Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “DNA, Intergenic”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources
PubMed2025

Human Genome REWRITE for Off-the-Shelf Stem Cells Reveals an "Epigenetic Ghost".

Human leukocyte antigen (HLA) polymorphism hinders off-the-shelf cell therapies. We developed REWRITE, a modular platform for iterative, scar-minimized genome writing of synthetic constructs >100 kb in human pluripotent stem cells (hPSCs). Using REWRITE, we deleted 105-209 kb of the HLA locus and installed synthetic 24 kb or 100 kb HLA haplotypes, and a 62 kb antigen-processing locus. This uncovered a persistent, heritable "epigenetic ghost" - an active state lingering despite genetic removal - whose resolution to a silenced default state is driven by native intergenic DNA. These loci restored inducible expression in key lineages, sparing cells from NK-mediated killing and establishing HLA-matched T-cell tolerance, enabling off-the-shelf cell therapies. REWRITE facilitates extensible programming of multigenic functions in allogeneic human cells - from immune design to genome architecture discovery.

Journal Article↗
PubMed1977

Ribosomal RNA genes of Saccharomyces cerevisiae. II. Physical map and nucleotide sequence of the 5 S ribosomal RNA gene and adjacent intergenic regions.

A DNA fragment containing the structural gene for the 5 S ribosomal RNA and intergenic regions before and after the 35 S ribosomal RNA precursor gene of Saccharomyces cerevisiae has been amplified in a bacterial plasmid and physically mapped by restriction endonuclease cleavage and hybridization to purified yeast 5 S ribosomal RNA. The nucleotide sequence of the DNA fragments carrying the 5 S ribosomal RNA gene and adjacent regions has been determined. The sequence unambiguously identifies the 5 S ribosomal RNA gene, determines its polarity within the ribosomal DNA repeating unit, and reveals the structure of its promoter and termination regions. Partial DNA sequence of the regions near the beginning and end of the 35 S ribosomal RNA gene has also been determined as a preliminary step in establishing the structure of promoter and termination regions for the 35 S ribosomal RNA gene.

Base Sequence↗
PubMed2023

Non-coding regions of nuclear-DNA-encoded mitochondrial genes and intergenic sequences are targeted by autoantibodies in breast cancer.

Autoantibodies against mitochondrial-derived antigens play a key role in chronic tissue inflammation in autoimmune disorders and cancers. Here, we identify autoreactive nuclear genomic DNA (nDNA)-encoded mitochondrial gene products (GAPDH, PKM2, GSTP1, SPATA5, MFF, TSPOAP1, PHB2, COA4, and HAGH) recognized by breast cancer (BC) patients' sera as nonself, supporting a direct relationship of mitochondrial autoimmunity to breast carcinogenesis. Autoreactivity of multiple nDNA-encoded mitochondrial gene products was mapped to protein-coding regions, 3' untranslated regions (UTRs), as well as introns. In addition, autoantibodies in BC sera targeted intergenic sequences that may be parts of long non-coding RNA (lncRNA) genes, including LINC02381 and other putative lncRNA neighbors of the protein-coding genes ERCC4, CXCL13, SOX3, PCDH1, EDDM3B, and GRB2. Increasing evidence indicates that lncRNAs play a key role in carcinogenesis. Consistent with this, our findings suggest that lncRNAs, as well as mRNAs of nDNA-encoded mitochondrial genes, mechanistically contribute to BC progression. This work supports a new paradigm of breast carcinogenesis based on a globally dysfunctional genome with altered function of multiple mitochondrial and non-mitochondrial oncogenic pathways caused by the effects of autoreactivity-induced dysregulation of multiple genes and their products. This autoimmunity-based model of carcinogenesis will open novel avenues for BC treatment.

autoimmunity↗
PubMed2026

Transcription Start Regions in PTU-intergenic regions drive cell cycle-dependent transcriptional activation events in Leishmania donovani.

Leishmania displays an unconventional mode of transcription, with long clusters of genes being transcribed polycistronically from Transcription Start Regions (TSRs), being processed into monocistronic units prior to translation. It has long been believed that transcription is constitutive: failure to identify consensus sequences across TSRs (except a GT-rich motif supporting transcription in Trypanosoma brucei) and absence of canonical eukaryotic transcription factors led to the conclusion that regulation is primarily post-transcriptional, with epigenetics playing a role in triggering transcription initiation. This study stems from our previous findings identifying a few genes to be activated in a cell cycle-dependent manner. Using nuclear run-on assays to analyze nascent transcripts of two chromosomes, chromosomes 2 and 14, we find that while most genes are constitutively transcribed, a subset of genes gets activated at specific cell cycle stages. Reporter assays reveal that this transcriptional activation is driven by the regions immediately upstream of the genes. Sequence analyses of these TSRs lying in polycistronic intergenic regions (PIRs) uncovered a 10-mer GT-rich motif, in synchrony with earlier findings in T. brucei identifying a GT-rich motif at bidirectional TSRs. We also identify a second 25-mer motif at these TSRs, and deletion analyses find this motif to be critical for regulating gene expression. The findings of this study reveal that transcriptional events in these unicellular parasites are more complex than believed thus far: not all transcriptional events are constitutive, polycistronic transcription is not the only mode of transcription, and cis-acting sequence elements regulate at least some transcriptional events in these parasites.IMPORTANCEEndemic to 90 countries, Leishmania parasites cause a spectrum of diseases called Leishmaniases. No vaccines for human use are available to date, and the drugs currently used to treat the disease are expensive, have toxic side effects, and have complex administration regimens, with emerging drug resistance compounding problems. Researchers continue to investigate Leishmania cellular processes, with the hope of uncovering new therapeutic target sites. Gene regulation in these parasites is unusual, being modulated by various mechanisms, including epigenetic modifications, gene dosage, and post-transcriptional processing. Transcription is typically polycistronic and constitutive, initiating from Transcription Start Regions (TSRs) lying upstream of the first gene in the polycistronic transcription unit (PTU). The work presented here reveals that a subset of genes is transcribed monocistronically in a cell cycle-dependent manner from Transcription Start Regions lying in the PTU-intergenic regions (PIRs), underscoring the complexities of gene regulation in these parasites.

Leishmania donovani↗
PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗
PubMed2022

Comparison on Major Gene Mutations Related to Rifampicin and Isoniazid Resistance between Beijing and Non-Beijing Strains of Mycobacterium tuberculosis: A Systematic Review and Bayesian Meta-Analysis.

Objective: The Beijing strain of Mycobacterium tuberculosis (MTB) is controversially presented as the predominant genotype and is more drug resistant to rifampicin and isoniazid compared to the non-Beijing strain. We aimed to compare the major gene mutations related to rifampicin and isoniazid drug resistance between Beijing and non-Beijing genotypes, and to extract the best evidence using the evidence-based methods for improving the service of TB control programs based on genetics of MTB. Method: Literature was searched in Google Scholar, PubMed and CNKI Database. Data analysis was conducted in R software. The conventional and Bayesian random-effects models were employed for meta-analysis, combining the examinations of publication bias and sensitivity. Results: Of the 8785 strains in the pooled studies, 5225 were identified as Beijing strains and 3560 as non-Beijing strains. The maximum and minimum strain sizes were 876 and 55, respectively. The mutations prevalence of rpoB, katG, inhA and oxyR-ahpC in Beijing strains was 52.40% (2738/5225), 57.88% (2781/4805), 12.75% (454/3562) and 6.26% (108/1724), respectively, and that in non-Beijing strains was 26.12% (930/3560), 28.65% (834/2911), 10.67% (157/1472) and 7.21% (33/458), separately. The pooled posterior value of OR for the mutations of rpoB was 2.72 ((95% confidence interval (CI): 1.90, 3.94) times higher in Beijing than in non-Beijing strains. That value for katG was 3.22 (95% CI: 2.12, 4.90) times. The estimate for inhA was 1.41 (95% CI: 0.97, 2.08) times higher in the non-Beijing than in Beijing strains. That for oxyR-ahpC was 1.46 (95% CI: 0.87, 2.48) times. The principal patterns of the variants for the mutations of the four genes were rpoB S531L, katG S315T, inhA-15C > T and oxyR-ahpC intergenic region. Conclusion: The mutations in rpoB and katG genes in Beijing are significantly more common than that in non-Beijing strains of MTB. We do not have sufficient evidence to support that the prevalence of mutations of inhA and oxyR-ahpC is higher in non-Beijing than in Beijing strains, which provides a reference basis for clinical medication selection.

Isoniazid↗
PubMed2026

Versatile, marker-free platform for life cycle-wide imaging of Plasmodium falciparum by integrating an exogenous gene cassette into a conserved intergenic locus.

The creation of transgenic Plasmodium falciparum lines with robust fluorescence across the entire life cycle is essential for advancing our understanding of parasite biology, which in turn informs the development of new drugs and vaccines. In this study, we utilized Plasmodium-optimized genome editing to integrate an mCherry expression cassette into a selected intergenic locus without gene disruption. The resulting marker-free line, NF54-mCh, exhibited intense fluorescence throughout all developmental stages, including asexual and sexual blood stages, as well as mosquito (ookinete, oocyst, and sporozoite) and liver stages. NF54-mCh showed normal proliferation, gametocytogenesis, and efficient transmission to mosquitoes. The ultra-high brightness in salivary gland sporozoites allowed for the non-invasive identification of infected mosquitoes. Sporozoites remained highly infectious to humanized mouse livers, thus enabling the completion of the full life cycle. NF54-mCh serves as a parental line for performing additional genetic modifications, because the CRISPR/Cas9-based genome editing method is free of introduced drug resistance markers. The broader applicability of this strategy was validated by generating similar reporter lines in Plasmodium species utilized in rodent malaria models. In summary, NF54-mCh represents a unique, versatile platform that will accelerate fundamental research and support the future development of malaria control strategies, including new vaccines and drugs.

Animals↗
PubMed2004

MCALIGN: stochastic alignment of noncoding DNA sequences based on an evolutionary model of sequence evolution.

A method is described for performing global alignment of noncoding DNA sequences based on an evolutionary model parameterized by the frequency distribution of lengths of insertion/deletion events (indels) and their rate relative to nucleotide substitutions. A stochastic hill-climbing algorithm is used to search for the most probable alignment between a pair of sequences or three sequences of known phylogenetic relationship. The performance of the procedure, parameterized according to the empirical distribution of indel lengths in noncoding DNA of Drosophila species, is investigated by simulation. We show that there is excellent agreement between true and estimated alignments over a wide range of sequence divergences, and that the method outperforms other available alignment methods.

Algorithms↗
PubMed2025

Methylation patterns of the nasal epigenome of hospitalized SARS-CoV-2 positive patients reveal insights into molecular mechanisms of COVID-19.

BACKGROUND: Coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has varied presentations from asymptomatic to death. Efforts to identify factors responsible for differential COVID-19 severity include but are not limited to genome wide association studies (GWAS) and transcriptomic analysis. More recently, variability in host epigenomic profiles have garnered attention, providing links to disease severity. However, whole epigenome analysis of the respiratory tract, the target tissue of SARS-CoV-2, remains ill-defined. RESULTS: We interrogated the nasal methylome to identify pathophysiologic drivers in COVID-19 severity through whole genome bisulfite sequencing (WGBS) of nasal samples from COVID-19 positive individuals with severe and mild presentation of disease. We noted differential DNA methylation in intergenic regions and low methylated regions (LMRs), demonstrating the importance of distal regulatory elements in gene regulation in COVID-19 illness. Additionally, we demonstrated differential methylation of pathways implicated in immune cell recruitment and function, and the inflammatory response. We found significant hypermethylation of the FUT4 promoter implicating impaired neutrophil adhesion in severe disease. We also identified hypermethylation of ELF5 binding sites suggesting downregulation of ELF5 targets in the nasal cavity as a factor in COVID-19 phenotypic variability. CONCLUSIONS: This study demonstrated DNA methylation as a marker of the immune response to SARS-CoV-2 infection, with enhancer-like elements playing significant roles. It is difficult to discern whether this differential methylation is a predisposing factor to severe COVID-19, or if methylation differences occur in response to disease severity. These differences in the nasal methylome may contribute to disease severity, or conversely, the nasal immune system may respond to severe infection through differential immune cell recruitment and immune function, and through differential regulation of the inflammatory response.

Humans↗
PubMed2026

The complete genomic sequence of a novel member of the genus Caulimovirus isolated from Dregea volubilis.

A novel caulimovirus was identified from diseased leaves of Dregea volubilis exhibiting yellowing and vein-associated chlorosis in Yuanjiang County, Yunnan Province, China. The virus was tentatively named Dregea volubilis caulimovirus 1 (DVCaV1). The complete genome sequence of DVCaV1, determined by de novo assembly of high-throughput sequencing data, comprises 8,160 bp of circular double-stranded DNA containing two intergenic regions and seven open reading frames (ORFs). These ORFs encode (in order) a movement protein (MP), an aphid transmission factor (ATF), a virion-associated protein (VAP), a coat protein (CP), a polymerase polyprotein (Pol, containing protease, reverse transcriptase, and RNase H domains), a transactivator/viroplasmin (TAV) protein, and a hypothetical protein of unknown function. Sequence comparisons revealed the highest nucleotide similarity with strawberry vein banding virus (SVBV; NC_001725). Phylogenetic analysis confirmed DVCaV1 as a member of the genus Caulimovirus, with SVBV as its closest known relative. According to current ICTV species demarcation criteria for the genus Caulimovirus (host range and > 20% nucleotide sequence divergence in the polymerase region), DVCaV1 represents a novel species. This is, to our knowledge, the first report of a caulimovirus detected in naturally symptomatic Dregea volubilis.

Genome, Viral↗
PubMed1978

Assembly of the mitochondrial membrane system. Genetic complementation of mit- mutations in mitochondrial DNA of Saccharomyces cerevisiae.

A method has been devised to test intergenic complementation of mutations in the mitochondrial DNA of Saccharomyces cerevisiae. The test is based on the observation that diploids issued from pairwise crosses of certain mit- mutants with deficiencies in cytochrome oxidase, or coenzyme QH2-cytochrome c reductase, acquire high levels of respiratory activity shortly after zygote formation. Under our experimental conditions neither biochemical complementation, interallelic complementation, nor recombination has been found to contribute to any significant extent toward the respiration measured in the diploids at early times. The test has been used to study the number of complementation groups represented by a large number of mit- mutants. Results of pairwise crosses of mutants in the oxi 1, oxi 2, oxi 3, cob 1, and cob 2 loci indicate that complementation occurs between the oxi and cob loci between different oxi loci but not between the two cob loci. The five loci have, therefore, been assigned to four different complementation groups.

DNA, Mitochondrial↗
PubMed2026

Regulatory mechanisms of maternal imprinting at the murine Dlk1-Dio3 domain.

Genomic imprinting is an epigenetic process causing parent-of-origin specific gene expression. The Dlk1-Dio3 domain is one of the largest imprinted clusters. While DNA methylation at an intergenic CpG-island (IG-CGI) within the imprinting control region (ICR) controls expression from the paternal chromosome, mechanisms regulating the unmethylated maternal chromosome remain unknown. Within the transcriptional regulatory element (IG-TRE) of the ICR, deletions identified a minimal region in vitro exhibiting both silencing and enhancing activity, with SOX2 and ZFP281 contributing to enhancer function on the maternal chromosome. In vivo, however, this deletion did not affect maternal expression in mouse embryos; instead it activated Dlk1 on both parental chromosomes. Combining deletion of this IG-TRE with the lethal IG-CGI deletion rescued lethality in mice by balancing Dlk1 expression, despite persistent maternal gene upregulation. These results demonstrate that loss of expression at this domain is more detrimental than gain, highlighting the importance of in vivo analysis. Identification of active regulatory factors on the unmethylated maternal chromosome challenges the prevailing view that imprinting is primarily a methylation-driven phenomenon, further revealing the sophisticated hierarchical mechanisms governing imprinting control.

Animals↗
PubMed2026

RAD54L coordinates the nucleolar DNA damage response to maintain rDNA stability.

The nucleolus is organized around actively transcribed ribosomal RNA genes (rDNA), where high RNA polymerase I (Pol I) activity creates intrinsic susceptibility to replication stress and DNA damage. Here, we identify the DNA translocase RAD54L as a critical regulator of the nucleolar DNA damage response (nDDR) to rDNA double-strand breaks (DSBs) and replication stress. We show that RAD54L localizes to the nucleolus under basal conditions and is recruited to nucleolar caps following CRISPR-Cas9-induced rDNA-DSBs to promote repair. RAD54L loss results in persistent RAD51 foci, increased nucleolar γH2AX, and micronuclei formation, indicating defective resolution of rDNA lesions and genome instability. Under baseline conditions and replication stress induced by the Pol I transcription inhibitor CX-5461, RAD54L limits the accumulation of ssDNA and coordinates nDDR signaling. We further show that rDNA-DSBs induce RNA polymerase II-dependent RNA-DNA hybrids (R-loops) at intergenic rDNA regions, which facilitate nucleolar reorganization and cap formation and repair factor recruitment. Together, these findings establish RAD54L as a key regulator that coordinates replication stress response and rDNA repair, maintaining rDNA stability and genome integrity.

DNA, Ribosomal↗
PubMed2026

The dark genome in cardiovascular medicine.

Only ∼1%-2% of the human genome directly codes for proteins. The remainder consists of non-coding DNA, often referred to as the 'dark genome'. This includes regulatory elements, transposable and repetitive sequences, structural genomic features, pseudogenes, intronic and intergenic regions, and non-coding RNA (ncRNA) genes. These components are increasingly recognized as major regulators of gene expression, cell identity, and disease susceptibility. Currently, dark genome elements, particularly ncRNAs are increasingly recognized as important regulators of cardiovascular health and disease. Advances in genome analysis technologies have greatly improved our understanding of these non-coding regions and revealed clearer connections between the dark genome and cardiovascular traits. This review highlights major parts of the dark genome involved in cardiovascular disease, with emphasis on those for which mechanistic understanding and translational relevance are beginning to emerge. As mechanistic insight into individual and collective components of the dark genome advances, it increasingly enables the development of new opportunities for targeted therapeutics for cardiovascular prevention and disease management.

Humans↗
PubMed2026

Mammalian DNA methyltransferases in DNA methylation and imprinted gene expression in extraembryonic ectoderm of post-implantation embryos.

DNA methylation in mammals is mainly catalyzed by three DNA methyltransferases (DNMTs). Conventionally, DNMT1 is considered the primary DNMT protein for maintenance DNA methylation, whereas DNMT3A and DNMT3B function in de novo DNA methylation. In two previous studies, we demonstrated that DNMT3A and DNMT3B maintain genome-wide DNA methylation in embryonic stem (ES) cells and in the epiblast of post-implantation embryos. Interestingly, DNMT3A and DNMT3B also sustain genome-wide DNA methylation in the extraembryonic ectoderm (EXE) of post-implantation embryos, including repeats, genic and intergenic regions. Although DNMT1 plays a major role in maintaining DNA methylation at the imprinting control regions (ICRs) in the imprinted regions, DNMT3A and DNMT3B are required for preserving DNA methylation at the ICRs of a subset of imprinted regions in EXE, similar to the observations in ES cells and epiblast. Surprisingly, de novo DNA methylation mediated by DNMT3A and DNMT3B leads to increased DNA methylation at a large subset of imprinted regions. These results are consistent with what we previously elucidated in the epiblast of post-implantation embryos. Importantly, loss of DNA methylation at the ICR of an imprinted region, resulting from the absence of DNMT1 or two DNMT3 proteins, causes allelic expression switch of the corresponding imprinted genes in that imprinted region. This study provides further evidence that DNMT3A and DNMT3B exert both maintenance and de novo DNA methylation functions across the genome in post-implantation embryos. It also validates some previous findings for DNA methylation-dependent allelic expression switch of imprinted genes.

DNA methylation↗
PubMed1979

Sequence of the 16 S-23 s spacer region in two ribosomal RNA operons of Escherichia coli.

The transducing phages lambdadaroE and lambdadilv5, which carry the Escherichia coli ribosomal RNA operons rrnD and rrnX, respectively, have been mapped with the restriction endonucleases BamHI, EcoRI, HindIII, and Sma I. Using hybridization techniques, we have located the ribosomal RNA genes on these phage DNAs. The DNA sequence of the 437-base-pair 16 S-23 S ribosomal RNA intergenic spacer in the two rRNA operons rrnD and rrnX has been determined. The nucleotides examined exhibit only one base pair change between rrnD and rrnX. Both spacer regions contain the genes for tRNA1Ile and tRNA1BAla; the gene sequences are identical with the previously deduced tRNA sequences and are clustered within the first 60% of the spacer DNA. The most striking feature of the 16 S-23 S intergenic region in these two operons is the disparity in G-C content between the tRNA gene sequences (60% G-C) and the remaining spacer DNA (37% G-C). Spacer sequences are known to be involved in the processing of the ribosomal RNA transcript by RNase III and RNase P. In addition, we report the sequence of the first 108 base pairs of the 23 S rRNA gene.

Base Sequence↗
PubMed2024

Triphenyl Phosphate Alters Methyltransferase Expression and Induces Genome-Wide Aberrant DNA Methylation in Zebrafish Larvae.

Emerging environmental contaminants, organophosphate flame retardants (OPFRs), pose significant threats to ecosystems and human health. Despite numerous studies reporting the toxic effects of OPFRs, research on their epigenetic alterations remains limited. In this study, we investigated the effects of exposure to 2-ethylhexyl diphenyl phosphate (EHDPP), tricresyl phosphate (TMPP), and triphenyl phosphate (TPHP) on DNA methylation patterns during zebrafish embryonic development. We assessed general toxicity and morphological changes, measured global DNA methylation and hydroxymethylation levels, and evaluated DNA methyltransferase (DNMT) enzyme activity, as well as mRNA expression of DNMTs and ten-eleven translocation (TET) methylcytosine dioxygenase genes. Additionally, we analyzed genome-wide methylation patterns in zebrafish larvae using reduced-representation bisulfite sequencing. Our morphological assessment revealed no general toxicity, but a statistically significant yet subtle decrease in body length following exposure to TMPP and EHDPP, along with a reduction in head height after TPHP exposure, was observed. Eye diameter and head width were unaffected by any of the OPFRs. There were no significant changes in global DNA methylation levels in any exposure group, and TMPP showed no clear effect on DNMT expression. However, EHDPP significantly decreased only DNMT1 expression, while TPHP exposure reduced the expression of several DNMT orthologues and TETs in zebrafish larvae, leading to genome-wide aberrant DNA methylation. Differential methylation occurred primarily in introns (43%) and intergenic regions (37%), with 9% and 10% occurring in exons and promoter regions, respectively. Pathway enrichment analysis of differentially methylated region-associated genes indicated that TPHP exposure enhanced several biological and molecular functions corresponding to metabolism and neurological development. KEGG enrichment analysis further revealed TPHP-mediated potential effects on several signaling pathways including TGFβ, cytokine, and insulin signaling. This study identifies specific changes in DNA methylation in zebrafish larvae after TPHP exposure and brings novel insights into the epigenetic mode of action of TPHP.

Animals↗