SEARCH · Search PubMed

Results for “PARP signaling”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed2001

The enzymatic and DNA binding activity of PARP-1 are not required for NF-kappa B coactivator function.

Poly(ADP-ribose) polymerase 1 (PARP-1)-deficient mice are protected against septic shock, diabetes type I, stroke, and inflammation. We report that primary cells from PARP-1(-/-) animals are impaired in kappa B-dependent transcriptional activation induced by different stimuli involved in inflammatory and genotoxic stress signaling. PARP-1 was also required for p65-mediated transcriptional activation. PARP-1 enzymatic inhibitors did not inhibit the transcriptional activation of a kappa B-dependent reporter gene in wild type cells. Remarkably, neither the enzymatic activity nor the DNA binding activity of PARP-1 was required for kappa B-dependent transcriptional activation in PARP-1(-/-) cells complemented with different PARP-1 mutants. However, PARP-1 interacted in vitro directly with both subunits of NF-kappa B (p50 and p65), and mapping of the interaction domains revealed that both subunits bind to different PARP-1 domains. Furthermore, a PARP-1 mutant lacking the enzymatic and DNA binding activity interacted comparably to the wild type PARP-1 with p65 or p50. Finally, we showed that PARP-1 is activating the natural inducible nitric-oxide synthase and P-selectin promoter in a kappa B-dependent manner upon stimulation of the cells with inflammatory stimuli or cotransfection of p65. Our results provide evidence that neither the DNA binding nor the enzymatic activity of PARP-1 but its direct protein-protein interaction with both subunits of NF-kappa B is required for its coactivator function, thus expanding the role of PARP-1 as an essential and novel classical transcriptional coactivator for kappa B-dependent gene expression in vivo.

B-Lymphocytes↗

PubMed2004

Nuclear and mitochondrial conversations in cell death: PARP-1 and AIF signaling.

Different cell-death mechanisms control many physiological and pathological processes in humans. Mitochondria play important roles in cell death through the release of pro-apoptotic factors such as cytochrome c and apoptosis-inducing factor (AIF), which activate caspase-dependent and caspase-independent cell death, respectively. Poly(ADP-ribose) polymerase 1 (PARP-1) is emerging as an important activator of caspase-independent cell death. PARP-1 generates the majority of long, branched poly(ADP-ribose) (PAR) polymers following DNA damage. Overactivation of PARP-1 initiates a nuclear signal that propagates to mitochondria and triggers the release of AIF. AIF then shuttles from mitochondria to the nucleus and induces peripheral chromatin condensation, large-scale fragmentation of DNA and, ultimately, cytotoxicity. Identification of the pro-death and pro-survival signals in the PARP-1-mediated cell-death program might provide novel therapeutic targets in human diseases.

Apoptosis Inducing Factor↗

PubMed2000

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Animals↗

PubMed2000

Apoptosis in the dorsal lateral geniculate nucleus after monocular deprivation involves glutamate signaling, NO production, and PARP activation.

In mammals, visual experience during early postnatal life is critical for normal development of the visual system. Here we report that monocular deprivation for 2, 7, and 14 consecutive days causes p53 accumulation, cell death, and progressive loss of neurones in the dorsal lateral geniculate nucleus (dLGN) of newborn rats and these are prevented by NMDA and non-NMDA glutamate receptor antagonists, and by L-NAME, an inhibitor of nitric oxide synthesis. Monocular deprivation also increases dLGN levels of citrulline, the coproduct of nitric oxide synthesis, and this, as well as cell death and neuronal loss, is abolished by antagonists of glutamate receptors and by L-NAME. Finally, poly-(ADP-ribose) polymerase (PARP) knock-out mice appear to be protected from monocular deprivation-induced cell death. In conclusion, during early postnatal development of the rat visual system monocular deprivation causes excitotoxic, nitric oxide-mediated, cell death in the dLGN that appears to be apoptotic and also requires activation of PARP.

Animals↗

PubMed2000

A fast signal-induced activation of Poly(ADP-ribose) polymerase: a novel downstream target of phospholipase c.

We present the first evidence for a fast activation of the nuclear protein poly(ADP-ribose) polymerase (PARP) by signals evoked in the cell membrane, constituting a novel mode of signaling to the cell nucleus. PARP, an abundant, highly conserved, chromatin-bound protein found only in eukaryotes, exclusively catalyzes polyADP-ribosylation of DNA-binding proteins, thereby modulating their activity. Activation of PARP, reportedly induced by formation of DNA breaks, is involved in DNA transcription, replication, and repair. Our findings demonstrate an alternative mechanism: a fast activation of PARP, evoked by inositol 1,4,5,-trisphosphate-Ca(2+) mobilization, that does not involve DNA breaks. These findings identify PARP as a novel downstream target of phospholipase C, and unveil a novel fast signal-induced modification of DNA-binding proteins by polyADP-ribosylation.

Animals↗

PubMed2005

PolyADP-ribosylation is involved in neurotrophic activity.

PolyADP-ribosylation is a transient posttranslational modification of proteins, mainly catalyzed by poly(ADP-ribose)polymerase-1 (PARP-1). This highly conserved nuclear protein is activated rapidly in response to DNA nick formation and promotes a fast DNA repair. Here, we examine a possible association between polyADP-ribosylation and the activity of neurotrophins and neuroprotective peptides taking part in life-or-death decisions in mammalian neurons. The presented results indicate an alternative mode of PARP-1 activation in the absence of DNA damage by neurotrophin-induced signaling mechanisms. PARP-1 was activated in rat cerebral cortical neurons briefly exposed to NGF-related nerve growth factors and to the neuroprotective peptides NAP (the peptide NAPVSIPQ, derived from the activity-dependent neuroprotective protein ADNP) and ADNF-9 (the peptide SALLRSIPA, derived from the activity-dependent neurotrophic factor ADNF) In addition, polyADP-ribosylation was involved in the neurotrophic activity of NGF-induced and NAP-induced neurite outgrowth in differentiating pheochromocytoma 12 cells as well as in the neuroprotective activity of NAP in neurons treated with the Alzheimer's disease neurotoxin beta-amyloid. A fast loosening of the highly condensed chromatin structure by polyADP-ribosylation of histone H1, which renders DNA accessible to transcription and repair, may underlie the role of polyADP-ribosylation in neurotrophic activity.

Amyloid beta-Peptides↗

PubMed2005

Poly(ADP-ribosyl)ation by PARP-1: 'PAR-laying' NAD+ into a nuclear signal.

Poly(ADP-ribose) (PAR) and the PAR polymerases (PARPs) that catalyze its synthesis from donor nicotinamide adenine dinucleotide (NAD+) molecules have received considerable attention in the recent literature. Poly(ADP-ribosyl)ation (PARylation) plays diverse roles in many molecular and cellular processes, including DNA damage detection and repair, chromatin modification, transcription, cell death pathways, insulator function, and mitotic apparatus function. These processes are critical for many physiological and pathophysiological outcomes, including genome maintenance, carcinogenesis, aging, inflammation, and neuronal function. This review highlights recent work on the biochemistry, molecular biology, physiology, and pathophysiology of PARylation, focusing on the activity of PARP-1, the most abundantly expressed member of a family of PARP proteins. In addition, connections between nuclear NAD+ metabolism and nuclear signaling through PARP-1 are discussed.

Aging↗

PubMed2004

The effect of PARP inhibitor on ischaemic cell death, its related inflammation and survival signals.

Poly(ADP-ribose) polymerase (PARP) plays an important role in ischaemic cell death, and 3-aminobenzamide (3-AB), one of the PARP inhibitors, has a protective effect on ischaemic stroke. We investigated the neuroprotective mechanisms of 3-AB in ischaemic stroke. The occlusion of middle cerebral artery (MCA) was made in 170 Sprague-Dawley rats, and reperfusion was performed 2 h after the occlusion. Another 10 Sprague-Dawley rats were used for sham operation. 3-AB was administered to 85 rats 10 min before the occlusion [3-AB group (n = 85) vs. control group without 3-AB (n = 85)]. Infarct volume and water content were measured, brain magnetic resonance imaging, terminal deoxynucleotidyltransferase (TdT)-mediated dUTP-biotin nick end-labelling (TUNEL) and Cresyl violet staining were performed, and immunoreactivities (IRs) of poly(ADP-ribose) polymer (PAR), cleaved caspase-3, CD11b, intercellular adhesion molecule-1 (ICAM-1), cyclooxygenase-2 (COX-2), phospho-Akt (pAkt) and phospho-glycogen synthase kinase-3 (pGSK-3) were compared in the peri-infarcted region of the 3-AB group and its corresponding ischaemic region of the control group at 2, 8, 24 and 72 h after the occlusion. In the 3-AB group, the infarct volume and the water content were decreased (about 45% and 3.6%, respectively, at 24 h), the number of TUNEL-positive cells was decreased (about 36% at 24 h), and the IRs of PAR, cleaved caspase-3, CD11b, ICAM-1 and COX-2 were significantly reduced, while the IRs of pAkt and pGSK-3 were increased. These results suggest that 3-AB treatment could reduce the infarct volume by reducing ischaemic cell death, its related inflammation and increasing survival signals. The inhibition of PARP could be another potential neuroprotective strategy in ischaemic stroke.

Animals↗

PubMed2003

Tumour necrosis factor-alpha- vs. growth factor deprivation-promoted cell death: distinct converging pathways.

Perturbations of neuronal physiological homeostasis are likely to underscore neuronal demise/impairments that are reportedly associated with aging of the central nervous system and age-related neurodegenerative diseases such as Alzheimer's disease (AD). A number of age- and/or disease-associated neurotoxic events has been described. These include abnormally modified proteins such as beta amyloid and hyper-phosphorylated Tau, cytokines such as tumour necrosis factor-alpha (TNFalpha), high levels of free radicals conducive to oxidative stress, and impaired/decreased neuronal trophic support by neurotrophic factors. Overall, it could be argued that toxic events in the aged brain are either active, such as those due to a direct action of cytokines, or passive, such as those due to lack of growth factor support. It is therefore conceivable that cellular responses to such diverse toxic stimuli are different, suggesting that interventions should be targeted accordingly. In order to begin answering this question, we determined in PC12 cells the time course of activity, in response to TNFalpha (active) or growth factor withdrawal (passive), of protein kinase c-zeta (PKCzeta), nuclear factor kappa B (NFkappaB), caspases 3 and 8, and poly (ADP-ribose) polymerase (PARP), key signal transduction elements associated with modulation of cell death/survival in PC12 cells. We found that the overall activity of PKCzeta, NFkappaB and caspase 8 was significantly different depending on the apoptotic initiator. The pattern of caspase 3 and PARP activity, however, was not statistically different between serum-free- and TNFalpha-induced cell death conditions. This suggests that two distinct cell responses are elicited that converge at caspase 3, which then induces downstream events involved in the execution of a common apoptotic programme. These results contribute to the aim of differentially targeting neuronal death in the aged brain (characterized by neurotrophic factor impairments) or in the diseased brain (e.g. AD, characterized by elevated levels of pro-inflammatory cytokines).

Animals↗

PubMed2005

An in vivo evaluation of docetaxel delivered intratumorally in head and neck squamous cell carcinoma.

OBJECTIVE: To identify activity and biological mechanisms of intratumoral (IT) docetaxel on head and neck squamous cell carcinoma (HNSCC). METHODS: Docetaxel IT therapy was tested in xenograft models of 2 HNSCC lines, HN30 and HN12. The overall and disease-free survival rates, tumor growth, and toxic effects were measured. The pharmacokinetic profiles of docetaxel in plasma and tumor were compared after IT and intravenous (IV) administration. Comparisons between common and supradoses of docetaxel with regard to expression of regulators in the cell cycle, apoptosis, and signal transduction pathways were determined using Western blot analysis. RESULTS: In the HN30 and HN12 xenograft models, IT docetaxel improved overall as well as disease-free survival and reversed tumor growth. The only toxic effects noted were local (alopecia and skin breakdown). Skin breakdown resolved in all cases. At equivalent dosing levels, IT docetaxel achieved a 26-fold higher peak tumor concentration and 24-fold longer tumor exposure than IV treatment. Furthermore, limited plasma exposure was noted with IT docetaxel. Supradose levels of docetaxel produced distinct protein expression patterns for regulators of the cell cycle (cyclins A and B, p21, and p27), apoptosis (cleaved caspase-3 and cleaved PARP), and signal transduction (EGFR, pEGFR, pc-Jun, and pERK) in HNSCC, which supports a distinctive mechanism of action for supradose docetaxel levels. Since levels of cleaved caspase-3 and PARP, markers of apoptosis, were only elevated with lower doses, the observed cell death at supradose levels was probably due to necrosis. CONCLUSIONS: Injections of IT docetaxel at usual and supradoses are associated with a pharmacokinetic profile and biological mechanism distinct from those observed with usual IV doses. It is calculated that IT therapy in men will increase peak concentrations of docetaxel in tumors by 1000-fold over the conventional IV dose used clinically. These preclinical results support further testing of IT docetaxel in HNSCC.

Animals↗

PubMed1999

Inhibition of nuclear receptor signalling by poly(ADP-ribose) polymerase.

Mammalian poly(ADP-ribose) polymerase (PARP) is a nuclear chromatin-associated protein with a molecular mass of 114 kDa that catalyzes the transfer of ADP-ribose units from NAD+ to nuclear proteins that are located within chromatin. We report here the identification of a novel property of PARP as a modulator of nuclear receptor signalling. PARP bound directly to retinoid X receptors (RXR) and repressed ligand-dependent transcriptional activities mediated by heterodimers of RXR and thyroid hormone receptor (TR). The interacting surface is located in the DNA binding domain of RXRalpha. Gel shift assays demonstrated that PARP bound to TR-RXR heterodimers on the response element. Overexpression of wild-type PARP selectively blocked nuclear receptor function in transient transfection experiments, while enzyme-defective mutant PARP did not show significant inhibition, suggesting that the essential role of poly(ADP-ribosyl) enzymatic activity is in gene regulation by nuclear receptors. Furthermore, PARP fused to the Gal4 DNA binding domain suppressed the transcriptional activity of the promoter harboring the Gal4 binding site. Thus, PARP has transcriptional repressor activity when recruited to the promoter. These results indicates that poly(ADP-ribosyl)ation is a negative cofactor in gene transcription, regulating a member of the nuclear receptor superfamily.

Animals↗

PubMed2005

PARP-1 determines specificity in a retinoid signaling pathway via direct modulation of mediator.

We show that PARP-1 is indispensable to retinoic acid receptor (RAR)-mediated transcription from the RARbeta2 promoter in a highly purified, reconstituted transcription system and that RA-inducible expression of all RARbeta isoforms is abrogated in PARP-1(-/-) cells in vivo. Importantly, PARP-1 activity was independent of its catalytic domain. PARP-1 directly interacts with RAR and Mediator. Chromatin immunoprecipitation experiments confirmed the presence of PARP-1 and Mediator on RAR-responsive promoters in vivo. Importantly, Mediator was inactive (Cdk8+) under basal conditions but was activated (Cdk8-) upon induction. However, in PARP-1(-/-) cells, Mediator was retained in its inactive state (Cdk8+) upon induction consistent with the absence of gene expression. PARP-1 became dispensable for ligand-dependent transcription in a chromatin reconstituted transcription assay when Mediator was devoid of the Cdk8 module (CRSP). PARP-1 appears to function as a specificity factor regulating the RA-induced switch of Mediator from the inactive (Cdk8+) to the active (Cdk8-) state in RAR-dependent transcription.

Animals↗

PubMed1998

Zinc is an essential cofactor for recognition of the DNA binding domain of poly(ADP-ribose) polymerase by antibodies in autoimmune rheumatic and bowel diseases.

OBJECTIVE: To characterize autoantibody response to poly(ADP-ribose) polymerase (PARP) and to assess the significance of autoantibodies to the 2 zinc fingers of this enzyme in patients with autoimmune rheumatic and bowel diseases. METHODS: The specificity of antienzyme autoantibodies was established by dot immunoassay with recombinant human PARP and by enzyme-linked immunosorbent assay using the recombinant N-terminal fragment containing the DNA binding domain of PARP, the recombinant C-terminal catalytic domain (40-kd fragment), a peptide containing the nuclear localization signal (NLS) of PARP, 2 synthetic peptides (and mutated peptides) corresponding to zinc-finger motifs F1 and F2 that are present in the DNA binding domain, zinc fingers from other self antigens (e.g., peptides from Ro60, Ro52, and U1C proteins), and poly(ADP-ribose). Sera from patients with autoimmune rheumatic and bowel diseases were tested, as were affinity-purified antibodies. Histocompatibility typing of systemic lupus erythematosus (SLE) patients was performed by serology. RESULTS: Antibodies from the patient sera reacted only weakly with the recombinant N- and C-terminal domains and with the NLS peptide. In contrast, the 2 synthetic peptides corresponding to zinc-finger motifs F1 and F2 represented immunodominant targets for IgG antibodies from patients with SLE, mixed connective tissue disease (MCTD), Crohn's disease, and ulcerative colitis. The sera from patients with SLE and MCTD showed much weaker reactivity with mutant peptides F1 and F2, which contain mutations at the cysteine residues involved in zinc coordination. F1/F2 antibodies did not cross-react with zinc fingers from other self proteins. No correlation was found between the presence of F1/F2 autoantibodies in SLE sera and the presence of other autoantibodies typical of this disease (e.g., anti-double-stranded DNA and poly[ADP-ribose] antibodies). The presence of F2 antibodies in the serum of SLE patients was negatively associated with HLA-DR6. CONCLUSION: An autoimmune response to PARP is potentially important because this enzyme is involved in DNA repair and is rapidly cleaved during the "execution phase" of apoptosis. The high prevalence in certain autoimmune rheumatic and bowel diseases of antibodies to F1 and F2, which are directly involved in this process, is further evidence implicating involvement of the DNA repair system in chronic inflammatory diseases.

Amino Acid Sequence↗

PubMed2006

Poly(ADP-ribose) polymerase-1 signaling to mitochondria in necrotic cell death requires RIP1/TRAF2-mediated JNK1 activation.

Poly(ADP-ribose) polymerase-1 (PARP-1) hyperactivation-induced necrosis has been implicated in several pathophysiological conditions. Although mitochondrial dysfunction and apoptosis-inducing factor translocation from the mitochondria to the nucleus have been suggested to play very important roles in PARP-1-mediated cell death, the signaling events downstream of PARP-1 activation in initiating mitochondria dysfunction are not clear. Here we used the DNA alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine, a potent PARP-1 activator, to study PARP-1 activation-mediated cell death. We found, based on genetic knockouts and pharmacological inhibition, that c-Jun N-terminal kinase (JNK), especially JNK1, but not the other groups of mitogen-activated protein kinase, is required for PARP-1-induced mitochondrial dysfunction, apoptosis-inducing factor translocation, and subsequent cell death. We reveal that receptor-interacting protein 1 (RIP1) and tumor necrosis factor receptor-associated factor 2 (TRAF2), are upstream of JNK in PARP-1 hyperactivated cells, because PARP-1-induced JNK activation was attenuated in RIP1-/- and TRAF2-/- mouse embryonic fibroblast cells. Consistently, knockouts of RIP1 and TRAF2 caused a resistance to PARP-1-induced cell death. Therefore, our study uncovers that RIP1, TRAF2, and JNK comprise a pathway to mediate the signaling from PARP-1 overactivation to mitochondrial dysfunction.

Animals↗

PubMed2004

Deadly conversations: nuclear-mitochondrial cross-talk.

Neuronal damage following stroke or neurodegenerative diseases is thought to stem in part from overexcitation of N -methyl-D-aspartate (NMDA) receptors by glutamate. NMDA receptors triggered neurotoxicity is mediated in large part by activation of neuronal nitric oxide synthase (nNOS) and production of nitric oxide (NO). Simultaneous production of superoxide anion in mitochondria provides a permissive environment for the formation of peroxynitrite (ONOO-). Peroxynitrite damages DNA leading to strand breaks and activation of poly(ADP-ribose) polymerase-1 (PARP-1). This signal cascade plays a key role in NMDA excitotoxicity, and experimental models of stroke and Parkinson's disease. The mechanisms of PARP-1-mediated neuronal death are just being revealed. While decrements in ATP and NAD are readily observed following PARP activation, it is not yet clear whether loss of ATP and NAD contribute to the neuronal death cascade or are simply a biochemical marker for PARP-1 activation. Apoptosis-inducing factor (AIF) is normally localized to mitochondria but following PARP-1 activation, AIF translocates to the nucleus triggering chromatin condensation, DNA fragmentation and nuclear shrinkage. Additionally, phosphatidylserine is exposed and at a later time point cytochrome c is released and caspase-3 is activated. In the setting of excitotoxic neuronal death, AIF toxicity is caspase independent. These observations are consistent with reports of biochemical features of apoptosis in neuronal injury models but modest to no protection by caspase inhibitors. It is likely that AIF is the effector of the morphologic and biochemical events and is the commitment point to neuronal cell death, events that occur prior to caspase activation, thus accounting for the limited effects of caspase inhibitors. There exists significant cross talk between the nucleus and mitochondria, ultimately resulting in neuronal cell death. In exploiting this pathway for the development of new therapeutics, it will be important to block AIF translocation from the mitochondria to the nucleus without impairing important physiological functions of AIF in the mitochondria.

Animals↗

PubMed1997

Expression of bloodstream variant surface glycoproteins in procyclic stage Trypanosoma brucei: role of GPI anchors in secretion.

Using transformed procyclic trypanosomes, the synthesis, intracellular transport and secretion of wild-type and mutant variant surface glycoprotein (VSG) is characterized. We find no impediment to the expression of this bloodstream stage protein in insect stage cells. VSG receives a procyclic-type phosphatidylinositol-specific phospholipase C-resistant glycosyl phosphatidylinositol (GPI) anchor, dimerizes and is N-glycosylated. It is transported to the plasma membrane with rapid kinetics (t(1/2) approximately 1 h) and then released by a cell surface zinc-dependent metalloendoprotease activity, a possible homolog of leishmanial gp63. Deletion of the C-terminal GPI addition signal generates a soluble form of VSG that is exported with greatly reduced kinetics (t(1/2) approximately 5 h). Fusion of the procyclic acidic repetitive protein (PARP) GPI anchor signal to the C-terminus of the truncated VSG reporter restores both GPI addition and transport competence, suggesting that GPI anchors play a critical role in the folding and/or forward transport of newly synthesized VSG. The VSG-PARP fusion is also processed near the C-terminus by events that do not involve N-linked oligosaccharides and which are consistent with GPI side chain modification. This unexpected result suggests that GPI processing may be influenced by adjacent peptide sequence or conformation.

Amino Acid Sequence↗

PubMed2005

Pathophysiologic role of oxidative stress-induced poly(ADP-ribose) polymerase-1 activation: focus on cell death and transcriptional regulation.

PARP-1 is a nuclear enzyme activated by DNA breaks. Activated PARP-1 cleaves NAD into nicotinamide and ADP-ribose and polymerizes the latter covalently coupled to nuclear acceptor proteins. Poly(ADP-ribosyl)ation has been implicated in the regulation of a diverse array of cellular processes ranging from DNA repair, chromatin organization, transcription, replication to protein degradation. On the 'dark side' of poly(ADP-ribosyl)ation, PARP-1 activation has been shown to contribute to tissue injury in shock, diabetes, myocardial or cerebral ischemia reperfusion and various forms of inflammation, as proven by pharmacological studies as well as experiments utilizing PARP-1 knockout animals. To our current knowledge, two mechanisms are responsible for the beneficial effects of PARP inhibitors in inflammatory, neurodegenerative and ischemia-reperfusion-based diseases: (i) inhibition of cell death caused by over-activation of PARP-1; (ii) inhibition of inflammatory signal transduction and production of inflammatory mediators. Here we review the possible regulatory mechanisms (e.g. calcium signaling, metabolism, density-dependent signaling, kinase cascades) of the PARP-1-mediated cell death pathway and discuss recent developments shedding new light on the complex role of PARP-1 in the regulation of the expression of inflammatory mediators.

Animals↗

PubMed2003

Parp-1 deficiency implicated in colon and liver tumorigenesis induced by azoxymethane.

Poly(ADP-ribose) polymerase-1 (Parp-1) is activated by DNA strand breaks and functions in the maintenance of genomic integrity and cell death control. On the other hand, Parp-1 is also involved in transcriptional regulation of various genes, and the relationship between Parp-1 deficiency and susceptibility to tumorigenesis has not been fully elucidated. In the present study, Parp-1(-/-) mice, harboring exon 1 disruption in Parp-1, and Parp-1(+/+) animals were administered azoxymethane (AOM) at a dose of 10 mg/kg body weight once a week for 6 weeks. At 30 weeks after the first carcinogen treatment, mice were sacrificed. The incidence of animals bearing either adenomas or adenocarcinomas in the colon and the average number of colon tumors per mouse were significantly higher in Parp-1(-/-) mice than in Parp-1(+/+) animals. beta-Catenin accumulation was observed in 43/44 of Parp-1 (-/-) tumors and 19/21 of the Parp-1(+/+) tumors and was not statistically different between the genotypes. This suggests that most tumors developed through a pathway involving the alteration of Wnt-beta-catenin signaling in both Parp-1(-/-) and Parp-1(+/+) mice. In the liver, where AOM is primarily activated, the incidence of animals bearing nodules and the average number of nodules per section were significantly increased in Parp-1(-/-) mice compared with Parp-1(+/+) mice. Therefore, the results indicate that susceptibility to AOM-induced tumorigenesis in the colon and also in the liver is enhanced in Parp-1(-/-) mice, and Parp-1 could have a substantial role in colon and liver tumorigenesis.

Adenocarcinoma↗