Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Equilibrative Nucleoside Transporter 1”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

Functional single nucleotide polymorphism haplotypes in the human equilibrative nucleoside transporter 1.

The human equilibrative nucleoside transporter 1 gene (hENT1) is the primary nucleoside transporter for cytosine arabinoside (AraC), a deoxycytidine analog used for treatment of acute leukemias and lymphomas. We screened approximately 1.6 kb upstream of the transcription initiation site of hENT1 for single nucleotide polymorphisms (SNPs) that affect gene expression. We identified one SNP at position -706G>C with a frequency of 21% in whites and 5% in African-Americans. In African-Americans, we observed two SNPs at positions -1345C>G and -1050G>A with allele frequencies of 8% and 19%, respectively. TRANSFAC analysis suggested that -1345C>G and -706G>C may alter transcription factor binding sites. Four naturally occurring haplotypes (CGG, CAG, CGC and GAG) were cloned into a luciferase expression plasmid, transfected into Cos-1 cells, and reporter activity measured at 24 and 48 h. Three haplotypes, CAG, CGC and GAG, respectively, showed average expression that was approximately two-fold (P<0.05), 1.4-fold (P<0.05) and 1.1-fold (P>0.05) higher than lowest expression haplotype CGG at 48 h. When reanalysed as single SNPs, the differences in expression were significant for -1345C>G and -1050G>A genotypes, and not for -706G>C. However, the magnitude of difference was reduced, suggesting that no single SNP completely accounts for the expression differences observed at the haplotype level. By real-time quantitative reverse transcriptase-polymerase chain reaction assay, individuals with CGG/CGC haplotypes showed 1.37-fold higher median expression of hENT1 transcript than those with common CGG/CGG haplotypes. Although not statistically significant (P=0.12), this difference is in the direction predicted by the in vitro data. hENT1 promoter region haplotypes may influence gene expression and alter AraC chemosensitivity.

Black or African American↗

Use of a small reporter molecule to determine cell-surface proteins by capillary electrophoresis and laser-induced fluorescence: use of 5-SAENTA-x8f for quantitation of the human equilibrative nucleoside transporter 1 protein.

The human equilibrative nucleoside transporter 1 protein (hENT1) is a major mediator of cellular entry of nucleosides and anticancer nucleoside drugs; its assay is important in understanding and diagnosing chemotherapy resistance. Here we present a novel assay for quantifying hENT1 using capillary electrophoresis with laser-induced fluorescence detection (CE-LIF). A cellular population is treated with 5'-S-(2-aminoethyl)-N6-(4-nitrobenzyl)-5'-thioadenosine-x8-fluorescein (5-SAENTA-x8f), which binds with high affinity and specificity to the hENT1 protein. The cells are washed to remove excess reagent, lysed, and centrifuged, and the supernatant is analyzed by CE-LIF with the use of an internal standard. Accuracy was evaluated by comparing the capillary electrophoresis results with those obtained by flow cytometry; the results were highly correlated, r = 0.96. The relative standard deviation of the hENT1 assay was 10%, determined from nine independent assays of the same cell line, which is 3 times superior to results obtained in a flow cytometry assay. The detection limit for 5-SAENTA-x8f was 4300 molecules injected into the capillary.

Adenosine↗

Mutation of residue 33 of human equilibrative nucleoside transporters 1 and 2 alters sensitivity to inhibition of transport by dilazep and dipyridamole.

Human equilibrative nucleoside transporters (hENT) 1 and 2 differ in that hENT1 is inhibited by nanomolar concentrations of dipyridamole and dilazep, whereas hENT2 is 2 and 3 orders of magnitude less sensitive, respectively. When a yeast expression plasmid containing the hENT1 cDNA was randomly mutated and screened by phenotypic complementation in Saccharomyces cerevisiae to identify mutants with reduced sensitivity to dilazep, clones with a point mutation that converted Met33 to Ile (hENT1-M33I) were obtained. Characterization of the mutant protein in S. cerevisiae and Xenopus laevis oocytes revealed that the mutant had less than one-tenth the sensitivity to dilazep and dipyridamole than wild type hENT1, with no change in nitrobenzylmercaptopurine ribonucleoside (NBMPR) sensitivity or apparent uridine affinity. To determine whether the reciprocal mutation in hENT2 (Ile33 to Met) also altered sensitivity to dilazep and dipyridamole, hENT2-I33M was created by site-directed mutagenesis. Although the resulting mutant (hENT2-I33M) displayed >10-fold higher dilazep and dipyridamole sensitivity and >8-fold higher uridine affinity compared with wild type hENT2, it retained insensitivity to NBMPR. These data established that mutation of residue 33 (Met versus Ile) of hENT1 and hENT2 altered the dilazep and dipyridamole sensitivities in both proteins, suggesting that a common region of inhibitor interaction has been identified.

Amino Acid Sequence↗

Uridine recognition motifs of human equilibrative nucleoside transporters 1 and 2 produced in Saccharomyces cerevisiae.

The sugar moiety of nucleosides has been shown to play a major role in permeant-transporter interaction with human equilibrative nucleoside transporters 1 and 2 (hENT1 and hENT2). To better understand the structural requirements for interactions with hENT1 and hENT2, a series of uridine analogs with sugar modifications were subjected to an assay that tested their abilities to inhibit [3H]uridine transport mediated by recombinant hENT1 and hENT2 produced in Saccharomyces cerevisiae. hENT1 displayed higher affinity for uridine than hENT2. Both transporters barely tolerated modifications or inversion of configuration at C(3'). The C(2')-OH at uridine was a structural determinant for uridine-hENT1, but not for uridine-hENT2, interactions. Both transporters were sensitive to modifications at C(5') and hENT2 displayed more tolerance to removal of C(5')-OH than hENT1; addition of an O-methyl group at C(5') greatly reduced interaction with either hENT1 or hENT2. The changes in binding energies between transporter proteins and the different uridine analogs suggested that hENT1 formed strong interactions with C(3')-OH and moderate interactions with C(2')-OH and C(5')-OH of uridine, whereas hENT2 formed strong interactions with C(3')-OH, weak interactions with C(5')-OH, and no interaction with C(2')-OH.

Amino Acid Motifs↗

Equilibrative nucleoside transporter 1 expression is downregulated by hypoxia in human umbilical vein endothelium.

Reduced oxygen level (hypoxia) induces endothelial dysfunction and release of the endogenous nucleoside adenosine. Human umbilical vein endothelium (HUVEC) function in an environment with 3% to 5% O2 and exhibit efficient adenosine membrane transport via human equilibrative nucleoside transporters 1 (hENT1). We studied whether adenosine transport and hENT1 expression are altered by hypoxia in HUVEC. Hypoxia (0 to 24 hours, 2% and 1% O2) reduced maximal hENT1-adenosine transport velocity (V(max)) and maximal nitrobenzylthionosine (NBMPR, a high-affinity hENT1 protein ligand) binding, but increased extracellular adenosine concentration. Hypoxia also reduced hENT1 protein and mRNA levels, effects unaltered by N(omega)-nitro-l-arginine methyl ester (l-NAME, nitric oxide synthase [NOS] inhibitor) or PD-98059 (inhibitor of mitogen-activated protein kinase kinase 1 and 2 [MEK1/2]). Hypoxia reduced endothelial NOS (eNOS) activity and eNOS phosphorylation at Ser(1177), but increased eNOS protein level. Hypoxia increased (1 to 3 hours), but reduced (24 hours) p42/44(mapk) phosphorylation. Thus, hypoxia-increased extracellular adenosine may result from reduced hENT1-adenosine transport in HUVEC. Hypoxia effect seems not to involve NO, but p42/44(mapk) may be required for the relatively rapid effect (1 to 3 hours) of hypoxia. These results could be important in diseases where the fetus is exposed to intrauterine environments poor in oxygen, such as intrauterine growth restriction, or where adenosine transport is altered, such as gestational diabetes.

Adenosine↗

Analysis of human equilibrative nucleoside transporter 1 (hENT1) protein in non-Hodgkin's lymphoma by immunohistochemistry.

The human equilibrative nucleoside transporter 1 (hENT1) is a member of the equilibrative nucleoside transporter family that mediates cellular entry of gemcitabine, cytarabine, and fludarabine. Deficiency in hENT1 confers resistance to toxicity of these drugs in a variety of model systems. Since some nucleoside analogs have a role in treating patients with non-Hodgkin's lymphoma (NHL), this study was undertaken to assess hENT1 abundance in NHL. A total of 115 cases of NHL of various subtypes and 15 reactive lymph nodes were evaluated for the presence of hENT1 protein using immunohistochemistry applied to frozen tissues. Samples were considered positive when >or=50% of neoplastic cells showed immunostaining. In reactive lymph nodes, hENT1 was confined to the germinal centers, whereas mantle zone B-cells and interfollicular T-cells were negative. In NHL, a relatively high frequency of hENT1 positivity was found in Burkitt lymphoma/leukemia (63%), diffuse large B-cell lymphoma (DLCL; 45%), and follicular lymphoma (40%). In DLCL, 26% of cases were positive for CD10, and CD10-positive DLCL cases were more likely to be hENT1 positive than CD10-negative cases (P=0.025). A lower frequency of hENT1 positivity was found in mantle cell lymphoma (13%) and peripheral T-cell lymphomas (37%). All marginal zone lymphomas (n=5), chronic lymphocytic leukemia small lymphocytic lymphomas (n=10), plasmacytoma (n=3), acute lymphoblastic lymphoma/leukemia, and anaplastic large-cell lymphomas (n=5) were negative. In conclusion, hENT1 was most frequently found in benign and malignant follicular center cells. Prospective studies to assess the value of hENT1 immunostaining in predicting resistance to nucleoside chemotherapy for NHL are warranted.

Equilibrative Nucleoside Transporter 1↗

Residues Met89 and Ser160 in the human equilibrative nucleoside transporter 1 affect its affinity for adenosine, guanosine, S6-(4-nitrobenzyl)-mercaptopurine riboside, and dipyridamole.

The human equilibrative nucleoside transporter 1 (hENT1) is an important modulator of the physiological action of adenosine. We identified amino acid residues involved in adenosine transport using a yeast-based assay to rapidly screen and identify randomly generated hENT1 mutants that exhibited decreased sensitivity to inhibition of adenosine transport by various hENT1 competitive inhibitors. We identified Met89 and Ser160 as important in the affinity of hENT1 for various substrates and inhibitors. Mutation to Met89Cys or Ser160Cys significantly (p < 0.05) increased the S6-(4-nitrobenzyl)-mercaptopurine riboside (NBMPR) IC50 values by approximately 4- and 6-fold, respectively (42 +/- 13 and 65 +/- 1.6 nM) compared with the wild-type transporter (11 +/- 0.7 nM). The double mutant Met89Cys/Ser160Cys synergistically increased the NBMPR IC50 value to approximately 19-fold of that of the wild-type transporter. In contrast, compared with wild-type hENT1, the sensitivity to dipyridamole inhibition was significantly (p < 0.05) increased by only the Ser160Cys (approximately 2.6-fold) or the double mutant Met89Cys/Ser160Cys (approximately 4.7-fold) but not by the Met89Cys mutant. Mutation to Met89Cys or Ser160Cys increased the Km of adenosine (approximately 8- and 3-fold) and the Ki of guanosine (approximately 6- and 2-fold). The double mutant increased both the Km value of adenosine and the Ki value of guanosine by approximately 8-fold and seemed to confer no additional reduction in adenosine or guanosine affinity than that by mutation of Met89 alone. Together, these data indicate that transmembrane domains (TMDs) 2 (Met89) and 4 (Ser160) of hENT1 interact and are important in conferring sensitivity to NBMPR. In contrast, Ser160 and Met89 of hENT1, respectively, play a dominant role in conferring sensitivity to dipyridamole and adenosine/guanosine affinity.

Adenosine↗

Identification of the mitochondrial targeting signal of the human equilibrative nucleoside transporter 1 (hENT1): implications for interspecies differences in mitochondrial toxicity of fialuridine.

We have previously shown that the human equilibrative nucleoside transporter 1 (hENT1) is expressed and functional in the mitochondrial membrane and that this expression enhances the mitochondrial toxicity of the nucleoside drug, fialuridine (FIAU) (Lai, Y., Tse, C. M., and Unadkat, J. D. (2004) J. Biol. Chem. 279, 4490-4497). Here we report on identification of the mitochondrial targeting sequence of hENT1. Using confocal microscopy and different truncated and point mutants of hENT1-YFP (yellow fluorescent protein) expressed in Madin-Darby canine kidney cells, we identified amino acid residues Pro(71),Glu(72), and Asn(74) (the PEXN motif) of hENT1 as important in mitochondrial targeting of hENT1. Identification of this mitochondrial targeting sequence provides a possible explanation for the dramatic difference in mitochondrial toxicity of FIAU between humans and rodents. Although the mouse ENT1 (mENT1), expressed in Madin-Darby canine kidney cells, can transport FIAU, confocal microscopy showed that mENT1-GFP (green fluorescent protein) was not localized to the mitochondria. Consistent with this observation, mitochondria isolated from mouse livers did not transport FIAU. Sequence alignment of hENT1, mENT1, and rat ENT1 (rENT1) showed that the PEXN motif of hENT1 was substituted with a PAXS motif in both mENT1 and rENT1. Substitution of PAXS in mENT1 with PEXN (to create mENT1-PEXN-GFP) and of PEXN in hENT1 with PAXS (to create hENT1-PAXS-YFP) resulted in partial mitochondrial localization of mENT1-PEXN-GFP and loss of mitochondrial localization of hENT1-PAXS-YFP. This is the first time that the mitochondrial targeting signal of hENT1 has been identified. Our data suggest that the lack of mitochondrial toxicity of FIAU in mice is due to the lack of mENT1 targeting to and expression in the mitochondria.

Amino Acid Sequence↗

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

5' Flanking Region↗

The type 1 equilibrative nucleoside transporter regulates ethanol intoxication and preference.

Adenosine is an important mediator of ethanol intoxication. In vitro, ethanol stimulates adenosine signaling by inhibiting the type 1 equilibrative nucleoside transporter (ENT1), whereas chronic ethanol exposure downregulates ENT1. It is not known, however, whether ENT1 is important for ethanol intoxication or consumption in vivo. Here we report that ENT1-null mice show reduced hypnotic and ataxic responses to ethanol and greater consumption of alcohol as compared with their wild-type littermates. These features are associated with a decrease in adenosine tone, as measured indirectly as a reduction in A(1) receptor-mediated inhibition of glutamate excitatory postsynaptic currents (EPSCs) in the nucleus accumbens, leading to increased phosphorylation of CRE-binding protein (CREB) in the striatum. Treatment with an A(1) receptor agonist decreases EPSC amplitude and reduces ethanol consumption in ENT1-null mice. Our results indicate that ENT1 has a physiological role in ethanol-mediated behaviors and suggest that decreased A(1) adenosine receptor function promotes alcohol consumption.

Adenosine↗

Functional and molecular characterization of nucleobase transport by recombinant human and rat equilibrative nucleoside transporters 1 and 2. Chimeric constructs reveal a role for the ENT2 helix 5-6 region in nucleobase translocation.

The human (h) and rat (r) equilibrative (Na(+)-independent) nucleoside transporters (ENTs) hENT1, rENT1, hENT2, and rENT2 belong to a family of integral membrane proteins with 11 transmembrane domains (TMs) and are distinguished functionally by differences in sensitivity to inhibition by nitrobenzylthioinosine and coronary vasoactive drugs. Structurally, the proteins have a large glycosylated loop between TMs 1 and 2 and a large cytoplasmic loop between TMs 6 and 7. In the present study, hENT1, rENT1, hENT2, and rENT2 were produced in Xenopus laevis oocytes and investigated for their ability to transport pyrimidine and purine nucleobases. hENT2 and rENT2 efficiently transported radiolabeled hypoxanthine, adenine, guanine, uracil, and thymine (apparent K(m) values 0.7-2.6 mm), and hENT2, but not rENT2, also transported cytosine. These findings were independently confirmed by hypoxanthine transport experiments with recombinant hENT2 produced in purine-cytosine permease (FCY2)-deficient Saccharomyces cerevisiae and provide the first direct demonstration that the ENT2 isoform is a dual mechanism for the cellular uptake of nucleosides and nucleobases, both of which are physiologically important salvage metabolites. In contrast, recombinant hENT1 and rENT1 mediated negligible oocyte fluxes of hypoxanthine relative to hENT2 and rENT2. Chimeric experiments between rENT1 and rENT2 using splice sites at rENT1 residues 99 (end of TM 2), 171 (between TMs 4 and 5), and 231 (end of TM 6) identified TMs 5-6 of rENT2 (amino acid residues 172-231) as a determinant of nucleobase transport activity, suggesting that this domain forms part(s) of the ENT2 substrate translocation channel.

Animals↗

Determinants of sensitivity and resistance to gemcitabine: the roles of human equilibrative nucleoside transporter 1 and deoxycytidine kinase in non-small cell lung cancer.

Gemcitabine is one of the most commonly used agents for lung cancer chemotherapy, but the determinants of sensitivity and/or resistance to this agent are not yet fully understood. In this study we used quantitative RT-PCR to examine the expression levels of human equilibrative nucleoside transporter 1 (hENT1) and deoxycytidine kinase (dCK) genes in non-small cell lung cancer (NSCLC) cell lines in relation to sensitivity and resistance to gemcitabine. The basal expression levels of hENT1 were significantly correlated with the IC50 values for gemcitabine (r =-0.6769, P = 0.0005), whereas dCK expression levels were not. In a highly gemcitabine-sensitive cell line, NCI-H23, the sensitivity to gemcitabine was inhibited by nitrobenzylmercaptopurine ribonucleoside (NBMPR), an inhibitor of hENT1, without significant modulation of hENT1 expression. These data suggest that hENT1 is associated with gemcitabine sensitivity in lung cancer. We also continuously exposed NCI-H23 cells to gemcitabine and subsequently established the drug-resistant clone H23/GEM-R, which showed a significant decrease of dCK expression; however, hENT1 expression was not altered in the continuously exposed sublines or in the resistant clone. We conclude that increased hENT1 expression is a determinant of gemcitabine sensitivity, while decreased dCK expression is associated with acquired resistance to gemcitabine in NSCLC cells. Thus, hENT1 and dCK might be useful as predictive markers for efficacy of gemcitabine therapy in NSCLC.

Affinity Labels↗

Gene-expression profiling reveals down-regulation of equilibrative nucleoside transporter 1 (ENT1) in Ara-C-resistant CCRF-CEM-derived cells.

We have investigated the mechanism of resistance of leukemia cells to Ara-C using an in-house cDNA microarray designed for the analysis of leukemia cells. We produced Ara-C-resistant cells from the CCRF-CEM (acute lymphoblastic leukemia) cell line and compared their gene-expression profile with that of wild-type cells. The adenosine deaminase (ADA) gene was highly up-regulated in Ara-C-resistant cells, while equilibrative nucleoside transporter 1 (ENT1) and several cell-cycle-related genes were down-regulated. Of all these genes, ENT1 seemed the most likely to be relevant to Ara-C resistance. To investigate the role of ENT1 in Ara-C-resistant cells, we transfected the cells with the gene. ENT1-transfected Ara-C-resistant cells resembled wild-type CCRF-CEM cells more closely than untransfected Ara-C-resistant cells in terms of growth rate, Ara-C-uptake characteristics, and ADA expression levels. The down-regulation of the ENT1 gene is expected to result in nucleotide deficiency in addition to blockage of Ara-C influx. Accordingly, Ara-C-resistant cells showed low growth rates, which were restored by transfection with ENT1. These low growth rates were also correlated with the phosphorylation level of cell-cycle checkpoint kinase 2. In this study we identified down-regulation of ENT1 as the factor responsible for Ara-C resistance, and this knowledge may be used to devise a clinical regimen that will overcome the resistance.

Adenosine Deaminase↗

Pharmacological analysis and molecular cloning of the canine equilibrative nucleoside transporter 1.

We studied the binding of [3H]nitrobenzylthioinosine (NBMPR) and the uptake of [3H]formycin B by the es (equilibrative inhibitor-sensitive) nucleoside transporter of Madin Darby Canine Kidney (MDCK) cells. NBMPR inhibited [3H]formycin B uptake with a Ki of 2.7+/-0.6 nM, and [3H]NBMPR had a KD of 1.3+/-0.3 nM for binding to these cells; these values are significantly higher than those obtained in human and mouse cell models. In contrast, other recognized es inhibitors, such as dipyridamole, were significantly more effective as inhibitors of [3H]NBMPR binding and [3H]formycin B uptake by MDCK cells relative to that seen for human cells. We isolated a cDNA encoding the canine es nucleoside transporter (designated cENT1), and assessed its function by stable expression in nucleoside transport deficient PK15NTD cells. The PK15-cENT1 cells displayed inhibitor sensitivities that were comparable to those obtained for the endogenous es nucleoside transporter in MDCK cells. These data indicate that the dog es/ENT1 transporter has distinctive inhibitor binding characteristics, and that these characteristics are a function of the protein structure as opposed to the environment in which it is expressed.

Amino Acid Sequence↗

The absence of human equilibrative nucleoside transporter 1 is associated with reduced survival in patients with gemcitabine-treated pancreas adenocarcinoma.

PURPOSE: Gemcitabine monotherapy is the standard palliative chemotherapy for pancreatic adenocarcinoma. Gemcitabine requires plasma membrane nucleoside transporter proteins to efficiently enter cells and exert it cytotoxicity. In vitro studies have demonstrated that deficiency of human equilibrative nucleoside transporter 1 (hENT1), the most widely abundant and distributed nucleoside transporter in human cells, confers resistance to gemcitabine toxicity, but the distribution and abundance of nucleoside transporters in normal and malignant pancreatic tissue is unknown. EXPERIMENTAL DESIGN: We studied tumor blocks from normal pancreas and 21 Alberta patients with gemcitabine-treated pancreatic cancer. Immunohistochemistry on the formalin-fixed, paraffin-embedded tissues was performed with specific hENT1 and human Concentrative Nucleoside Transporter 3 monoclonal antibodies and scored by a pathologist blinded to clinical outcomes. RESULTS: hENT1 was detected in normal Langerhan cells and lymphocytes but not in normal glandular elements. Patients in whom all adenocarcinoma cells had detectable hENT1 had significantly longer median survivals from gemcitabine initiation than those for whom hENT1 was absent in a proportion (10 to 100%) of adenocarcinoma cells (median survival, 13 versus 4 months, P = 0.01). Immunohistochemistry for human Concentrative Nucleoside Transporter 3 revealed moderate to high-intensity staining in all adenocarcinoma tissue samples. CONCLUSIONS: Patients with pancreatic adenocarcinoma with uniformly detectable hENT1 immunostaining have a significantly longer survival after gemcitabine chemotherapy than tumors without detectable hENT1. Immunohistochemistry for hENT1 shows promise as a molecular predictive assay to appropriately select patients for palliative gemcitabine chemotherapy but requires formal validation in prospective, randomized trials.

Adenocarcinoma↗

Differential expression of human equilibrative nucleoside transporter 1 (hENT1) protein in the Reed-Sternberg cells of Hodgkin's disease.

Gemcitabine is a cytotoxic nucleoside analog with activity in relapsing/refractory Hodgkin's disease (HD). Because gemcitabine is hydrophilic, it requires plasma membrane nucleoside transporter proteins to access intracellular targets. The most abundant and widely distributed transporter in human cells is human equilibrative nucleoside transporter 1 (hENT1). Because our prior studies showed that a deficiency in hENT1 confers high-level resistance to gemcitabine toxicity in vitro, we developed an immunohistochemical method to assess the hENT1 abundance of cells in tumor tissue. We now report the application of this method for visualizing the hENT1 protein abundance in the plasma membranes of Reed-Sternberg cells in lymph nodes of HD patients. Frozen sections of 30 lymph nodes were stained with monoclonal antibodies (mAb 10D7G2) raised against a synthetic peptide comprised of residues 254-271 from the large intracellular loop of hENT1 and staining intensity was scored on a 0-4 + scale. hENT1-staining intensity varied among HD lymph node samples (score/n; 0/8; 1/10; 2/9; 3/3; 4/0) and suggested that at least 60% of the tumors appeared hENT1 deficient. Because Epstein-Barr virus (EBV) is often associated with HD, staining for Epstein-Barr early RNA was also examined. Although 9/30 patients tested positive for EBV, there was no correlation with hENT1 staining. hENT1-staining intensities were positively correlated with age of the patient but were independent of other clinical, laboratory or pathology features (tumor stage, histologic subtype, presence of B symptoms, staining for CD15 or CD30, serum biochemistry, disease free survival, and overall survival). We conclude that, because hENT1 deficiency has been previously related to nucleoside-drug resistance, immunohistochemical staining for hENT1 warrants evaluation as a predictive tool for guiding the appropriate use of gemcitabine in the treatment of HD.

Adolescent↗

Mitochondrial expression of the human equilibrative nucleoside transporter 1 (hENT1) results in enhanced mitochondrial toxicity of antiviral drugs.

Many antiviral drugs (e.g. fialuridine; FIAU) produce clinically significant mitochondrial toxicity that limits their dose or prevents their use in the clinic. Because the majority of nucleoside drugs is too hydrophilic to cross the highly impermeable mitochondrial membrane, we have hypothesized that they must be transported into the mitochondria to produce their toxicity. To test this hypothesis, we have sought to determine whether the nucleoside transporters, human equilibrative nucleoside transporter 1 (hENT1) or human concentrative nucleoside transporter 1 (hCNT1), when stably expressed in Madin-Darby canine kidney cells as yellow fluorescent fusion protein (YFP), are localized to the mitochondria. By using organelle-selective dyes and confocal microscopy, we have found that hENT1-YFP is localized to the mitochondria as well as the plasma membrane, whereas hCNT1-YFP was found predominantly on the plasma membrane. hENT1-YFP was not localized to the nuclear envelope, endosomes, lysosomes, or Golgi complex. Western blotting confirmed the presence of hENT1-YFP or endogenous hENT1 in mitochondria isolated from hENT1-YFP-expressing cells and human livers, respectively. In agreement with these localization data, [14C]FIAU was efficiently transported into the mitochondria of cells expressing hENT1-YFP but not of cells expressing hCNT1-YFP. The mitochondrial toxicity of FIAU to Madin-Darby canine kidney cells was enhanced by hENT1-YFP, even when hENT1 activity on the plasma membrane was selectively blocked by 10 nm nitrobenzylthioinosine. Moreover, FIAU (50 microm) produced significant mitochondrial toxicity ( approximately 70% decrease in mitochondrial DNA synthesis) when it was directly incubated with mitochondria isolated from hENT1-expressing cells. In conclusion, we have identified for the first time that hENT1 is expressed on the mitochondrial membrane and that this expression enhances the mitochondrial toxicity of nucleoside drugs such as FIAU. Mitochondrial expression of hENTs may explain the clinically significant mitochondrial toxicity caused by the anti-HIV nucleoside drugs such as zidovudine, stavudine, and didanosine.

Animals↗