Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Phycomyces”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

On the phylogeny of Phycomyces blakesleeanus. Nucleotide sequence of 5 S ribosomal RNA.

The nucleotide sequence of the major 5 S ribosomal RNA from the lower fungus Phycomyces blakesleeanus has been determined. The sequence is 5' AAUCUACGGCCAUACAGAUAGUAACACACCGGAUCCCGUCUGAUCUCCGCAGUUAAGUCUCUCCUGGUAGCGUCAGUAC UAUGGUGGGGGACCACAUGGGAAUACGCUAUGUCGUAGGUU3'OH. The Phycomyces 5 S RNA sequence has invariant nucleotide positions characteristic of other eukaryotic 5 S RNAs and fits currently proposed secondary structural models. The Phycomyces of 5 S RNA shows relatively low overall sequence homology to the higher fungal (Ascomycetes) 5 S RNAs (56-60%) but shows higher sequence homology to those 5 S RNAs from Tetrahymena thermophila (68%), human KB cells (67%), and Spinacia oleracea (62%). A comparison of individual segments of the RNA also shows that the structure of Phycomyces 5 S RNA has several major differences from structures common to the higher fungi. Positions 2-14 are homologous with those of metazoan and some protozoan 5 S RNAs. At positions 30-45, the RNA sequence is closer to metazoan 5 S RNAs than to the Neurospora of Aspergillus 5 S RNAs. The Phycomyces 5 S RNA shares similar sequences with both Aspergillus and Tetrahymena 5 S RNAs at positions 79-99. Several other important homologies in primary and proposed secondary structures also have been observed in comparing Phycomyces 5 S RNA with animal and plant 5 S RNAs. We conclude that Phycomyces may not be as closely related phylogenetically to the Ascomycetes as previously thought.

Base Sequence↗

Transformation of Phycomyces blakesleeanus to G-418 resistance by an autonomously replicating plasmid.

The fungus, Phycomyces blakesleeanus, shows many well-defined responses to a number of external stimuli. Genetic analysis shows that at least eight genes are involved in Phycomyces sensory transduction. As a first step toward the molecular analysis of these genes and their products, we have developed a transformation protocol for Phycomyces by using a plasmid containing the kanamycin-resistance gene from Tn903 and a Phycomyces DNA fragment capable of supporting autonomous replication in yeast (ARS). Our results demonstrate that the Tn903 gene is expressed in Phycomyces and that the ARS fragment selected in yeast supports autonomous replication in Phycomyces as well.

Drug Resistance, Microbial↗

Modification of sexual development and carotene production by acetate and other small carboxylic acids in Blakeslea trispora and Phycomyces blakesleeanus.

In Phycomyces blakesleeanus and Blakeslea trispora (order Mucorales, class Zygomycetes), sexual interaction on solid substrates leads to zygospore development and to increased carotene production (sexual carotenogenesis). Addition of small quantities of acetate, propionate, lactate, or leucine to mated cultures on minimal medium stimulated zygospore production and inhibited sexual carotenogenesis in both Phycomyces and Blakeslea. In Blakeslea, the threshold acetate concentration was <1 mmol/liter for both effects, and the concentrations that had one-half of the maximal effect were <2 mmol/liter for carotenogenesis and >7 mmol/liter for zygosporogenesis. The effects on Phycomyces were similar, but the concentrations of acetate had to be multiplied by ca. 3 to obtain the same results. Inhibition of sexual carotenogenesis by acetate occurred normally in Phycomyces mutants that cannot use acetate as a carbon source and in mutants whose dormant spores cannot be activated by acetate. Small carboxylic acids may be signals that, independent of their ability to trigger spore germination in Phycomyces, modify metabolism and development during the sexual cycle of Phycomyces and Blakeslea, uncoupling two processes that were thought to be linked and mediated by a common mechanism.

Acetates↗

Isolation and molecular analysis of the orotidine-5'-phosphate decarboxylase gene (pyrG) of Phycomyces blakesleeanus.

The pyrG gene of Phycomyces was isolated from a Phycomyces genomic library, constructed in the cosmid pHS255, by hybridization with a 170 bp fragment of the pyrG gene of Aspergillus niger. This fragment includes a consensus sequence found in almost all species in which the orotidine-5'-phosphate decarboxylase (OMPdecase) gene has been sequenced. The complete nucleotide sequence of the cloned pyrG gene from Phycomyces was determined and the transcription start sites mapped. In the predicted amino acid sequence there are regions of strong homology to the equivalent genes of Saccharomyces cerevisiae, A. niger, Schizophyllum commune and Homo sapiens. Analysis of the sequence revealed the presence of two introns. The precise length and location of these introns was determined by sequencing the pyrG cDNA and comparing it with the genomic clone. Non-coding flanking regions showed obvious homology to the consensus TATA and CAAT boxes, and the polyadenylation signal "AATAAA". The pyrG gene is the second Phycomyces gene that has been cloned and analysed. This is the first time that introns have been reported in Phycomyces.

Amino Acid Sequence↗

Phycomyces and the biology of light and color.

Phycomyces has been in the laboratories for about 140 years, sometimes following trends and fashions, but often anticipating them. Researchers have been attracted by the sensitive and precise responses of Phycomyces to light and other stimuli, coupled with easy manipulations and good adaptation to laboratory life. It is a simple prototype of the many organisms that use light as a source of information but not as a significant source of energy. Growth, development, genetics, and carotene production have been other subjects of pioneering research. Phycomyces was the second organism, after us, known to require a vitamin. It was one of the first organisms in the research on spontaneous mutants and the second, after Drosophila, in which mutations were induced artificially. It was used to coin the concept and the name of heterokaryosis. Phycomyces heterokaryons offer unique experimental possibilities, for instance in the study of gene function in vivo and the causes of cell death. An overall impression of parsimony and combinatorial gene usage arises from the genetic analysis of the complex functions of this fungus. The main subjects of recent attention have been the various reactions to light, gravitropism, and some aspects of metabolism, particularly the production of carotene. Interest in Phycomyces is slacking because of the repeated failures at transforming it stably with exogenous DNA.

Carotenoids↗

Mossbauer effect studies in the fungus Phycomyces.

Mossbauer spectra of 57- Fe have been observed from different parts (mycelia, spores, sporangiophores) of the fungus Phycomyces blakesleeanus grown in an agar medium isotopically enriched with 57- Fe. The spectra indicate that the iron within Phycomyces exists primarily in two chemical states: one which is the same as that of the iron in the growth medium and the other in the form of ferritin, an iron-storage protein. The amount of iron in the former state is observed to decrease relative to the amount of iron in the latter state in going from mycelia to the sporangiophores to the sporangia themselves. Thus, the conversion of iron from the chemical state of the nutrient to ferritin has been monitored for different parts of the phycomyces. In addition, our spectra indicate that at low temperatures the iron atoms clustered within a ferritin molecule are antiferromagnetically coupled. The size of these clusters is inferred from their superparamagnetic behavior at low tempertures and comparison with horse ferritin indicates that the phycomyces ferritin iron clusters are smaller by a factor of two.

Agar↗

Sterols in erg mutants of Phycomyces: metabolic pathways and physiological effects.

Phycomyces is a fungal producer of beta-carotene and other beneficial metabolites. Several erg mutants of Phycomyces, originally selected to study the effects of membrane alteration on physiological responses, have now been used to gain information about sterol biosynthesis in filamentous fungi. One mutant, H23, and its progeny were found to be blocked at episterol C-5 dehydrogenase and did not produce ergosterol or any other sterol with a conjugated Delta(5,7) diene system. This mutant showed abnormal phototropism, which was correlated with the altered sterol composition. Another mutant, H25, seems to be a regulatory mutant. All analyzed mutants synthesized ergosta-7,22,24(28)-trien-3beta-ol, demonstrating for the first time that the sterol C-22 dehydrogenase of Phycomyces is capable of recognizing sterols with a 24(28) unsaturated side chain. New evidence regarding the biogenesis of neoergosterol and phycomysterols, the potential sparking function of cholesterol, as well as the regulation of sterol biosynthesis in this fungus is also reported. Given these results, a pathway for sterol biosynthesis in Phycomyces is proposed.

Amphotericin B↗

Nucleotide composition in protein-coding and non-coding DNA in the zygomycete Phycomyces blakesleeanus.

The zygomycete Phycomyces blakesleeanus has a 30 Mb genome with a 35% content of guanine and cytosine (GC). We determined the GC content in Phycomyces genes and fragments of genes available in public databases, the frequency of nucleotides in each codon position, and the codon usage. We observed a difference of 18% between the GC content of protein-coding and non-coding DNA. This large difference allowed the visualization of protein-coding DNA by plotting the GC content along a segment of Phycomyces DNA. We have identified a high GC DNA segment linked to the pyrG genes of the zygomycete genera Phycomyces, Mucor, and Blakeslea that corresponds to the 3' end of the gene responsible for the protein kinase C.

Amino Acid Sequence↗

Isolation and characterization of Phycomyces blakesleeanus ferritin.

Ferritin was isolated from the fungus Phycomyces blakesleeanus and compared biochemically and immunologically with horse spleen ferritin. Phycomyces and horse spleen ferritins were shown to exhibit similar electrophoretic patterns on polyacrylamide gels. Both preparations yielded an identical single band on sodium dodecyl sulfate-containing polyacrylamide gels. Tryptic digests of Phycomyces ferritin yielded 17 ninhydrin-positive spots as compared to 26 for horse spleen ferritin tryptic digests. Phycomyces ferritin was immunologically unrelated to horse spleen ferritin.

Animals↗

Biophysical considerations concerning gravity receptors and effectors including experimental studies on Phycomyces blakesleeanus.

Part I. Migration and Diffusion of Graviceptors: The physical action of gravitational and inertial forces on graviceptors is considered. The motion of graviceptors as influenced by physical dimensions, density, electric charge, composition of the suspending medium and flow variables is demonstrated. Part II. Observations on Geotropism in Phycomyces blakesleeanus: Mutants of Phycomyces blakesleeanus exhibit strikingly different rates of geotropic response. It is shown that Phycomyces grown in the dark lack normal geotropic responses: pre-exposure to light is necessary for the synthesis of structures responsible for geotropism. A physical model is presented that may account for some of the geotropic phenomena observed in Phycomyces.

Biophysical Phenomena↗

Ferritin in the fungus Phycomyces.

The iron-protein ferritin has been purified from mycelium, sporangiophores, and spores of the fungus Phycomyces blakesleeanus. It has a protein-to-iron ratio of 5, a sedimentation coefficient of 55S, a buoyant density in CsCl of 1.82 g/cm(3), and the characteristic morphology of ferritin in the electron microscope. Apoferritin prepared from Phycomyces ferritin has a sedimentation coefficient of 18S and consists of subunits of molecular weight 25,000. In the cytoplasm of Phycomyces, ferritin is located on the surface of lipid droplets (0.5-2.0 micro in diameter) where it forms crystalline monolayers which are conspicuous in electron micrographs of sporangiophore thin-sections. Ferritin is found in all developmental stages of Phycomyces but is concentrated in spores. The level of ferritin iron is regulated by the iron level in the growth medium, a 50-fold increase occurring on iron-supplemented medium.

Centrifugation, Density Gradient↗

Specific tropism caused by ultraviolet C radiation in Phycomyces.

The giant sporangiophores of Phycomyces blakesleeanus turn towards blue and away from ultraviolet C sources (wavelength under 310 nm). We have isolated fifteen mutants with normal blue tropism but defective ultraviolet tropism. Wild-type sporangiophores described a double turn when exposed successively to blue and ultraviolet beams coming from the same side; under certain conditions, the mutants turned only to the blue. The new uvi mutations modified the behaviour in heterokaryosis and were lethal in homokaryosis, i.e., they affected essential cellular components. The responses of the wild type and one of the mutants were registered and evaluated with a computer-aided device. The mutant behaved normally under blue light, but took longer than the wild type to turn away from the ultraviolet source. With very weak ultraviolet stimuli (10(-8) and l0(-9) W m-2), the wild type turned towards the source, but the mutant did not respond. Calculations of absorbed-energy distributions in the sporangiophore showed that Phycomyces responds differently to similar spatial distributions of blue and ultraviolet radiations. Wild-type and mutant sporangiophores had the same high ultraviolet absorption due to gallic acid. We conclude that ultraviolet tropism is not just a modification of blue phototropism due to the high ultraviolet absorption of the sporangiophores. Phycomyces has a separate sensory system responsive to ultraviolet radiation, but not to blue light.

Gallic Acid↗

Genetic characterization of two phototropism mutants of Phycomyces with defects in the genes madI and madJ.

Two Phycomyces genes, madI and madJ, which are involved in phototropism, were characterized by recombination and complementation analyses. The madI gene was located on linkage group IV of the genetic map of Phycomyces, 27 map units away from the gene carA. Complementation and recombination studies involving the genes madD, madE, madF, and madG, in combination with previous genetic studies, show that the recently isolated mad-407 mutation defines a novel behavioural gene, madJ, of Phycomyces. A regulatory role of the madJ gene product in the light-sensory transduction pathway is suggested.

Chromosome Mapping↗

Transformation of Phycomyces with a bacterial gene for kanamycin resistance.

Phycomyces protoplasts transformed with a plasmid containing the bacterial gene for kanamycin resistance grow in the presence of G418, a kanamycin analogue. The plasmid also contains a Phycomyces DNA sequence that supports autonomous replication in yeast. We obtained about 250 transformants per microgram DNA or one per 5000 viable protoplasts. The transformant phenotype is retained under selective conditions and lost in the majority of the vegetative spores. Recovered plasmids and Southern analysis indicate that the plasmid probably replicates autonomously in Phycomyces.

DNA Restriction Enzymes↗

Photomorphogenesis in Phycomyces: differential display of gene expression by PCR with arbitrary primers.

The zygomycete fungus Phycomyces blakesleeanus develops two types of fruiting bodies of very different size, macrophores and microphores. Blue light stimulates macrophorogenesis and inhibits microphorogenesis. I have adapted a method based on the polymerase chain reaction with arbitrary primers to investigate the role of differential gene expression during photophorogenesis in Phycomyces. Several cDNAs for genes induced in vegetative mycelium have been observed, but only one gene induced by blue light has been detected. I have demonstrated the feasibility of this approach by the isolation of a cDNA segment for the heat-shock protein HSP100 that is induced by blue light at the onset of sporangiophore development. The heat-shock protein HSP100 is an ATP-binding protein that has the ability to disassemble protein complexes. In plants, the gene for HSP100 is induced by light. The cDNA segment for HSP100 obtained from Phycomyces is 686 bp long and the predicted amino acid sequence contains one of the ATP-binding sites.

Amino Acid Sequence↗

The phytoene dehydrogenase gene of Phycomyces: regulation of its expression by blue light and vitamin A.

By using a polymerase chain reaction based cloning strategy we isolated the gene (carB) encoding the enzyme phytoene dehydrogenase from Phycomyces blakesleeanus. The deduced protein, a 583 residue polypeptide, showed great similarity to carotenoid dehydrogenases from other fungi and bacteria, especially in the amino-terminal region. The main conserved regions found in other phytoene dehydrogenases, which are thought to be essential for the enzymatic activity, are present in the sequence from Phycomyces. Heterologous expression of the Phycomyces gene in Escherichia coli showed that, as in other fungi and bacteria, a single polypeptide catalyzes the four dehydrogenations that convert phytoene to lycopene. RNA measurements indicated that the level of expression of the phytoene dehydrogenase gene in wild-type mycelia increased in response to blue light. The kinetics of this increase in transcription of the gene after blue light induction (0.1 and 0.4 W/m2) exhibit a two-step (biphasic) dependence on fluence rate, suggesting that there could be two separate components involved in the reception of the low and high blue light signal. The presence of vitamin A in the medium stimulated transcript accumulation in the wild type and in some carotenogenic mutant strains. Diphenylamine, a phytoene dehydrogenase inhibitor, did not affect the level of transcription of this gene.

Amino Acid Sequence↗

Carbamoyl-phosphate synthase in Phycomyces blakesleeanus.

A carbamoyl-phosphate synthase has been purified from mycelia of Phycomyces blakesleeanus NRRL 1555 (-). The molecular weight of the enzyme was estimated to be 188,000 by gel filtration. Polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate showed that the enzyme consists of two unequal subunits with molecular weights of 130,000 and 55,000. The purified enzyme has been shown to be highly unstable. The carbamoyl-phosphate synthase from Phycomyces uses ammonia and not L-glutamine as a primary N donor and does not require activation by N-acetyl-L-glutamate, but it does require free Mg2+ for maximal activity. Kinetic studies showed a hyperbolic behavior with respect to ammonia (Km 6.34 mM), bicarbonate (Km 10.5 mM) and ATP.2 Mg2+ (Km 0.93 mM). The optimum pH of the enzyme activity was 7.4-7.8. The Phycomyces carbamoyl-phosphate synthase showed a transition temperature at 38.5 degrees C. It was completely indifferent to ornithine, cysteine, glycine, IMP, dithiothreitol, glycerol, UMP, UDP and UTP. The enzyme was inhibited by reaction with 5 mM N-ethylmaleimide.

Carbamoyl-Phosphate Synthase (Ammonia)↗