SEARCH · Search PubMed

Results for “DNA binding activity”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

PubMed2026

DNA-binding activity of PIF7 links phytochrome B signaling to plant responses to vegetation proximity.

PHYTOCHROME INTERACTING FACTORs (PIFs) are transcription factors that act as central signaling hubs in light-regulated processes. All PIFs contain an active phytochrome B-binding motif and a DNA-binding basic helix-loop-helix domain. In the shade-avoider Arabidopsis thaliana, PIF7 is a major promoter of hypocotyl elongation in response to vegetation proximity, becoming active when released from phytochrome B via its active phytochrome B-binding motif. Here we show that PIF7 promotes seedling elongation in other species, including the shade-avoider tomato and the shade-tolerant Cardamine hirsuta, suggesting that PIF7 has retained some of its key functional domains across diverse plants. Through complementation analyses using PIF7 variants lacking either the active phytochrome B-binding or basic helix-loop-helix domain, we demonstrate that, unlike PIF3, PIF7 versions unable to bind phytochrome B remain active regardless of light conditions, whereas loss of DNA-binding capacity fully disrupts PIF7 function. Our results further suggest that phytochrome B interaction imposes a dual regulatory control over PIF7, modulating both its abundance and its phosphorylation state (ie its ability to bind and regulate target genes).

Phytochrome B↗

PubMed2026

A novel DNA-protective function of Escherichia coli thioredoxin 2 mediated by its N-terminal zinc-binding domain.

Thioredoxins are ubiquitous thiol-disulfide oxidoreductases that maintain intracellular redox homeostasis. In addition to its conserved catalytic domain, Escherichia coli thioredoxin 2 (EcTrx2) possesses a unique N-terminal zinc-binding domain whose physiological function remains largely unknown. Here, we identify a previously unrecognized DNA-binding activity of EcTrx2 and demonstrate its role in protecting DNA during oxidative stress. Electrophoretic mobility shift assays showed that EcTrx2 bound plasmid DNA in a concentration-dependent and GST-tag-independent manner, whereas EcTrx1 exhibited no detectable DNA-binding activity. DNA binding was abolished by deletion of the N-terminal zinc-binding domain and was blocked by zinc occupancy, indicating that this unique domain is essential for DNA interaction. Consistent with these findings, EcTrx2 significantly protected plasmid DNA from DNase I digestion and hydroxyl radical-mediated oxidative damage in vitro. Furthermore, EcTrx2 enhanced bacterial tolerance to the DNA-damaging agents zeocin and diamide, supporting the physiological relevance of its DNA-binding activity. Our results reveal a DNA-binding role for EcTrx2 and identify its N-terminal zinc-binding domain as a key determinant of DNA binding and protection against oxidative DNA damage.

DNA binding↗

PubMed1978

Identification of four trans-3,4-dihydrodiol metabolites of 7,12-dimethylbenz[a]anthracene and their in vitro DNA-binding activities upon further metabolism.

Trans-3,4-dihydrodiols of 7,12-dimethylbenz[a]anthracene (7,12-Me2BA), 7-methyl-12-hydroxymethylbenz[a]anthracene (7-Me-12-OHMeBA), 7-hydroxymethyl-12-methylbenz[a]anthracene (7-OHMe-12-MeBA), and 7,12-di(hydroxymethyl)benz[a]anthracene [7,12-(OHMe)2BA] have been identified as metabolites of the potent carcinogenic and adrenocorticolytic agent 7,12-MeBA. The four trans-3,4-dihydrodiols were identified by their (i) ultraviolet-visible absorption and fluorescence properties, (ii) different retention times on both reversed-phase and normal-phase high-pressure liquid chromatography, (iii) mass spectral analysis, and (iv) inability to form vicinal cis-acetonides. Upon further metabolism by liver microsomes, the trans-3,4-dihydrodiols of 7,12-Me2BA, 7-Me-12OHMeBA, and 7-OHMe-12-MeBA were found to give rise to products that bind more strongly to DNA in vitro than do the products of 7,12-Me2BA. The evidence suggests that one or more of the four trans-3,4-dihydrodiols may be the proximate carcinogenic and adrenocorticolytic metabolites.

9,10-Dimethyl-1,2-benzanthracene↗

PubMed2025

Structure-function relationship of ASH1L and histone H3K36 and H3K4 methylation.

The histone H3K36-specific methyltransferase ASH1L plays a critical role in development and is frequently dysregulated in human diseases, particularly cancer. Here, we report on the biological functions of the C-terminal region of ASH1L encompassing a bromodomain (ASH1LBD), a plant homeodomain (ASH1LPHD) finger, and a bromo-adjacent homology (ASH1LBAH) domain, structurally characterize these domains, describe their mechanisms of action, and explore functional crosstalk between them. We find that ASH1LPHD recognizes H3K4me2/3, whereas the neighboring ASH1LBD and ASH1LBAH have DNA binding activities. The DNA binding function of ASH1LBAH is a driving force for the association of ASH1L with the linker DNA in the nucleosome, and the large interface with ASH1LPHD stabilizes the ASH1LBAH fold, merging two domains into a single module. We show that ASH1L is involved in embryonic stem cell differentiation and co-localizes with H3K4me3 but not with H3K36me2 at transcription start sites of target genes and genome wide, and that the interaction of ASH1LPHD with H3K4me3 is inhibitory to the H3K36me2-specific catalytic activity of ASH1L. Our findings shed light on the mechanistic details by which the C-terminal domains of ASH1L associate with chromatin and regulate the enzymatic function of ASH1L.

Histones↗

PubMed2026

African swine fever virus A151R protein antagonizes the antiviral activity of barrier-to-autointegration factor (BAF) by targeting its dsDNA-binding activity.

Barrier-to-autointegration factor (BAF) is a ubiquitous double-stranded DNA-binding protein that compacts DNA and can restrict poxvirus replication in the cytoplasm. BAF antiviral DNA-binding activity is tightly regulated by dynamic phosphorylation mediated by viral and cellular enzymes. For example, vaccinia virus counteracts BAF by encoding the B1 kinase, which phosphorylates BAF and abrogates its DNA-binding activity. Some DNA viruses, such as African swine fever virus (ASFV), undergo cytoplasmic replication but appear to lack a B1-like kinase. Interestingly, ASFV encodes A151R, a viral protein recently found to stably interact with BAF. Here, we demonstrate that A151R is capable of counteracting the antiviral properties of BAF. Structural modeling indicates that A151R is not a protein kinase and does not phosphorylate BAF but instead directly targets its double-stranded DNA-binding interface. This interaction enhances genome replication and progeny production of a B1-deficient virus. Mechanistically, A151R markedly impairs BAF DNA binding and disrupts its dimerization, a key requirement for high-affinity DNA association. Importantly, disruption of the A151R-BAF interaction abolishes these effects and restores BAF antiviral function. In addition, expression of the unphosphorylatable BAF mutant, which normally exhibits strong chromatin association, was redistributed to the cytoplasm in the presence of A151R, further supporting phosphorylation-independent regulation of BAF-DNA association. In conclusion, our findings support a previously unrecognized mechanism by which ASFV A151R disables BAF antiviral activity by obscuring its DNA-binding interface and inhibiting DNA binding in a phosphorylation-independent manner.IMPORTANCEDNA viruses replicating in the cytoplasm must overcome host intrinsic defenses to ensure productive replication, yet the mechanisms underlying their antagonism of the DNA-binding antiviral factor BAF remain incompletely understood. Here, we identify African swine fever virus (ASFV) A151R as a novel viral regulator that disables BAF by targeting its double-stranded DNA-binding interface rather than altering its phosphorylation state. We demonstrate that A151R impairs BAF DNA binding, disrupts its dimerization, and promotes viral DNA accumulation and progeny production in a BAF-dependent manner. Importantly, this activity requires A151R-BAF interaction and is independent of BAF phosphorylation status. Our findings reveal a previously unrecognized strategy employed by ASFV to neutralize host DNA-binding restriction factors and expand the molecular framework of BAF-mediated antiviral defense.

A151R↗

PubMed1976

Deoxyribonucleic acid-binding studies on the hut repressor and mutant forms of the hut repressor of Salmonella typhimurium.

In Salmonella typhimurium the genes coding for the enzymes of histidine utilization (hut) are clustered in two adjacent operons, hutMIGC and hut(P,R,Q)UH. A single repressor, the product of the C gene, regulates both operons by binding at two operator sites, one near M and one in (P,R,Q). The deoxyribonucleic acid (DNA)-binding activity of the repressor was measured using DNA's containing separate operators. The repressor had greater activity when assayed using DNA containing the operator of the (P,R,Q)UH operon than when assayed using DNA containing the operator of the MIGC operon. The binding to either operator was absent in the presence of the inducer, urocanate. The DNA-binding activities were also determined for two super-repressors. The super-repressors had altered DNA-binding properties, although the self-regulated nature of the repressors complicated the analysis of the results. A purfication procedure for the wild-type repressor is presented. The purified repressor was somewhat unstable, and additional experiments using it were not performed.

Amidohydrolases↗

PubMed2025

Missense variants in human forkhead transcription factors reveal determinants of forkhead DNA bispecificity.

Recognition of specific DNA sequences by transcription factors (TFs) is a key step in transcriptional control of gene expression. While most forkhead (FH) TFs bind either an FKH (RYAAAYA) or an FHL (GACGC) recognition motif, some FHs can bind both motifs. Mechanisms that control whether an FH is monospecific vs. bispecific have remained unknown. Screening a library of 12 reference FH proteins, 61 naturally occurring missense variants including clinical variants, and 22 designed mutant FHs for DNA-binding activity using universal ("all 10-mer") protein-binding microarrays revealed non-DNA-contacting residues that control mono- vs. bispecificity. Variation in non-DNA-contacting amino acid residues of TFs is associated with human traits and may play a role in the evolution of TF DNA-binding activities and gene regulatory networks.

Humans↗

PubMed2023

DNA binding and RAD51 engagement by the BRCA2 C-terminus orchestrate DNA repair and replication fork preservation.

The tumor suppressor BRCA2 participates in DNA double-strand break repair by RAD51-dependent homologous recombination and protects stressed DNA replication forks from nucleolytic attack. We demonstrate that the C-terminal Recombinase Binding (CTRB) region of BRCA2, encoded by gene exon 27, harbors a DNA binding activity. CTRB alone stimulates the DNA strand exchange activity of RAD51 and permits the utilization of RPA-coated ssDNA by RAD51 for strand exchange. Moreover, CTRB functionally synergizes with the Oligonucleotide Binding fold containing DNA binding domain and BRC4 repeat of BRCA2 in RPA-RAD51 exchange on ssDNA. Importantly, we show that the DNA binding and RAD51 interaction attributes of the CTRB are crucial for homologous recombination and protection of replication forks against MRE11-mediated attrition. Our findings shed light on the role of the CTRB region in genome repair, reveal remarkable functional plasticity of BRCA2, and help explain why deletion of Brca2 exon 27 impacts upon embryonic lethality.

DNA Replication↗

PubMed2024

Human PC4 supports telomere stability and viability in cells utilizing the alternative lengthening of telomeres mechanism.

Cancer cells with an activated Alternative Lengthening of Telomeres (ALT) mechanism elongate telomeres via homology-directed repair. Sustained telomeric replication stress is an essential trigger of ALT activity; however, it can lead to cell death if not properly restricted. By analyzing publicly available data from genome-wide CRISPR KO screenings, we have identified the multifunctional protein PC4 as a novel factor essential for ALT cell viability. Depletion of PC4 results in rapid ALT cell death, while telomerase-positive cells show minimal effects. PC4 depletion induces replication stress and telomere fragility primarily in ALT cells, and increases ALT activity. PC4 binds to telomeric DNA in cells, and its binding can be enhanced by telomeric replication stress. Finally, a mutant PC4 with partly impaired single stranded DNA binding activity is capable to localize to telomeres and suppress ALT activity and telomeric replication stress. We propose that PC4 supports ALT cell viability, at least partly, by averting telomere dysfunction. Further studies of PC4 interactions at ALT telomeres may hold promise for innovative therapies to eradicate ALT cancers.

Humans↗

PubMed2019

RETRACTED: Investigation of the effect of UV-B light on Arabidopsis MYB4 (AtMYB4) transcription factor stability and detection of a putative MYB4-binding motif in the promoter proximal region of AtMYB4.

Here, we have investigated the possible effect of UV-B light on the folding/unfolding properties and stability of Arabidopsis thaliana MYB4 (AtMYB4) transcription factor in vitro by using biophysical approaches. Urea-induced equilibrium unfolding analyses have shown relatively higher stability of the wild-type recombinant AtMYB4 protein than the N-terminal deletion forms after UV-B exposure. However, as compared to wild-type form, AtMYB4Δ2 protein, lacking both the two N-terminal MYB domains, showed appreciable alteration in the secondary structure following UV-B exposure. UV-B irradiated AtMYB4Δ2 also displayed higher propensity of aggregation in light scattering experiments, indicating importance of the N-terminal modules in regulating the stability of AtMYB4 under UV-B stress. DNA binding assays have indicated specific binding activity of AtMYB4 to a putative MYB4 binding motif located about 212 bp upstream relative to transcription start site of AtMYB4 gene promoter, while relatively weak DNA binding activity was detected for another putative MYB4 motif located at -908 bp in AtMYB4 promoter. Gel shift and fluorescence anisotropy studies have shown increased binding affinity of UV-B exposed AtMYB4 to the promoter proximal MYB4 motif. ChIP assay has revealed binding of AtMYB4 to the promoter proximal (-212 position) MYB4 motif (ACCAAAC) in vivo. Docking experiments further revealed mechanistic detail of AtMYB4 interaction with the putative binding motifs. Overall, our results have indicated that the N-terminal 62-116 amino acid residues constituting the second MYB domain plays an important role in maintaining the stability of the C-terminal region and the overall stability of the protein, while a promoter proximal MYB-motif in AtMYB4 promoter may involve in the regulation of its own expression under UV-B light.

Arabidopsis↗

PubMed1975

Binding of bleomycin to DNA in bleomycin-sensitive and -resistant rat ascites hepatoma cells.

The 14C activity of [14C]bleomycin bound to DNA in bleomycin-sensitive rat ascites hepatoma cells (AH-66) was 8.7 times higher than in resistant cells (AH-66F) when the cells were incubated with [14C]bleomycin. The difference in permeability to bleomycin was not significant; uptake of [14C]bleomycin by the sensitive cells was only 1.2 times larger than that by the resistant cells, and the radioactivity incorporated into the nuclei of sensitive cells was only 1.3-fold greater. The bleomycin-inactivating enzyme level in the resistant cells was 3.5 times higher than in the sensitive cells, indicating that the antibiotic incorporated into the resistent cells was reduced in DNA-binding activity to a large extent. The level of protein-free thiol compound in the sensitive cells was 1.8-fold higher than in the resistant cells, suggesting a possible enhancement of bleomycin action by intracellular thiol compound as is found in vitro. These factors probably affect the DNA strand scission and the sensitivity of cells to this antibiotic. Binding of [14C]bleomycin to DNA in vitro was studied in the presence and the absence of dithiothreitol. A large portion of the radioactivity bound in the presence of dithiothreitol was unstable to acid, but the acid-resistant binding was also enhanced by this thiol compound.

Animals↗

PubMed1975

Immunology of DNA. III. Crithidia luciliae, a simple substrate for the determination of anti-dsDNA with the immunofluorescence technique.

C. luciliae are hemoflagellates nonpathogenic for man and easy to culture. They have a giant mitochondrion, in which the mitochondrial DNA is concentrated in a single large network, the kinetoplast. When used as a substrate for the indirect immunofluorescence technique, studying sera from patients with SLE, we could demonstrate a very good correlation between this test and the Farr assay for the demonstration of antibodies to double-stranded DNA. Although the sensitivity of both techniques is on the same order of magnitude, the IF technique has the following advantages over the Farr assay. It is easy to perform in laboratories equipped for autoimmune serology. It possesses an intrinsic check on the immunoglobulin character of the DNA-binding activity. It allows one to determine the Ig classes and subclasses of antibodies to DNA. It permits study of complement fixation to antibodies without interference of Clq fixation to DNA or anticomplementarity of the serum. There is an absence of interference with antibodies to single-stranded DNA.

Antibodies, Antinuclear↗

PubMed2025

Moss BRCA2 lacking the canonical DNA-binding domain promotes homologous recombination and binds to DNA.

BRCA2 is crucial for mediating homology-directed DNA repair (HDR) through its binding to single-stranded DNA (ssDNA) and the recombinases RAD51 and DMC1. Most BRCA2 orthologs have a canonical DNA-binding domain (DBD) with the exception of Drosophila melanogaster. It remains unclear whether such a noncanonical BRCA2 variant without DBD possesses a DNA-binding activity. Here, we identify a new noncanonical BRCA2 in the model plant Physcomitrium patens (PpBRCA2). We establish that PpBRCA2 is essential for genome integrity maintenance, somatic DNA double-strand break (DSB) repair, HDR-mediated gene targeting, and RAD51 foci recruitment at DNA break sites. PpBRCA2 is also critical for DSB repair during meiosis. Interestingly, PpBRCA2 interacts strongly with RAD51 but weakly with DMC1, suggesting a distinct meiotic function compared to other BRCA2 homologs. Despite lacking the canonical DBD, PpBRCA2 binds ssDNA through its disordered N-terminal region and efficiently promotes HDR. Our work highlights that the ssDNA binding capacity of BRCA2 homologs is conserved regardless of the presence of a canonical DBD and provides a deeper understanding of BRCA2's functional diversity across species.

BRCA2 Protein↗

PubMed2026

SpxA1 and SpxA2 function as a stoichiometry-dependent regulatory rheostat governing virulence gene expression in group A Streptococcus.

UNLABELLED: Group A Streptococcus (GAS) is a human-restricted pathogen whose global incidence has surged in the post-COVID era. The ability of GAS to shift from a colonizing to invasive phenotype depends on coordinated virulence gene regulation in response to host-derived signals. However, the mechanisms by which individual stress-sensing systems interact to reshape the virulence gene regulatory landscape remain incompletely understood. Here, we define the regulatory programs of two conserved transcriptional regulator paralogs, SpxA1 and SpxA2, using an integrated multi-omic approach combining RNA-seq, data-independent acquisition proteomics, NanoString-based transcriptional profiling across multiple host-relevant stress conditions, and chromatin immunoprecipitation with exonuclease treatment (ChIP-exo). RNA-seq revealed functionally distinct regulons with SpxA1 governing oxidative stress defense and SpxA2 coordinating virulence-associated gene expression linked to the CovRS two-component regulatory system. Proteomic analysis established SpxA2 as a ClpXP protease substrate in GAS and identified reciprocal paralog accumulation upon loss of either SpxA1 or SpxA2, consistent with compensatory transcriptional upregulation. NanoString profiling under bacitracin and human neutrophil peptide-1 challenge identified four gene modules with distinct stoichiometry-dependent and condition-dependent regulatory logic, revealing that the SpxA1/SpxA2 ratio rather than the activity of either paralog alone determines which transcriptional programs are engaged. ChIP-exo demonstrated that SpxA2 directly modulates CovR-DNA binding occupancy in a CovR-binding motif-dependent manner, simultaneously antagonizing CovR dimer binding at an extended (25 bp) CovR motif and facilitating CovR monomer binding at the canonical ATTARA motif. These findings establish the LiaFSR-SpxA2-CovRS axis as a cross-regulatory circuit through which GAS cell envelope stress sensing is directly transduced into coordinated virulence gene regulatory changes. IMPORTANCE: Group A Streptococcus (GAS) causes millions of infections annually, including a recent global surge in invasive disease. To survive in the human host, GAS must rapidly reprogram virulence gene expression in response to host-derived stresses. This study characterizes two conserved transcriptional regulators, SpxA1 and SpxA2, that govern this response through interaction with RNA polymerase to indirectly influence the DNA-binding activity of downstream transcription factors. We show that SpxA2, activated by a cell envelope stress-sensing system responding to human antimicrobial peptides, reshapes the binding of the master virulence regulator CovR in a promoter-specific manner, coupling cell envelope stress sensing to virulence gene regulation. The stoichiometric balance between SpxA1 and SpxA2 functions as a regulatory rheostat calibrating overall virulence gene regulatory tone, providing a framework for understanding how RNA polymerase-interacting regulators coordinate stress responses and virulence gene control across Gram-positive bacterial pathogens.

Streptococcus pyogenes↗

PubMed2025

Characterizing the regulatory logic of transcriptional control at the DNA sequence level by ensembles of thermodynamic models.

MOTIVATION: Understanding how the genome encodes the regulatory logic of transcription is a main challenge of the post-genomic era, and can be overcome with the aid of customized computational tools. RESULTS: We report an automated framework for analyzing an ensemble of fits to data of a thermodynamics-based sequence-level model for transcriptional regulation. The fits are clustered accordingly with their intrinsic regulatory logic. A multiscale analysis enables visualization of quantitative features resulting from the deconvolution of the regulatory profile provided by multiple transcription factors interacting with the locus of a gene. Quantitative experimental data on reporters driven by the whole locus of the even-skipped gene in the blastoderm of Drosophila embryos was used for validating our approach. A few clusters of highly active DNA binding sites within the enhancers collectively modulate even-skipped gene transcription. Analysis of variable enhancers' length shows the importance of bound protein-protein interactions for transcriptional regulation. The interplay between activation and quenching enables function conservation of enhancers despite length variations. AVAILABILITY AND IMPLEMENTATION: The transcription factor level data used for performing the reported study is accessible in the input files in Zenodo and GitHub as well the full code. Additional data from formerly FlyEx database will be available under request.

Thermodynamics↗

PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗

PubMed2025

Mutations in the transcriptional regulator MAB_2885 confer tedizolid and linezolid resistance through the MmpS-MmpL efflux pump MAB_2302-MAB_2303 in Mycobacterium abscessus.

Mycobacterium abscessus (MAB) is a clinically significant multidrug-resistant (MDR) pathogen, particularly implicated in pulmonary infections among cystic fibrosis (CF) patients. Tedizolid (TZD), an oxazolidinone-class antibacterial drug, has been recommended as an alternative treatment for MAB-infected patients who are intolerant to or whose isolate is resistant to first-line drugs including linezolid (LZD). To investigate the TZD resistance mechanisms in MAB, we isolated 23 TZD-resistant MAB mutants and performed whole-genome sequencing (WGS) to identify resistance-associated genes. Frequent mutations were identified in MAB_2885, encoding a putative TetR transcriptional regulator, and MAB_2303, encoding a putative mycobacterial membrane protein large (MmpL). Drug susceptibility testing confirmed that MAB_2885 mutations contribute to both TZD and LZD resistance in MAB. RNA-seq analysis revealed that restoring wild-type MAB_2885 in mutants downregulated the MAB_2302-MAB_2303. Electrophoretic mobility shift assay (EMSA) showed the MAB_2885 protein binds to its target sequence upstream of MAB_2302-MAB_2303, further confirming their regulatory relationship. The W91R mutation in the MAB_2885 protein was found to impair its DNA-binding activity compared to the wild-type. Liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis confirmed that MAB_2302-MAB_2303 functions as a TZD efflux pump. Additionally, overexpression of MAB_2885 in M. abscessus subsp. bolletii and M. abscessus subsp. massiliense also increased their TZD susceptibility and downregulated their respective MmpS-MmpL orthologs. Overall, our study demonstrates that mutations in MAB_ 2885 contribute to TZD and LZD resistance by disrupting the negative regulation of the downstream MAB_2302-MAB_2303, which functions as a direct efflux pump for TZD. These findings provide new insights into oxazolidinone resistance mechanisms in MAB and identify potential biomarkers for detecting drug resistance.

Mycobacterium abscessus↗

PubMed1977

[Role of the functional groups of the sibiromycin molecule in DNA binding].

Biological activity of 2 derivatives of sibiromycin, an antibiotic close by its chemical structure to antramycin and their capacity for formation of complexes with DNA was studied. Anhydrosibiromycin like sibiromycin formed a complex with DNA. The antibiotic increased the DNA melting point but to a less extent than sibiromycin. Anhydrosibiromycin had a low activity in the system of DNA-dependent RNA-polymerase. The low biological activity of anhydrosibiromycin must be due to instability of the antibiotic complex with DNA. Methyl ether of sibiromycin by the phenol hydroxyl, the other derivative of sibiromycin had no biological activity and did not interact with DNA. On the basis of experimental data it was suggested that definite functional groups of the sibiromycin participated in DNA binding.

Antibiotics, Antineoplastic↗