Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “MAP Kinase Kinase 2”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources
PubMed1996

Cellular expression of MAP 2 kinase in rat brain.

The cellular localization of microtubule-associated protein (MAP) 2 kinase mRNA in rat brain was examined by in situ hybridization histochemistry using a synthetic oligonucleotide probe. MAP 2 kinase was expressed in both neuronal and non-neuronal cells. Areas of high density of mRNA label by the MAP 2 kinase probe appeared to be associated with high cellular packing density. Thus, MAP 2 kinase expression was particularly high in regions such as the locus coeruleus, the piriform cortex, the dentate gyrus granule cell layer, pyramidal cells of the hippocampus, the mitral cells of the olfactory bulb, and the large motor neurons of the V and VII nerves. This apparent ubiquitous distribution suggests an important role of MAP 2 kinase in the cellular functions in most cells of the adult brain.

Animals↗
PubMed1993

Site-directed mutagenesis of the juxtamembrane domain of the human insulin receptor.

We have studied the functions of the juxtamembrane domain (941-989) of the human insulin receptor by site-directed mutagenesis. Tyrosine phosphorylation of pp185 was impaired in Chinese hamster ovary cells expressing the receptors with the alteration of Tyr960, but not of Tyr953 or Tyr972, to Phe (CHO-Y960F cells) as compared with cells expressing the normal receptors. In CHO-Y960F cells, tyrosine phosphorylation of insulin receptor substrate-1 (IRS-1), the activation of phosphatidylinositol 3-kinase in the anti-phosphotyrosine and anti-IRS-1 immunoprecipitates, the activation of mitogen-activated protein (MAP) kinase, and biological actions were also impaired. In addition, although the deletion of residues 954-965 severely impaired insulin internalization, the deletion of NPXY (957-960), the internalization signal of the low density lipoprotein receptor, did not affect internalization. Moreover, neither the deletions around Tyr953 nor the alterations of the tyrosines (953, 960, or 972) significantly reduced internalization. These data suggest that: 1) Tyr960 is important for the recognition of pp185/IRS-1, the association of phosphatidylinositol 3-kinase with pp185/IRS-1, and the activation of MAP kinase; 2) MAP kinase may lie downstream of pp185/IRS-1 in insulin's signal transduction; and 3) the juxtamembrane domain, but not NPXY or individual tyrosines, is important for insulin internalization.

Amino Acid Sequence↗
PubMed1998

Feedback regulation of Raf-1 and mitogen-activated protein kinase (MAP) kinase kinases 1 and 2 by MAP kinase phosphatase-1 (MKP-1).

Inactivation of growth factor-regulated mitogen-activated protein (MAP) kinases (ERK1 and ERK2) has been proposed to occur in part through dephosphorylation by the dual specificity MAP kinase phosphatase-1 (MKP-1), an immediate early gene that is induced by mitogenic signaling. In this study, we examined the effect of MKP-1 on signaling components upstream of ERK1 and ERK2. Coexpression of MKK1 or MKK2 with MKP-1 resulted in 7-10-fold activation of mitogen-activated protein kinase kinase (MKK), which required the presence of regulatory serine phosphorylation sites. Endogenous MKK1 and MKK2 were also activated upon MKP-1 expression. Raf-1, a direct regulator of MKK1 and MKK2, was activated under these conditions, and a synergistic activation of MKK was observed upon coexpression of Raf-1 and MKP-1. This effect did not appear to involve synthesis of autocrine growth factors or the inhibition of basal extracellular signal-regulated kinase (ERK) activity but was inhibited by a dominant negative Ras mutant, indicating that MKP-1 enhances Ras-dependent activation of Raf-1 in a cell autonomous manner. This study demonstrates positive feedback regulation of Raf-1 and MKK by the MKP-1 immediate early gene and a potential mechanism for activating Raf-1/MKK signaling pathways alternative to those involving ERK.

3T3 Cells↗
PubMedDate not supplied

Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

Cisplatin↗
PubMed1993

The chemotactic factor N-formylmethionyl-leucyl-phenylalanine activates microtubule-associated protein 2 (MAP) kinase and a MAP kinase kinase in polymorphonuclear leucocytes.

Incubation of human polymorphonuclear leucocytes (PMN) with either the chemotactic factor N-formylmethionyl-leucylphenylalanine (FMLP) or phorbol 12-myristate 13-acetate (PMA) activates a kinase with phosphorylating activity towards a known microtubule-associated protein-2 (MAP) kinase substrate, the epidermal growth factor receptor peptide (T669). Activation of this enzyme by FMLP was maximal at 1 min, decreasing by 10 min. Activation by PMA was slightly slower than that by FMLP, but more prolonged (maximal at 5 min, with no significant decrease by 20 min). The enzyme induced by either stimulant bound strongly to phenyl-Sepharose, had a molecular mass of 40 kDa on gel filtration and phosphorylated three MAP kinase substrates, i.e. MAP, myelin basic protein and the T669 peptide. By use of antibodies to MAP kinases and phosphotyrosine, the enzyme was identified as the 42 kDa MAP kinase (also known as extracellular-signal-regulated kinase 2, ERK2). Stimulation of PMN with FMLP or PMA was also found to induce a kinase kinase which phosphorylated human recombinant MAP kinase on threonine and tyrosine, with concomitant activation. These results suggest that MAP kinase and the kinase kinase are involved in the activation of PMN by chemotactic factors such as FMLP.

Animals↗
PubMed2004

Differential activation of ERK1,2 MAP kinase signaling pathway in mesenchymal stem cell from control and osteoporotic postmenopausal women.

Osteoblasts, the cells responsible for bone formation, derive from mesenchymal stem cells (MSCs) in bone marrow. To acquire a new cell phenotype, uncommitted MSCs must undergo several proliferation and differentiation changes. Although, it is known that extracellular signal-regulated protein kinases (ERKs) mitogen-activated protein (MAP) kinase pathway signaling is involved in the proliferation and differentiation processes, the role of ERKs in osteogenic differentiation it is controversial, at present. In addition, the function that ERK could play in MSCs derived from osteoporotic patients it is not well documented. In this study, we analyze whether previously observed differences in the dynamic response of MSCs from normal and osteoporotic postmenopausal women can be explained by changes in the activation of this signal transduction pathway. Levels of ERK phosphorylation and their correlation with osteogenic differentiation were evaluated in cultures of MSCs derived from osteoporotic postmenopausal women and "healthy" controls. The results show that, under basal conditions, MSCs derived from osteoporotic donors show a level of ERK phosphorylation 2.5 times higher than MSCs derived from control donors. The addition of the osteogenic stimulus only slightly increases the p-ERK level in cells derived from osteoporotic donors, and is higher in cells derived from control women. Important differences in the ability of PD98059 to inhibit phosphorylation of ERK in both types of cells were also observed, as well as the effect that this inhibition produced on calcium deposition. We conclude that the MAP kinase pathway signaling is differentially activated in MSCs derived from osteoporotic postmenopausal women. The high p-ERK levels in MSC derived from osteoporotic donors could determine the unresponsiveness of these cells to the osteogenic differentiation stimulus.

Aged↗
PubMed2003

Activating MAP KAP kinase 2.

The crystal structures of MAP KAP kinase 2 in complex with ADP and staurosporine suggest a major reorganization of the glycine-rich loop upon ligand binding. The main determinant for the catalytic activity of MAP KAP kinase 2 is phosphorylation by p38 MAP kinase.

Adenosine Diphosphate↗
PubMed2004

Dystroglycan, a scaffold for the ERK-MAP kinase cascade.

Dystroglycan is an important cell adhesion receptor linking the actin cytoskeleton, via utrophin and dystrophin, to laminin in the extracellular matrix. To identify adhesion-related signalling molecules associated with dystroglycan, we conducted a yeast two-hybrid screen and identified mitogen-activated protein (MAP) kinase kinase 2 (MEK2) as a beta-dystroglycan interactor. Pull-down experiments and localization studies substantiated a physiological link between beta-dystroglycan and MEK and localized MEK with dystroglycan in membrane ruffles. Moreover, we also identified active extracellular signal-regulated kinase (ERK), the downstream kinase from MEK, as another interacting partner for beta-dystroglycan and localized both active ERK and dystroglycan to focal adhesions in fibroblast cells. These studies suggest a role for dystroglycan as a multifunctional adaptor or scaffold capable of interacting with components of the ERK-MAP kinase cascade including MEK and ERK. These findings have important implications for our understanding of the role of dystroglycan in normal cellular processes and in disease states such as muscular dystrophy.

Animals↗
PubMed2002

Regulation of translation during in vitro maturation of bovine oocytes: the role of MAP kinase, eIF4E (cap binding protein) phosphorylation, and eIF4E-BP1.

Meiotic maturation of mammalian oocytes (transition from prophase I to metaphase II) is accompanied by complex changes in the protein phosphorylation pattern. At least two major protein kinases are involved in these events; namely, cdc2 kinase and mitogen-activated protein (MAP) kinase, because the inhibition of these kinases arrest mammalian oocytes in the germinal vesicle (GV) stage. We show that during meiotic maturation of bovine oocytes, the translation initiation factor, eIF4E (the cap binding protein), gradually becomes phosphorylated. This substantial phosphorylation begins at the time of germinal vesicle breakdown (GVBD) and continues to the metaphase II stage. The onset of eIF4E phosphorylation occurs in parallel with a significant increase in overall protein synthesis. However, although eIF4E is nearly fully phosphorylated in metaphase II oocytes, protein synthesis reaches only basal levels at this stage, similar to that of prophase I oocytes, in which the factor remains unphosphorylated. We present evidence that a specific repressor of eIF4E, the binding protein 4E-BP1, is present and could be involved in preventing eIF4E function in metaphase II stage oocytes. Recently, two protein kinases, called Mnk1 and Mnk2, have been identified in somatic cells as eIF4E kinases, both of which are substrates of MAP kinase in vivo. In bovine oocytes, a specific inhibitor of cdk kinases, butyrolactone I, arrests oocytes in GV stage and prevents activation of both cdc2 and MAP kinase. Under these conditions, the phosphorylation of eIF4E is also blocked, and its function in initiation of translation is impaired. In contrast, PD 098059, a specific inhibitor of the MAP kinase activation pathway, which inhibits the MAP kinase kinase, called MEK function, leads only to a postponed GVBD, and a delay in MAP kinase and eIF4E phosphorylation. These results indicate that in bovine oocytes, 1) MAP kinase activation is only partially dependent on MEK kinase, 2) MAP kinase is involved in eIF4E phosphorylation, and 3) the abundance of fully phosphorylated eIF4E does not necessarily directly stimulate protein synthesis. A possible MEK kinase-independent pathway of MAP kinase phosphorylation and the role of 4E-BP1 in repressing translation in metaphase II oocytes are discussed.

Animals↗
PubMed2002

YIL113w encodes a functional dual-specificity protein phosphatase which specifically interacts with and inactivates the Slt2/Mpk1p MAP kinase in S. cerevisiae.

We show here that the YIL113w gene of Saccharomyces cerevisiae encodes a functional protein phosphatase. Yil113p shows no activity in vitro towards either phosphorylated casein or myelin basic protein. However, Yil113p dephosphorylates activated extracellular signal-regulated kinase 2 MAP kinase indicating that it is a dual-specificity MAP kinase phosphatase. In support of this we find that Yil113p specifically interacts with the stress-activated Slt2/Mpk1p MAP kinase of S. cerevisiae. Furthermore, expression of Yil113p causes the dephosphorylation of Slt2/Mpk1p in vivo, while expression of an inactive mutant of Yil113p causes the accumulation of phosphorylated Slt2/Mpk1p. We conclude that the physiological target of YIL113p is Slt2/Mpk1p.

Dual-Specificity Phosphatases↗
PubMed2004

MEK5 and ERK5 are localized in the nuclei of resting as well as stimulated cells, while MEKK2 translocates from the cytosol to the nucleus upon stimulation.

The ERK5 signaling cascade acts through sequential activation of MEKK2/3, MEK5 and ERK5 and transmits signals to a variety of stress and mitogenic related targets. In this study we examined the subcellular localization of the components of the ERK5 cascade and found that in resting, as well as in EGF-stimulated HeLa and Rat-1 cells, endogenous ERK5 is localized mainly in the nucleus. This location is different from the previously described location of exogenous ERK5, in the cytosol of resting cells, which is confirmed in this study. The reason for the different localization could be a saturation of anchoring moieties by the endogenous ERK5. Indeed, in situ detergent extraction analysis using Nonidet P-40, revealed that ERK5 is bound to detergent resistant moieties in the nucleus, while the exogenous protein fails to interact with those anchors. The upstream activator MEK5 is also localized in the nucleus both before and after EGF stimulation and is resistant to NP-40 extraction in resting cells. ERK5 remains bound to these nuclear moieties even after stimulation, while MEK5 is detached from the anchors but remains localized in the nucleus. Unlike ERK5 and MEK5, their upstream activator MEKK2 is localized mainly in the cytosol of resting cells, and translocates into the nucleus upon EGF stimulation, allowing transmission of signals to the nuclear MEK5. The nuclear localization of MEK5 and ERK5 is different from that of ERK1/2 and MEK1/2 in resting cells, indicating that each MAPK cascade uses distinct mechanisms to transmit extracellular signals to their nuclear targets.

Animals↗
PubMed2003

Catalytically active MAP KAP kinase 2 structures in complex with staurosporine and ADP reveal differences with the autoinhibited enzyme.

MAP KAP kinase 2 (MK2), a Ser/Thr kinase, plays a crucial role in the inflammatory process. We have determined the crystal structures of a catalytically active C-terminal deletion form of human MK2, residues 41-364, in complex with staurosporine at 2.7 A and with ADP at 3.2 A, revealing overall structural similarity with other Ser/Thr kinases. Kinetic analysis reveals that the K(m) for ATP is very similar for MK2 41-364 and p38-activated MK2 41-400. Conversely, the catalytic rate and binding for peptide substrate are dramatically reduced in MK2 41-364. However, phosphorylation of MK2 41-364 by p38 restores the V(max) and K(m) for peptide substrate to values comparable to those seen in p38-activated MK2 41-400, suggesting a mechanism for regulation of enzyme activity.

Adenosine Diphosphate↗
PubMed1994

The primary structure of a human MAP kinase activated protein kinase 2.

Mitogen-activated protein (MAP) kinase is of central importance in mediating intracellular actions in response to a variety of extracellular stimuli. MAP kinase activated protein (MAPKAP) kinase 2 is one of the two known protein kinases that can be phosphorylated and activated by MAP kinase. Here we present the first complete primary structure of MAPKAP kinase 2 elucidated from a human cDNA sequence. Sequence analysis reveals that MAPKAP kinase 2 is a 370 amino acid protein containing a proline-rich N-terminal region and a well conserved catalytic domain. Northern blot analysis of MAPKAP kinase 2 showed a 4.8 kb mRNA species in HL-60 cells. In addition, we also show the first evidence that recombinant MAPKAP kinase 2 is phosphorylated and activated by MAP kinase in vitro.

Amino Acid Sequence↗
PubMedDate not supplied

The invasive phenotype in HMT-3522 cells requires increased EGF receptor signaling through both PI 3-kinase and ERK 1,2 pathways.

We studied the invasion of HMT-3522 breast epithelial cells in response to epidermal growth factor (EGF), and the associated signaling pathways. HMT-3522 T4-2 cells were shown to invade Matrigel-coated Transwell membranes in response to EGF while HMT-3522 S-1 cells failed to invade when treated with EGF. Studies utilizing specific molecular inhibitors showed the importance of beta1 integrin, phosphatidylinositol 3 kinase (PI 3-kinase), p38, extracellular regulated kinase 1, 2 (Erk 1,2) MAP kinases, and metalloproteinases in invasion and motility. T4-2 cell invasion was shown to be time-dependent and also gene transcription-dependent as shown by inhibition with Actinomycin D. T4-2 cells exhibited an increased activation of MAP kinases Erk 1,2 (2-fold), EGF receptor (3-fold), and PI 3-kinase (3- to 4-fold) when compared to the S-1 cells. In response to EGF, T4-2 cells showed a 5-fold greater secretion of matrix metalloproteinase-9 (MMP-9) as compared to S-1 cells, and this increase was largely dependent on the activity of PI 3-kinase. These findings indicate that expression of the invasive phenotype in these breast epithelial cells requires increased EGF receptor signaling, involving both PI 3-kinase and Erk 1,2 activities, which leads to multiple downstream effects, including enhanced secretion of MMP-9 and transcription of invasion-related genes.

Breast↗
PubMed2005

Targeting of a novel Ca+2/calmodulin-dependent protein kinase II is essential for extracellular signal-regulated kinase-mediated signaling in differentiated smooth muscle cells.

Subcellular targeting of kinases controls their activation and access to substrates. Although Ca2+/calmodulin-dependent protein kinase II (CaMKII) is known to regulate differentiated smooth muscle cell (dSMC) contractility, the importance of targeting in this regulation is not clear. The present study investigated the function in dSMCs of a novel variant of the gamma isoform of CaMKII that contains a potential targeting sequence in its association domain (CaMKIIgamma G-2). Antisense knockdown of CaMKIIgamma G-2 inhibited extracellular signal-related kinase (ERK) activation, myosin phosphorylation, and contractile force in dSMCs. Confocal colocalization analysis revealed that in unstimulated dSMCs CaMKIIgamma G-2 is bound to a cytoskeletal scaffold consisting of interconnected vimentin intermediate filaments and cytosolic dense bodies. On activation with a depolarizing stimulus, CaMKIIgamma G-2 is released into the cytosol and subsequently targeted to cortical dense plaques. Comparison of phosphorylation and translocation time courses indicates that, after CaMKIIgamma G-2 activation, and before CaMKIIgamma G-2 translocation, vimentin is phosphorylated at a CaMKII-specific site. Differential centrifugation demonstrated that phosphorylation of vimentin in dSMCs is not sufficient to cause its disassembly, in contrast to results in cultured cells. Loading dSMCs with a decoy peptide containing the polyproline sequence within the association domain of CaMKIIgamma G-2 inhibited targeting. Furthermore, prevention of CaMKIIgamma G-2 targeting led to significant inhibition of ERK activation as well as contractility. Thus, for the first time, this study demonstrates the importance of CaMKII targeting in dSMC signaling and identifies a novel targeting function for the association domain in addition to its known role in oligomerization.

Actinin↗
PubMed2004

MEKK2 regulates the coordinate activation of ERK5 and JNK in response to FGF-2 in fibroblasts.

Mitogen-activated protein kinases (MAPKs) are regulated by MAPK kinases (MKKs), which are in turn regulated by MKK kinases (MKKKs). While a single MKKK can regulate several different MAPK family members, and several MKKKs can often activate the same MAPK, emerging evidence indicates a unique role for individual MKKKs in acting as signaling nodes to coordinately activate different subsets of MAPKs in response to specific cellular stimuli. Thus, while there is much apparent overlap in MAPK regulation by different MKKKs, each MKKK serves a specific purpose in regulation of unique cellular functions. The purpose of this study was to define the specific role of MEKK2, an MKKK, in MAPK regulation and cell function. MEKK2 coordinately activates the ERK5 and JNK pathways. Targeted disruption of MEKK2 expression causes loss of ERK5 and JNK activation in response to FGF-2 in mouse embryonic fibroblasts (MEFs). FGF-2 receptor signaling requires MEKK2 for induction of mRNA for c-Jun, Fra-1, and Fra-2, components of the AP-1 transcription complex. In FGF-2-stimulated MEKK2-/- fibroblasts, c-Jun phosphorylation is inhibited, consistent with a loss of JNK activation. Thus, MEKK2 regulates AP-1 activity at two levels, by regulating both expression of AP-1 components and c-Jun N-terminal phosphorylation. One function of the AP-1 transcription complex is to regulate cytokine gene expression. Expression of IL-1alpha, IL-1beta, IL-6, and TNFalpha is inhibited in MEKK2-/- fibroblasts. Bacterial lipopolysaccharide (LPS) and TNFalpha neither activate ERK5 nor require MEKK2 for JNK activation, demonstrating specificity of MEKK2 in FGF-2 receptor signaling and control of cytokine gene expression.

Animals↗
PubMed2005

Positive regulation of Raf1-MEK1/2-ERK1/2 signaling by protein serine/threonine phosphatase 2A holoenzymes.

Protein serine/threonine phosphatase 2A (PP2A) regulates a wide variety of cellular signal transduction pathways. The predominant form of PP2A in cells is a heterotrimeric holoenzyme consisting of a scaffolding (A) subunit, a regulatory (B) subunit, and a catalytic (C) subunit. Although PP2A is known to regulate Raf1-MEK1/2-ERK1/2 signaling at multiple steps in this pathway, the specific PP2A holoenzymes involved remain unclear. To address this question, we established tetracycline-inducible human embryonic kidney 293 cell lines for overexpression of FLAG-tagged Balpha/delta regulatory subunits by approximately 3-fold or knock-down of Balpha by greater than 70% compared with endogenous levels. The expression of functional epitope-tagged B subunits was confirmed by the detection of A and C subunits as well as phosphatase activity in FLAG immune complexes from extracts of cells overexpressing the FLAG-Balpha/delta subunit. Western analysis of the cell extracts using phosphospecific antibodies for MEK1/2 and ERK1/2 demonstrated that activation of these kinases in response to epidermal growth factor was markedly diminished in Balpha knock-down cells but elevated in Balpha- and Bdelta-overexpressing cells as compared with control cells. In parallel with the activation of MEK1/2 and ERK1/2, the inhibitory phosphorylation site of Raf1 (Ser-259) was dephosphorylated in cells overexpressing Balpha or Bdelta. Pharmacological inhibitor studies as well as reporter assays for ERK-dependent activation of the transcription factor Elk1 revealed that the PP2A holoenzymes ABalphaC and ABdeltaC act downstream of Ras and upstream of MEK1 to promote activation of this MAPK signaling cascade. Furthermore both PP2A holoenzymes were found to associate with Raf1 and catalyze dephosphorylation of inhibitory phospho-Ser-259. Together these findings indicate that PP2A ABalphaC and ABdeltaC holoenzymes function as positive regulators of Raf1-MEK1/2-ERK1/2 signaling by targeting Raf1.

Blotting, Western↗
PubMed2005

Macrophages survive hyperoxia via prolonged ERK activation due to phosphatase down-regulation.

Macrophages exposed to hyperoxia in the lung continue to survive for prolonged periods. We previously reported (Nyunoya, T., Powers, L. S., Yarovinsky, T. O., Butler, N. S., Monick, M. M., and Hunninghake, G. W. (2003) J. Biol. Chem. 278, 36099-36106) that hyperoxia induces cell cycle arrest and sustained extracellular signal-related kinase (ERK) activity in macrophages. In this study, we determined the mechanisms of hyperoxia-induced ERK activation and how ERK activity plays a pro-survival role in hyperoxia-exposed cells. Inhibition of ERK activity decreased survival of hyperoxia-exposed macrophages. This was due, at least in part, to down-regulation of the pro-apoptotic Bcl-2 family member, BimEL. In determining the mechanism of ERK activation by hyperoxia, we found that ERK activation was not associated with hyperoxia-induced activation of the upstream ERK kinase mitogen-activated protein kinase/extracellular signal-regulated kinase kinase 1/2. When we examined the ability of whole cell lysates from hyperoxia-exposed cells to dephosphorylate purified phosphorylated ERK, we found decreased ERK-directed phosphatase activity. Two particular ERK-directed phosphatases (protein phosphatase 2A and MAPK phosphatase-3) demonstrated decreased activity in hyperoxia-exposed cells. Moreover, whole cell lysates from normoxia-exposed cells depleted of PP2A or MAPK phosphatase-3 were also less able to dephosphorylate ERK. These data demonstrate that, in hyperoxia-exposed macrophages, sustained activation of ERK due to phosphatase down-regulation permits macrophage survival via effects on the balance between pro- and anti-apoptotic Bcl-2 family proteins.

Adaptor Proteins, Signal Transducing↗