Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Phage genomics”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources
PubMed1989

Activation of prophage P4 by the P2 Cox protein and the sites of action of the Cox protein on the two phage genomes.

Phage P2 induces the unrelated prophage P4. In this paper we show that this is due to the activation of the P4 late promoter PII by the P2 Cox protein. This is in contrast to the effects of Cox on P2, for which it is known from previous work that it acts as a repressor of the promoter Pc, which is responsible for expression of the immunity repressor C. The activator role of Cox was revealed by its effect on replication of P4 DNA and on the formation of chloramphenicol acetyltransferase when a promoterless cat gene was inserted downstream of the P4 PII promoter. DNase I protection studies revealed that the Cox protein binds to the repressor promoter Pc of phage P2 and to the promoter PII of phage P4. In the latter case the Cox protein binds upstream of the -35 region, in analogy to several other activators of promoters. A weak binding was found in the promoters Pe of phage P2 and Ple of phage P4. The Cox protein is a case of viral transactivation of the replication genes of one phage by a control protein of the other. However, the effects of the Cox protein are totally different in the two phages, repressive in one case and activating in the other.

Base Sequence↗
PubMed2002

Marine phage genomics.

Marine phages are the most abundant biological entities in the oceans. They play important roles in carbon cycling through marine food webs, gene transfer by transduction and conversion of hosts by lysogeny. The handful of marine phage genomes that have been sequenced to date, along with prophages in marine bacterial genomes, and partial sequencing of uncultivated phages are yielding glimpses of the tremendous diversity and physiological potential of the marine phage community. Common gene modules in diverse phages are providing the information necessary to make evolutionary comparisons. Finally, deciphering phage genomes is providing clues about the adaptive response of phages and their hosts to environmental cues.

Bacteriophages↗
PubMed2002

Phage genomics: small is beautiful.

The Age of Genomics dawned only gradually for bacteriophages. It was 1977 when the genome of phage phi X174 was published and 1983 when the "large" genome of phage lambda hit the streets. More recently, the pace has quickened, so that we now have over 100 complete phage genomes and can expect thousands in a very few years. These sequences have been marvelously informative for the biology of the individual phages, but with the advent of high volume sequencing technology, the real excitement for phage biology is that it is now possible to analyze the sequences together and thereby address--for the first time at whole genome resolution--a set of fundamental biological questions related to populations: What is the structure of the global phage population? What are its dynamics? How do phages evolve? This is Comparative Genomics with a capital "C".

Bacteriophages↗
PubMed2006

ZCURVE_V: a new self-training system for recognizing protein-coding genes in viral and phage genomes.

BACKGROUND: It necessary to use highly accurate and statistics-based systems for viral and phage genome annotations. The GeneMark systems for gene-finding in virus and phage genomes suffer from some basic drawbacks. This paper puts forward an alternative approach for viral and phage gene-finding to improve the quality of annotations, particularly for newly sequenced genomes. RESULTS: The new system ZCURVE_V has been run for 979 viral and 212 phage genomes, respectively, and satisfactory results are obtained. To have a fair comparison with the currently available software of similar function, GeneMark, a total of 30 viral genomes that have not been annotated by GeneMark are selected to be tested. Consequently, the average specificity of both systems is well matched, however the average sensitivity of ZCURVE_V for smaller viral genomes (< 100 kb), which constitute the main parts of viral genomes sequenced so far, is higher than that of GeneMark. Additionally, for the genome of Amsacta moorei entomopoxvirus, probably with the lowest genomic GC content among the sequenced organisms, the accuracy of ZCURVE_V is much better than that of GeneMark, because the later predicts hundreds of false-positive genes. ZCURVE_V is also used to analyze well-studied genomes, such as HIV-1, HBV and SARS-CoV. Accordingly, the performance of ZCURVE_V is generally better than that of GeneMark. Finally, ZCURVE_V may be downloaded and run locally, particularly facilitating its utilization, whereas GeneMark is not downloadable. Based on the above comparison, it is suggested that ZCURVE_V may serve as a preferred gene-finding tool for viral and phage genomes newly sequenced. However, it is also shown that the joint application of both systems, ZCURVE_V and GeneMark, leads to better gene-finding results. The system ZCURVE_V is freely available at: http://tubic.tju.edu.cn/Zcurve_V/. CONCLUSION: ZCURVE_V may serve as a preferred gene-finding tool used for viral and phage genomes, especially for anonymous viral and phage genomes newly sequenced.

Algorithms↗
PubMed2001

Comparative phage genomics and the evolution of Siphoviridae: insights from dairy phages.

Comparative phage genomics can retrace part of the evolutionary history of phage modules encoding phage-specific functions such as capsid building or establishment of the lysogenic state. The diagnosis of relatedness is not based exclusively on sequence similarity, but includes topological considerations of genome organization. The gene maps from the lambda-, psiM2-, L5-, Sfi21-, Sfi11-, phiC31-, sk1- and TM4-like phages showed a remarkable synteny of their structural genes defining a lambda supergroup within Siphoviridae (Caudovirales with long non-contractile tails). A hierarchy of relatedness within the lambda supergroup suggested elements of vertical evolution in the capsid module of Siphoviridae. Links to P22-like Podoviridae and P2-like Myoviridae were also detected. Numerous cases of horizontal gene transfer were observed, but recent transfers were limited to interbreeding phage populations. We suggest that tailed phages are the result of both vertical and horizontal evolution and are thus a good model system for web-like phylogenies.

Dairying↗
PubMed2000

The use of competitive PCR mimic to evaluate a Limulus lambda phage genomic DNA library.

1. A lambda phage genomic DNA library for Limulus (L.) polyphemus brain was constructed using the AGEM-12 vector and the host strain KW251. 2. The primary library contained approximately 1.275 x 10(6) independent clones, increasing upon amplfication to 6.66 x 10(9) pfu/ml in a total volume of 58 ml. 3. A total of 28 clones was randomly chosen for a determination of the average size of inserts in the library. All clones contained inserts and the average size was 14.9 kb, ranging from 11.7 to 28.0 kb. The library provides a 10-fold equivalent of the L. polyphemus genome. 4. A new approach for evaluating a genomic DNA library was developed, in which competitive PCR MIMIC was employed to determine the target gene copy number in both constructed library and brain genomic DNA. The putative protein kinase C epsilon (PKCepsilon) was selected as the target gene because its partial sequence of cDNA was recently cloned from L. polyphemus brain in our laboratory (Cao et al., 1998). A 419-bp fragment of nonhomologous sequence derived from putative PKCepsilon and a 306-bp fragment from plasmid pUC 18 were generated for use as target and competitor in PCR MIMIC, respectively. 5. Within the genomic library DNA, a 0.8 value was obtained for the copy number of the putative PKCepsilon gene that was detected in 0.1 amol of one equivalent L. polyphemus genome in terms of the average recombinant molecular weight. In the genomic DNA, a single copy of putative PKCepsilon was found in 0.1 amol of one coverage for the L. polyphemus genome. Thus, it was implied that nearly 80% genetic resource was incorporated into the library. This percentage was termed the incorporation rate. 6. Based on these findings, we suggest that the incorporation rate is an essential factor for evaluating genomic libraries, particularly, when using partial digestion with restriction enzymes for library construction.

Animals↗
PubMed2003

Preparation of a whole genome phage library using fragmented Escherichia coli genome and its characterization of protein binding properties by surface plasmon resonance.

A novel phage library has been prepared using the Escherichia coli genome digested with three restriction enzymes. The resulting DNA fragments were ligated to the expression vector pCANTAB5 to obtain the library of recombinant M13 phages displaying relatively long exogenous peptides. The library was screened to isolate recombinant phages with high affinity to alkaline phosphatase (AP) from calf intestine. After four rounds of panning three phages (AP1, AP2 and AP3) were shown to have specific binding properties toward AP by enzyme-linked immunosorbent assay. The phages were further characterized by surface plasmon resonance (SPR). Among the three phages AP3 bound the AP-immobilized sensor chip most and caused the highest resonant angle shift. The sensor response decreased with the decrease of the concentration of AP3 added. Furthermore, displacement of AP3 from the AP-immobilized sensor chip was observed upon injection of AP solution to the SPR system, whereas injection of bovine serum albumin solution led to the great increase of the sensor response. This result indicates the specific binding of AP3 to AP.

Alkaline Phosphatase↗
PubMed1974

Role of the phi 11 phage genome in competence of Staphylococcus aureus.

Both phage ø11 and 83A, when present as prophage or when used as helper phage, induce competence for transfection and transformation to the same level in Staphylococcus aureus, strain 8325-4. Cells lysogenized with certain temperature-sensitive (ts) mutants of phage ø11 show competence at the nonpermissive temperature (41 C) without production of infectious phages. Phage ø11ts allele 31 can neither as a prophage nor as a helper phage develop competence under nonpermissive conditions. This mutant appears, therefore, to be mutated in the region of the phage genome controlling competence. The competence level for both transfection and transformation is increased by superinfecting strain 8325-4 (ø11) or 8325-4 (83A) at high multiplicities with phage ø11 with some of its mutants or with phage 83A. This superinfection enhancement appears to require protein synthesis but not deoxyribonucleic acid synthesis as judged from studies with inhibitors of macromolecular synthesis. Besides the phage particle, no extracellular or cell-bound factors so far detected can induce competence. The phage-induced product conferring competence is rapidly synthesized by strain 8325-4 (tsø11(31)) after shift to permissive conditions, but requires deoxyribonucleic acid and protein synthesis to be expressed. Recombination between the sus mutants of phage ø11 of Kretschmer and Egan and tsø11(31) indicate that competence is controlled by an early gene in the lytic cycle which may be expressed also in lysogenic cells. The phage product inducing competence appears to have a half-life of 10 to 15 min in the conditional lethal mutant at shift to nonpermissive temperature. Ultraviolet inactivation of phage ø11 infectivity occurs more rapidly than inactivation of competence induction. In fact, the number of transformants is increased at low doses of irradiation. Competence induction is, however, decreased at high does of ultraviolet irradiation.

Azo Compounds↗
PubMed1984

[Introduction of the hybrid plasmid RP4::D3112 into Pseudomonas putida cells requires the presence of specific mutation in the phage genome].

The wild type of D3112, a transposable phage of Pseudomonas aeruginosa can not be introduced as a portion of the hybrid plasmid RP4::D3112 into Pseudomonas putida cells. It is only possible when phage D3112 carries mutations designated lpc (lethal for P. putida and Escherichia coli). Analysis of heteroduplex molecules between DNAs of phages D3112w+ and D3112lpc demonstrated the absence of nonhomology regions, which suggests that lpc is a point mutation. The lpc2 mutation was located within the interval 20-29.9 kb of the phage genome.

Alleles↗
PubMed1986

Amplification and deletion of the amyE+-tmrB+ gene region in a Bacillus subtilis recombinant-phage genome by the tmrA7 mutation.

A 22.4-kilobase DNA fragment containing the tmrA7-amyR2-amyE+-tmrB+-aroI+ region of the Bacillus subtilis N7 chromosomal DNA was cloned into a recombinant B. subtilis bacteriophage, p11-AA248. The amyE+-tmrB+ gene region, approximately 12.6 kilobases, in the phage genome was amplified in a tunicamycin-resistant (Tmr) Amy+ AroI+ transductant of B. subtilis by p11-AA248. On the other hand, the amyE+-tmrB+ region in the genomes of 80 to 90% of the phage particles was deleted when the phages were induced from the Tmr Amy+ AroI+ transductants by treatment with 1.0 micrograms of mitomycin C per ml. From analyses of the physical maps and DNA nucleotide sequences in the junction region of the deleted phage genome and the parental DNA fragments, it is suggested that the deletion occurred within a direct repeat sequence composed of 18 base pairs. The endpoints of the amplified gene region seemed to be closely related to both terminal regions of the deleted DNA.

Bacillus subtilis↗
PubMed2006

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome.

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.

Chromosomes, Bacterial↗
PubMed2002

Transcription mapping as a tool in phage genomics: the case of the temperate Streptococcus thermophilus phage Sfi21.

For the lytic growth cycle of the temperate cos-site Streptococcus thermophilus phage Sfi21 a transcription map was developed on the basis of systematic Northern blot hybridizations. All deduced 5' ends were confirmed by primer extension analysis. Three time classes of transcripts were observed. Early transcripts were identified in four different genome regions. One prominent early mRNA of 4.8 kb length covered a group of 12 genes located between the origin of replication and the cos-site. Two short early mRNAs represented a single gene from the direct vicinity of the cos-site and the superinfection immunity gene from the lysogeny module, respectively. A fourth early transcript covered a group of four genes located between the lysin and the integrase gene. Middle transcripts of 2.1 and 5.8 kb length covered cro-like and ant-like repressor genes and the DNA replication module, respectively. Four types of late transcripts were identified. The transcripts covered the likely DNA packaging genes, the head morphogenesis module plus the major tail gene, the remainder of the tail genes, and the putative tail fiber plus lysis genes, respectively. Only the transcript from the head morphogenesis genes yielded defined late mRNA species. The transcription map concurred with most of the in silico predictions for the genome organization of phage Sfi21 except for the separation of the DNA replication module from a possible transcription regulation module. Most 5' ends of the transcripts determined in primer-extension experiments were not preceded by a consensus promoter sequence. The involvement of phage-encoded regulators for middle and late transcription was suggested by chloramphenicol-inhibition experiments.

5' Untranslated Regions↗
PubMed2005

Marine phage genomics: what have we learned?

Marine phages are the most abundant and diverse form of life on the planet, and their genomes have been described as the largest untapped reservoir of genomic information. To date, however, the complete genome sequences of only 17 marine phage are known. Nevertheless, these genomes have revealed some interesting features, including the presence of photosynthetic genes in cyanophage and common patterns of genomic organization. Intriguing findings are also being made from studies of the uncultivated marine viral community genome ('metavirome'). The greatest challenge in interpreting the biology of these phages, and for making comparisons with their terrestrial counterparts, is the high proportion of unidentifiable open reading frames (approximately 60%). Future studies are likely to focus on sequencing more marine phage genomes from disparate hosts and diverse environments and on further basic studies of the biology of existing marine phages.

Bacteriophages↗
PubMed2001

FhuA-mediated phage genome transfer into liposomes: a cryo-electron tomography study.

BACKGROUND: The transfer of phage genomes into host cells is a well established but only dimly understood process. Following the irreversible phage binding to a receptor in the bacterial outer membrane, the DNA is ejected from the viral capsid and transferred across the bacterial cell envelope. In Escherichia coli, the mere interaction of the phage T5 with its outer membrane receptor, the ferrichrome transporter FhuA, is sufficient to trigger the release of the DNA from the phage capsid. Although the structure of FhuA has been determined at atomic resolution, the understanding of the respective roles of phage and bacterial proteins in DNA channeling and the mechanisms by which the transfer of the DNA is mediated remains fragmentary. RESULTS: We report on the use of cryo-electron tomography to analyze, at a molecular level, the interactions of T5 phages bound to FhuA-containing proteoliposomes. The resolution of the three-dimensional reconstructions allowed us to visualize the phage-proteoliposome interaction before and after release of the genome into the vesicles. After binding to its receptor, the straight fiber of the phage T5 (the "tip" of the viral tail made of pb2 proteins) traverses the lipid bilayer, allowing the transfer of its double-stranded DNA (121,000 bp) into the proteoliposome. Concomitantly, the tip of the tail undergoes a major conformational change; it shrinks in length (from 50 to 23 nm), while its diameter increases (from 2 to 4 nm). CONCLUSIONS: Taking into account the crystal structure of FhuA, we conclude that FhuA is only used as a docking site for the phage. The tip of the phage tail acts like an "injection needle," creating a passageway at the periphery of FhuA, through which the DNA crosses the membrane. A possible mechanistic scenario for the transfer of the viral genome into bacteria is discussed.

Bacterial Outer Membrane Proteins↗
PubMed1980

Electron microscopic observation of new transposable elements inserted into P22 phage genome from R plasmids.

By using phage P22spl, a deletion mutant of phage P22, the structures of two new transposons on P22 genomes were studied by the electron microscopic heteroduplex method. One of these was the Cm (chloramphenicol) transposon derived from an R plasmid, NR1, and the other the Km (kanamycin) transposon frin obr502. the heteroduplex between P22 phage DNAs with and without the Cm transposon revealed that the Cm transposon was similar in structure to the Tn9 element, a well-known Cm transposon derived from the R plasmid pMS14. On the other hand, the Km transposon of pNR502 was quite different in structure from other Km transposons reported previously. This transposon consists of a 6.8 kilobase (kb) segment of DNA, in which a short inverted repeat is contained. The heteroduplex experiments showed that a 4.5 kb segment of DNA was deleted from the P22 genome in the P22spl genome. Because of a shorter unit length of the genome, phage P22spl is considered to be useful of assaying various kinds of transposable elements.

Chromosome Deletion↗
PubMed1994

Sequence and organization of the lactococcal prolate-headed bIL67 phage genome.

bIL67 is a broad-host-range prolate-headed phage that is active against Lactococcus cells. The complete phage genome sequence of 22195 bp was established. Thirty-seven open reading frames (ORFs) organized in two clusters were identified. Functions were assigned to the putative products of six of the ORFs on the basis of comparison of the deduced amino acid sequences to known proteins, analysis of structural features of the proteins and search for conserved motifs. These were a DNA polymerase, a protein involved in recombination, a lysin, a terminase subunit, a structural protein and a holin.

Amino Acid Sequence↗
PubMed1988

Differential stability of filamentous phage genomes in Xanthomonas campestris pv citri.

Stability of carrier state in filamentous phage-infected Xanthomonas campestris pv citri varied drastically even for closely related phage types. The spontaneous curing frequency for cells infected with Cf16-12, Cf16, Cf16-v1 and Cf was 1, 5, 96 and 100%, respectively. The size of the phage replicative-form (RF) pool which built up rapidly at the onset of Cf16 infection was critical to the maintenance of the carrier state and the eventual integration of the prophage. A correlation in stability between phage carrier state in infected cells and lysogeny was found for these phages. The past history of a phage infection altered the response of the cured host to reinfection. In those cured cells which remained susceptible, the stability of the reinfecting phage genome was not altered appreciably, while a distinctive new plaque morphology appeared in greater than 50% of these cells. These alterations were not dependent on the prophage integration prior to curing, and no phage DNA was detected in cured cells by blot hybridisation. Notwithstanding these changes, the sites of phage integration in cured cells remained the same as the original infection on both the phage RF and the host chromosome.

Bacteriophages↗