIRV2: relationships to the archaeal lipothrixvirus SIFV and some eukaryal viruses.

The double-stranded DNA genomes of the viruses SIRV1 and SIRV2, which infect the extremely thermophilic archaeon Sulfolobus and belong to the family Rudiviridae, were sequenced. They are linear, covalently closed at the ends, and 32,312 and 35,502 bp long, respectively, with an A+T content of 75%. The genomes of SIRV1 and SIRV2 carry inverted terminal repeats of 2029 and 1628 bp, respectively, which contain multiple direct repeats. SIRV1 and SIRV2 genomes contain 45 and 54 ORFs, respectively, of which 44 are homologous to one another. Their predicted functions include a DNA polymerase, a Holliday junction resolvase, and a dUTPase. The genomes consist of blocks with well-conserved sequences separated by nonconserved sequences. Recombination, gene duplication, horizontal gene transfer, and substitution of viral genes by homologous host genes have contributed to their evolution. The finding of head-to-head and tail-to-tail linked replicative intermediates suggests that the linear genomes replicate by the same mechanism as the similarly organized linear genomes of the eukaryal poxviruses, African swine fever virus and Chlorella viruses. SIRV1 and SIRV2 both contain motifs that resemble the binding sites for Holliday junction resolvases of eukaryal viruses and may use common mechanisms for resolution of replicative intermediates. The results suggest a common origin of the replication machineries of the archaeal rudiviruses and the above-mentioned eukaryal viruses. About 1/3 of the ORFs of each rudivirus have homologs in the Sulfolobus virus SIFV of the family Lipothrixviridae, indicating that the two viral families form a superfamily. The finding of inverted repeats of at least 0.8 kb at the termini of the linear genome of SIFV supports this inference.

African Swine Fever Virus↗
PubMed2002

Remarkable morphological diversity of viruses and virus-like particles in hot terrestrial environments.

Electron microscopic studies of the viruses in two hot springs (85 degrees C, pH 1.5-2.0, and 75-93 degrees C, pH 6.5) in Yellowstone National Park revealed particles with twelve different morphotypes. This diversity encompassed known viruses of hyperthermophilic archaea, filamentous Lipothrixviridae, rod-shaped Rudiviridae, and spindle-shaped Fuselloviridae, and novel morphotypes previously not observed in nature. Two virus types resembled head-and-tail bacteriophages from the families Siphoviridae and Podoviridae, and constituted the first observation of these viruses in a hydrothermal environment. Viral hosts in the acidic spring were members of the hyperthermophilic archaeal genus Acidianus.

Archaea↗
PubMed2005

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

Acidianus↗
PubMed2004

Exceptionally diverse morphotypes and genomes of crenarchaeal hyperthermophilic viruses.

The remarkable diversity of the morphologies of viruses found in terrestrial hydrothermal environments with temperatures >80 degrees C is unprecedented for aquatic ecosystems. The best-studied viruses from these habitats have been assigned to novel viral families: Fuselloviridae, Lipothrixviridae and Rudiviridae. They all have double-stranded DNA genomes and infect hyperthermophilic crenarchaea of the orders Sulfolobales and Thermoproteales. Representatives of the different viral families share a few homologous ORFs (open reading frames). However, about 90% of all ORFs in the seven sequenced genomes show no significant matches to sequences in public databases. This suggests that these hyperthermophilic viruses have exceptional biochemical solutions for biological functions. Specific features of genome organization, as well as strategies for DNA replication, suggest that phylogenetic relationships exist between crenarchaeal rudiviruses and the large eukaryal DNA viruses: poxviruses, the African swine fever virus and Chlorella viruses. Sequence patterns at the ends of the linear genome of the lipothrixvirus AFV1 are reminiscent of the telomeric ends of linear eukaryal chromosomes and suggest that a primitive telomeric mechanism operates in this virus.

African Swine Fever Virus↗
PubMed2006

Plasmids and viruses of the thermoacidophilic crenarchaeote Sulfolobus.

The crenarchaeote Sulfolobus spp. is a host for a remarkably large spectrum of viruses and plasmids. The genetic elements characterized so far indicate a large degree of novelty in terms of morphology (viruses) and in terms of genome content (plasmids and viruses). The viruses and conjugative plasmids encode a great number of conserved proteins of unknown function due to the lack of sequence similarity to functionally characterized proteins. These apparently essential proteins remain to be studied and should help to understand the physiology and genetics of the respective genetic elements as well as the host. Sulfolobus is one of the best-studied archaeons and could develop into an important model organism of the crenarchaea and the archaea.

Amino Acid Sequence↗
PubMed2003

Bacteriophage observations and evolution.

Bacteriophages are classified into one order and 13 families. Over 5100 phages have been examined in the electron microscope since 1959. At least 4950 phages (96%) are tailed. They constitute the order Caudovirales and three families. Siphoviridae or phages with long, noncontractile tails predominate (61% of tailed phages). Polyhedral, filamentous, and pleomorphic phages comprise less than 4% of bacterial viruses. Bacteriophages occur in over 140 bacterial or archaeal genera. Their distribution reflects their origin and bacterial phylogeny. Bacteriophages are polyphyletic, arose repeatedly in different hosts, and constitute 11 lines of descent. Tailed phages appear as monophyletic and as the oldest known virus group.

Bacteriophages↗
PubMed2005

Recombination shapes the natural population structure of the hyperthermophilic archaeon Sulfolobus islandicus.

Although microorganisms make up the preponderance of the biodiversity on Earth, the ecological and evolutionary factors that structure microbial populations are not well understood. We investigated the genetic structure of a thermoacidophilic crenarchaeal species, Sulfolobus islandicus, using multilocus sequence analysis of six variable protein-coding loci on a set of 60 isolates from the Mutnovsky region of Kamchatka, Russia. We demonstrate significant incongruence among gene genealogies and a lack of association between alleles consistent with recombination rates greater than the rate of mutation. The observation of high relative rates of recombination suggests that the structure of this natural population does not fit the periodic selection model often used to describe populations of asexual microorganisms. We propose instead that frequent recombination among closely related individuals prevents periodic selection from purging diversity and provides a fundamental cohesive mechanism within this and perhaps other archaeal species.

Ecosystem↗
PubMed2006

A novel archaeal regulatory protein, Sta1, activates transcription from viral promoters.

While studying gene expression of the rudivirus SIRV1 in cells of its host, the hyperthermophilic crenarchaeon Sulfolobus, a novel archaeal transcriptional regulator was isolated. The 14 kDa protein, termed Sulfolobus transcription activator 1, Sta1, is encoded on the host chromosome. Its activating effect on transcription initiation from viral promoters was demonstrated in in vitro transcription experiments using a reconstituted host system containing the RNA polymerase, TATA-binding protein (TBP) and transcription factor B (TFB). Most pronounced activation was observed at low concentrations of either of the two transcription factors, TBP or TFB. Sta1 was able to bind viral promoters independently of any component of the host pre-initiation complex. Two binding sites were revealed by footprinting, one located in the core promoter region and the second approximately 30 bp upstream of it. Comparative modeling, NMR and circular dichroism of Sta1 indicated that the protein contained a winged helix-turn-helix motif, most probably involved in DNA binding. This strategy of the archaeal virus to co-opt a host cell regulator to promote transcription of its genes resembles eukaryal virus-host relationships.

Amino Acid Sequence↗
PubMed2005

Purification, crystallization and preliminary X-ray diffraction studies of the archaeal virus resolvase SIRV2.

The Holliday junction (or four-way junction) is the universal DNA intermediate whose interaction with resolving proteins is one of the major events in the recombinational process. These proteins, called DNA junction-resolving enzymes or resolvases, bind to the junction and catalyse DNA cleavage, promoting the release of two DNA duplexes. SIRV2 Hjc, a viral resolvase infecting a thermophylic archaeon, has been cloned, expressed and purified. Crystals have been obtained in space group C2, with unit-cell parameters a = 147.8, b = 99.9, c = 87.6, beta = 109.46 degrees, and a full data set has been collected at 3.4 A resolution. The self-rotation function indicates the presence of two dimers in the asymmetric unit and a high solvent content (77%). Molecular-replacement trials using known similar resolvase structures have so far been unsuccessful, indicating possible significant structural rearrangements.

Amino Acid Sequence↗
PubMed2004

Multiple variants of the archaeal DNA rudivirus SIRV1 in a single host and a novel mechanism of genomic variation.

The DNA rudivirus SIRV1 of the hyperthermophilic archaeon Sulfolobus shows exceptional properties. Viral isolates invariably contain a population of variants with different but closely related genomes. Upon propagation in a given host strain, one or more genomes dominate in the viral population. However, upon passage into a new host strain the viral population undergoes changes and other dominant variants are selected. Sequencing and analysis of the variant genomes revealed that major differences occur in gene order, gene size and gene content at localized genomic sites. A previously unknown mechanism of genomic rearrangement involving putative 12 bp archaeal introns appears to facilitate alteration of the variant genomes. Inter-genomic recombination between the different variants also occurs. The variant genomes exhibit signature tetranucleotide sequences near their putative sites for replication initiation.

Base Sequence↗
PubMed2004

Transcription of the rod-shaped viruses SIRV1 and SIRV2 of the hyperthermophilic archaeon sulfolobus.

The double-stranded DNA genomes of the crenarchaeal rudiviruses SIRV1 (32 kb) and SIRV2 (35 kb) were previously sequenced. Here we present results of the analysis of gene expression of these viruses at different time points after infection of the host cell, Sulfolobus islandicus, and of the mapping of transcriptional start sites. Transcription of both genomes starts simultaneously at multiple sites spread over the total length of the genome and from both strands. The earliest time point when viral transcripts could be detected in cells was 30 min after infection. At this time point all the viral genes, except one, were transcribed. Many genes were clustered and appeared to be transcribed as polycistronic messengers. Although the coat protein-encoding gene was initially also transcribed as a polycistronic messenger, an abundant monocistronic transcript of this gene was detected 2 to 3 h after infection, just before assembly of viral particles. The expression of a single gene, adjacent to the coat protein gene, was upregulated at the late phase of infection, suggesting that it might be involved in specific processing and activation of the coat protein messenger. Start sites of 13 transcripts from the SIRV1 genome have been mapped by primer extension, and promoter sequences have been identified. Similar to host promoters, these viral promoters all contain potential binding sites for the archaeal transcription factors TATA binding protein and transcription factor B. In addition, most of them contain a virus-specific consensus element, suggesting the involvement of alternative transcription factors.

Base Sequence↗