Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Genes, Developmental”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources
PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗
PubMed2018

Convergent evolution of gene expression in two high-toothed stickleback populations.

Changes in developmental gene regulatory networks enable evolved changes in morphology. These changes can be in cis regulatory elements that act in an allele-specific manner, or changes to the overall trans regulatory environment that interacts with cis regulatory sequences. Here we address several questions about the evolution of gene expression accompanying a convergently evolved constructive morphological trait, increases in tooth number in two independently derived freshwater populations of threespine stickleback fish (Gasterosteus aculeatus). Are convergently evolved cis and/or trans changes in gene expression associated with convergently evolved morphological evolution? Do cis or trans regulatory changes contribute more to gene expression changes accompanying an evolved morphological gain trait? Transcriptome data from dental tissue of ancestral low-toothed and two independently derived high-toothed stickleback populations revealed significantly shared gene expression changes that have convergently evolved in the two high-toothed populations. Comparing cis and trans regulatory changes using phased gene expression data from F1 hybrids, we found that trans regulatory changes were predominant and more likely to be shared among both high-toothed populations. In contrast, while cis regulatory changes have evolved in both high-toothed populations, overall these changes were distinct and not shared among high-toothed populations. Together these data suggest that a convergently evolved trait can occur through genetically distinct regulatory changes that converge on similar trans regulatory environments.

Alleles↗
PubMed2026

De novo transcriptome meta-analysis reveals candidate genes involved in life-stage transitions for RNAi-mediated management of the citrus root weevil (Diaprepes abbreviatus).

BACKGROUND: The citrus root weevil, Diaprepes abbreviatus, is a destructive agricultural pest for which molecular control options remain limited due to historically sparse genomic resources. Leveraging a comprehensive de novo transcriptome, we investigated developmental gene regulation across larval, pupal, and adult stages and identified essential targets for RNA interference (RNAi)-based intervention. RESULTS: Stage-resolved transcriptomic analyses revealed extensive transcriptional reprogramming associated with metabolism, detoxification, cuticle biosynthesis, endocrine signaling, and sensory perception. Among these, chitin synthase (DaCHS) emerged as a critical developmental gene, exhibiting pronounced up-regulation during late larval and pupal stages corresponding to intensive cuticle synthesis. Phylogenetic and structural analyses demonstrated that DaCHS is highly conserved among insects and retains canonical catalytic domains and transmembrane topology. Alpha Fold-based structural modeling and molecular docking confirmed stable interaction of DaCHS with its substrate, N-acetylglucosamine, supporting functional conservation of enzymatic activity. Oral delivery of DaCHS double-stranded RNA induced robust transcript suppression, leading to significant mortality and severe developmental defects, including larval and pupal abnormalities, and adults with disrupted wing and abdominal morphogenesis. CONCLUSION: These findings establish DaCHS as an indispensable gene for D. abbreviates development and validate transcriptome-guided RNAi as a powerful framework for target discovery. This work provides a strong molecular foundation for developing RNAi-based strategies that can be integrated into sustainable management programs for citrus root weevil control. © 2026 Society of Chemical Industry.

Animals↗
PubMed2025

3D chromatin structures precede genome activation in Drosophila embryogenesis.

3D chromatin structure is critical for the regulation of gene expression during development. Here we used Micro-C assays at 100-bp resolution to map genome organization in Drosophila melanogaster throughout the first half of embryogenesis. These high-resolution contact maps reveal fine-scale features such as loops and boundaries delineating topologically associating domains. Notably, we observe that 3D chromatin structures form prior to zygotic genome activation and persist during successive mitotic cycles. Integrative analysis with 149 public chromatin immunoprecipitation sequencing (ChIP-seq) datasets identifies four classes of chromatin structuring elements, including a distinct group enriched for GAGA-associated factor (GAF) and Zelda binding, associated with developmental-gene regulation. These elements are mitotically retained and exhibit sequence and structure similarity between D. melanogaster and D. virilis. We propose that 3D chromatin organization in the pre-cellular embryo facilitates deployment of developmentally regulated genes during Drosophila embryogenesis.

Animals↗
PubMed2026

Mechanisms and functional implications of long-range enhancer-dependent gene regulation.

Metazoan development relies on the coordinated establishment of diverse gene regulatory programs that drive the formation of specific cell types, tissues and organs. The temporal and spatial control of gene expression is achieved through the concerted activity of multiple classes of cis-regulatory elements encoded in the genome. Among these, enhancers enable the establishment of specific and precise gene expression patterns and control gene expression over long linear distances, a property often referred to as distance-independent regulatory activity. However, enhancer activity is, in fact, inversely correlated with linear genomic distance, and target gene expression and transcriptional precision decrease with increasing enhancer-promoter linear distances. Here, we highlight emerging insights into multiple mechanisms that enable enhancers to precisely and robustly activate gene expression across large genomic distances. Finally, we provide a more speculative perspective on the potential advantages that long-range regulation might confer during the establishment of developmental gene expression programs.

Enhancer Elements, Genetic↗
PubMed2024

DNA methylation reprogramming in teleosts.

Early embryonic development is crucially important but also remarkably diverse among animal taxa. Axis formation and cell lineage specification occur due to both spatial and temporal control of gene expression. This complex system involves various signaling pathways and developmental genes such as transcription factors as well as other molecular interactants that maintain cellular states, including several types of epigenetic marks. 5mC DNA methylation, the chemical modification of cytosines in eukaryotes, represents one such mark. By influencing the compaction of chromatin (a high-order DNA structure), DNA methylation can either repress or induce transcriptional activity. Mammals exhibit a reprogramming of DNA methylation from the parental genomes in the zygote following fertilization, and later in primordial germ cells (PGCs). Whether these periods of methylation reprogramming are evolutionarily conserved, or an innovation in mammals, is an emerging question. Looking into these processes in other vertebrate lineages is thus important, and teleost fish, with their extensive species richness, phenotypic diversity, and multiple rounds of whole genome duplication, provide the perfect research playground for answering such a question. This review aims to present a concise state of the art of DNA methylation reprogramming in early development in fish by summarizing findings from different research groups investigating methylation reprogramming patterns in teleosts, while keeping in mind the ramifications of the methodology used, then comparing those patterns to reprogramming patterns in mammals.

Animals↗
PubMed2026

Transcriptome analysis of the pectoral fin degeneration in half-smooth tongue sole (Cynoglossus semilaevis).

Appendage degeneration is a notable morphological feature of some teleosts with specialized benthic lifestyles. The half-smooth tongue sole (Cynoglossus semilaevis) undergoes severe pectoral fin regression during metamorphosis. However, the molecular basis underlying rapid pectoral fin degeneration remains unclear. Here, we performed time-series transcriptome sequencing on pectoral fins at pre-metamorphosis, metamorphosis peak and post-metamorphosis to characterize the molecular changes associated with pectoral fin degeneration. Transcriptional dynamics and functional enrichment showed that no significant enrichment of classical apoptosis-related transcriptional pathways was detected during pectoral fin degeneration. Instead, sustained downregulation of twist1b, identified as a transcriptomic candidate, together with significant upregulation of ssh1, coupled with enrichment of lysosome and ubiquitin-proteasome system (UPS) pathways, suggested enhanced tissue remodeling during pectoral fin degeneration. Temporal expression clustering revealed heterochronic misalignment in the developmental gene expression: upstream initiator tbx5 was upregulated at early metamorphosis, while downstream maintenance signal fgf10 decreased synchronously. Distal patterning gene hoxd12a exhibited premature expression and rapid decay, losing sustained late-phase expression. Moreover, transient elevation of gli3 during metamorphosis may contribute to restricted distal fin growth. We conclude that pectoral fin degeneration in C. semilaevis is associated with heterochronic disruption of developmental signaling and extensive tissue remodeling. This study provides transcriptomic insights into pectoral fin degeneration in tongue soles and establishes a basis for future functional studies of appendage reduction in teleosts.

Animals↗
PubMed2026

Evolutionary conservation of heat shock proteins in Blattodea and their roles in wing morphogenesis and ovarian development of Blattella germanica.

Heat shock proteins (Hsps) are essential molecular chaperones for protein homeostasis and stress responses. However, the Hsp repertoires and functions in Blattodea remain underexplored. Our genome-scale survey of nine Blattodea species revealed 37-46 conserved Hsp90, Hsp70, and DNAJ (Hsp40) genes, with DNAJ the most abundant and Hsp90 the least. Phylogenetic analysis confirmed the evolutionary conservation of three Hsp90, seven Hsp70, and 29 DNAJ subclades in Blattodea. Selection pressure analysis revealed predominant purifying selection (dN/dS ≪ 1) across lineages, strongest in DNAJ and highest in Hsp90 conservation. In Blattella germanica, expression of six representative BgHsp genes progressively increased during development, peaking in fifth-instar nymphs. Tissue expression profiling revealed that BgHspA1-2/3/4 were predominantly expressed in legs, BgDNAJB5 and BgHsp90AB1-2 were enriched in the fat body, and BgHsp90AB1 was highly expressed in the head. dsRNA injection targeting conserved Hsp gene regions achieved 61.9-94.1% knockdown of all six target genes. RNAi knockdown of six BgHsp genes disrupted wing morphogenesis, causing distinct phenotypes: wing whitening (56.7%, dsBgHspA1-4), unequal length (66.7%, dsBgHspA1-3; 76.7%, dsBgDNAJB5), and wing wrinkling (70%, dsBgHspA1-2; 63.3%, dsBgHsp90AB1; 76.7%, dsBgHsp90AB1-2). During ovarian formation, the developmental delay was most severe in the dsBgHsp90AB1 group, moderate in the dsBgHsp90AB1-2 and dsBgHspA1-2/3/4 groups, and weakest in the dsBgDNAJB5 group. Besides, knockdown significantly downregulated key developmental genes (apterous-a, nubbin, scalloped, ultrabithorax, wingless, and vitellogenin). These findings provide a reference for understanding the evolutionary patterns of Hsps in Blattodea, and offer mechanistic insights into the developmental regulation mediated by Hsps in this important public-health pest.

Animals↗
PubMed2025

Genome-Wide Mining of lncRNAs Reveals Their Potential Regulatory Role in the Evolution of Viviparity.

Reproduction in vertebrates usually involves egg-laying (oviparity) or live-bearing (viviparity). Oviparity is the ancestral trait from which viviparity has independently evolved more than 100 times in squamate reptiles. This transition involves a series of physiological and structural changes, including the degeneration of eggshell and the evolution of a placenta and differences in the temporal and spatial expression patterns of some functional genes that drive the structural transformation. Long non-coding RNAs (lncRNAs) play important roles in the regulation of gene expression, yet it remains unclear whether they participate in gene expression shifts during the transition from oviparity to viviparity, and if so how. Therefore, we employ deep mining to identify novel lncRNAs of a closely related oviparous-viviparous pair of lizards (Phrynocephalus przewalskii and P. vlangalii). We construct cis- and trans-regulatory networks between lncRNAs and target genes using the transcriptomic data of oviduct or uteri tissues across reproductive periods. Results show that lncRNAs that regulate eggshell gland developmental genes in the oviparous lizard are lost or less expressed in the viviparous lizard. A number of lncRNAs involved in the regulation of placental development and embryo attachment in viviparous species have no orthologs in oviparous species, and others show little or no expression. Accordingly, lncRNAs may play important regulatory roles in the physiological and structural changes in the transition from oviparity to viviparity. These results open doors to the further elucidation of genetic regulatory networks.

Animals↗
PubMed2026

Comparative analysis of conserved non-coding elements identifies gene regulatory networks rewired during the water-to-land transition in vertebrates.

The conquest of land by vertebrates has been a pivotal moment in evolutionary history. Adapting to the new habitats necessitated numerous changes in vertebrate anatomy and physiology, creating an enduring imprint on the developmental gene regulatory networks (GRNs) of tetrapods. The increase of high-quality genomic resources over the past decade has made it possible to study the genomic legacy of the water-to-land transition. While much attention has been given to the highly conserved non-coding elements (CNEs) of the genome that share high levels of similarity across evolutionarily diverged clades, recent evidence suggests that perhaps comparable attention should be given to "missing" CNE-s, conserved sequence patches present in extant stem gnathostomes and actinopterygian fishes that have become undetectable in tetrapods during the adaptation to terrestrial life, whether through true sequence loss or divergence beyond alignability. These sequences could help us reveal the relaxation of certain developmental constraints, related to the aquatic lifestyle, that made reaching new adaptive peaks in the developmental landscape possible. In this paper, we search for such CNEs and characterize them in comparison with pan-Gnathostome CNEs, using the zebrafish (Danio rerio) genome as a reference. Our results suggest that the rewiring of developmental networks related to pigmentation and muscle structure formation has left the largest genomic imprint. We also find that components of canonical Wnt and Hedgehog signalling, are enriched among CNEs retained in fish.

cis-regulatory evolution↗
PubMed2026

Revealing the cytokine-mediated embryo-maternal crosstalk during extended in vitro culture in the Arabian camel (Camelus dromedarius).

This study reports, for the first time, the establishment of endometrial organoids (EOs) from the Arabian camel (Camelus dromedarius) and evaluates their suitability as an in vitro model for embryo-maternal interactions during implantation. Endometrial tissues were collected from non-pregnant she-camels and cultured in Matrigel with a defined growth medium. By Day 7, organoids displayed a spherical morphology (200-250 µm), remained viable for up to 20 days, and expanded to approximately 1 mm. They exhibited epithelial characteristics and high proliferative activity, confirmed by expression of mucin-1, pan-cytokeratin, vimentin, and Ki67. Day 7 in vitro-produced embryos co-cultured with EOs showed significant improvements in development and trophoblast outgrowth. This was accompanied by upregulation of key developmental genes (OCT4, c-MYC, KLF4, CDX2). Cytokine profiling revealed enhanced bidirectional signaling: embryos increased secretion of CCL2, CCL4, IGF-1, IFNG, IL1α, IL12b, IL-8, LIF, IL-10, and NTF3, while EOs upregulated VEGFA, IL-8, CCL2, and TIMP1. Co-culture uniquely induced additional cytokines and amplified signaling intensity. Metabolomic analysis of embryo-conditioned medium identified 108 metabolites, including steroids associated with immunomodulation. Notably, embryos cultured in EO-conditioned medium developed up to Day 21 post-cleavage, reaching a mean diameter of 2.4 mm. Overall, camel EOs provide a physiologically relevant platform that supports embryo development and enables detailed investigation of cytokine-mediated embryo-maternal communication and implantation processes in the dromedary camel.

Camel↗
PubMed2026

Prdm15 deficiency perturbs hematopoietic stem and progenitor cell homeostasis.

The maintenance of homeostasis in hematopoietic stem and progenitor cells (HSPCs) is essential for the proper development of the entire hematopoietic system. However, the mechanisms underlying this regulatory equilibrium remain elusive. Here, we report that Prdm15 deficiency in HSPCs induces the accumulation of immature hematopoietic stem cells in mice. A series of transplantation assays shows that these cells display impaired reconstitution capacity and competitive fitness, which are associated with abnormal differentiation trajectories and transcriptional alterations identified by single-cell RNA sequencing. Mechanistically, integrated multi-omics analyses including ATAC-seq and CUT&Tag sequencing of HSPCs indicate that Prdm15 deficiency induces significant transcriptional and epigenetic alterations, particularly affecting the methyltransferase KMT2C and altering H3K4me1 and H3K27ac modifications at the promoters of hematopoietic developmental genes. Collectively, our findings establish PRDM15 as a critical epigenetic regulator of HSPCs, offering valuable insights into the molecular mechanisms underlying hematopoietic homeostasis.

Cell differentiation↗
PubMed2026

hnRNPK condensates facilitate enhancer-promoter looping and RNA polymerase II recruitment.

Enhancer RNAs interact with promoter-derived RNAs to dictate enhancer-promoter looping, but the RNA-binding protein that mediates this process has remained unidentified. Here we identify hnRNPK as a general structural regulator that preferentially binds to nascent RNAs transcribed from enhancer and promoter regions, promoting enhancer-promoter looping and transcriptional activation. We further show that hnRNPK forms phase-separated, cavity-containing condensates that encapsulate RNA polymerase II (Pol II) via its RPB3 subunit, facilitating chromatin looping and potentially enabling recruitment of Pol II from enhancers to promoters through protein dimerization. Notably, a mutation associated with Au-Kline syndrome in hnRNPK (c.953+1dupG) alters its condensates from a liquid-like to a gel-like state, leading to developmental defects in knock-in mice. Fibroblasts derived from these mutants display reduced enhancer-promoter looping and decreased Pol II recruitment at promoters of key developmental genes. These findings suggest that hnRNPK is a structural regulator of enhancer-promoter communication and highlight the importance of RNA-RNA interactions mediated by RNA-binding proteins in transcriptional regulation.

RNA Polymerase II↗
PubMed2026

Fetal signatures in the 3D genome of iPSC-derived neurons and their implications for disease modeling.

Induced pluripotent stem cells (iPSCs) have revolutionized neuroscience, providing an approach to generate patient-specific neurons for modeling of neurological diseases. However, it remains unclear how closely iPSC-derived neurons replicate the chromatin architecture of authentic brain neurons. Here, we uniformly processed newly generated Hi-C data from iPSC-derived neurons and neurons isolated from the human postmortem brain, together with previously published data sets comprising 228 human and 89 mouse Hi-C and snm3C-seq samples from different cell subtypes. These data were merged into 96 high-coverage contact maps used to examine chromatin features ranging from chromatin compartments and topologically associating domains (TADs) to chromatin loops, Polycomb-mediated contacts, and frequently interacting regions (FIREs). We find that iPSC-derived neurons largely retain the chromatin state of undifferentiated cells and resemble fetal rather than mature neurons. iPSC-derived neurons exhibit unusually strong compartmentalization, an enrichment of developmental genes at TAD borders, and a marked reduction of long-range repressive Polycomb-mediated contacts that typically silence early fetal programs. Although immature, iPSC-derived neurons offer advantages for modeling interactions between disease-associated SNPs and target genes, as many psychiatric disorders have neurodevelopmental origins. Integrating iPSC-derived and postmortem neuronal data sets therefore provides complementary insights into the chromatin landscape underlying disease-associated interactions. Our study offers a valuable Hi-C resource for the community and provides a detailed comparison of chromatin architecture throughout neuronal maturation, underscoring its importance for validating neuronal models and providing a robust framework for future studies.

Journal Article↗
PubMed2026

Cultivar-dependent regulation of cytokinin biosynthesis in wheat: developmental expression of TaIPT genes and hormonal crosstalk during reproductive development.

BACKGROUND: Cytokinins are key regulators of plant growth, reproductive development, and yield formation. In cereals, cytokinin biosynthesis is catalyzed by isopentenyltransferase (IPT) enzymes, yet the genomic organization and developmental regulation of IPT genes in polyploid wheat remain incompletely understood, especially at the cultivar level. RESULTS: Here, we present an integrated genomic, transcriptional, and hormonal analysis of the TaIPT gene family during vegetative and reproductive development in two wheat cultivars, awnless Kontesa and awned Ostka. Genome-wide analysis identified nine core TaIPT genes represented by 25 homoeologs distributed across the A, B, and D subgenomes, for which a unified nomenclature was established. Phylogenetic analysis resolved TaIPTs into conserved evolutionary clades corresponding to ATP/ADP-dependent and tRNA-dependent IPT groups. Expression profiling revealed distinct spatial and temporal patterns of TaIPT transcription across roots, leaves, inflorescences, and developing spikes. Several TaIPT genes showed enhanced expression during early reproductive stages, coinciding with dynamic changes in cytokinin concentrations. Comparative analyses revealed cultivar-specific expression and co-variation patterns, with Kontesa displaying more compartmentalized TaIPT expression and Ostka showing coordinated activation of multiple TaIPT genes during early grain development. Hormone profiling further indicated stage-dependent associations between TaIPT expression, cytokinin metabolism, and the balance between cytokinins and abscisic acid. These relationships are interpreted as correlative and provide a framework for future functional testing rather than direct evidence of causality. CONCLUSIONS: Together, these results provide a cultivar-focused framework for understanding the organization and regulation of cytokinin biosynthesis genes in wheat. The data highlight cultivar-dependent TaIPT expression patterns and their association with cytokinin dynamics during reproductive development, while also identifying the need for homoeolog-specific and functional validation. This study establishes a foundation for future research on cytokinin-mediated regulation of wheat growth and grain development.

Triticum↗
PubMed2019

Replication timing networks reveal a link between transcription regulatory circuits and replication timing control.

DNA replication occurs in a defined temporal order known as the replication timing (RT) program and is regulated during development, coordinated with 3D genome organization and transcriptional activity. However, transcription and RT are not sufficiently coordinated to predict each other, suggesting an indirect relationship. Here, we exploit genome-wide RT profiles from 15 human cell types and intermediate differentiation stages derived from human embryonic stem cells to construct different types of RT regulatory networks. First, we constructed networks based on the coordinated RT changes during cell fate commitment to create highly complex RT networks composed of thousands of interactions that form specific functional subnetwork communities. We also constructed directional regulatory networks based on the order of RT changes within cell lineages, and identified master regulators of differentiation pathways. Finally, we explored relationships between RT networks and transcriptional regulatory networks (TRNs) by combining them into more complex circuitries of composite and bipartite networks. Results identified novel trans interactions linking transcription factors that are core to the regulatory circuitry of each cell type to RT changes occurring in those cell types. These core transcription factors were found to bind cooperatively to sites in the affected replication domains, providing provocative evidence that they constitute biologically significant directional interactions. Our findings suggest a regulatory link between the establishment of cell-type-specific TRNs and RT control during lineage specification.

Cell Differentiation↗
PubMed2019

Distinct types of short open reading frames are translated in plant cells.

Genomes contain millions of short (<100 codons) open reading frames (sORFs), which are usually dismissed during gene annotation. Nevertheless, peptides encoded by such sORFs can play important biological roles, and their impact on cellular processes has long been underestimated. Here, we analyzed approximately 70,000 transcribed sORFs in the model plant Physcomitrella patens (moss). Several distinct classes of sORFs that differ in terms of their position on transcripts and the level of evolutionary conservation are present in the moss genome. Over 5000 sORFs were conserved in at least one of 10 plant species examined. Mass spectrometry analysis of proteomic and peptidomic data sets suggested that tens of sORFs located on distinct parts of mRNAs and long noncoding RNAs (lncRNAs) are translated, including conserved sORFs. Translational analysis of the sORFs and main ORFs at a single locus suggested the existence of genes that code for multiple proteins and peptides with tissue-specific expression. Functional analysis of four lncRNA-encoded peptides showed that sORFs-encoded peptides are involved in regulation of growth and differentiation in moss. Knocking out lncRNA-encoded peptides resulted in a decrease of moss growth. In contrast, the overexpression of these peptides resulted in a diverse range of phenotypic effects. Our results thus open new avenues for discovering novel, biologically active peptides in the plant kingdom.

Bryopsida↗
PubMed2005

AnoEST: toward A. gambiae functional genomics.

Here, we present an analysis of 215,634 EST and cDNA sequences of a major vector of human malaria Anopheles gambiae structured into the AnoEST database. The expressed sequences are grouped into clusters using genomic sequence as template and associated with inferred functional annotation, including the following: corresponding Ensembl gene prediction, putative orthologous genes in other species, homology to known proteins, protein domains, associated Gene Ontology terms, and corresponding classification into broad GO-slim functional groups. AnoEST is a vital resource for interpretation of expression profiles derived using recently developed A. gambiae cDNA microarrays. Using these cDNA microarrays, we have experimentally confirmed the expression of 7961 clusters during mosquito development. Of these, 3100 are not associated with currently predicted genes. Moreover, we found that clusters with confirmed expression are nonbiased with respect to the current gene annotation or homology to known proteins. Consequently, we expect that many as yet unconfirmed clusters are likely to be actual A. gambiae genes. [AnoEST is publicly available at http://komar.embl.de, and is also accessible as a Distributed Annotation Service (DAS).].

Animals↗