Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Cyclin G”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources

The p53-regulated cyclin G gene promotes cell growth: p53 downstream effectors cyclin G and Gadd45 exert different effects on cisplatin chemosensitivity.

Among the p53-regulated genes that have been identified thus far, cyclin G is a relatively recent one. We conducted a series of experiments aimed at elucidating cyclin G function. Ectopic overexpression of cyclin G in human RKO colon carcinoma cells accelerated cell growth. Transfection of normal human fibroblasts with the cyclin G expression vector promoted clonal expansion. Cyclin G immune complexes isolated from the transfected cells exhibited appreciable levels of cyclin-dependent kinase activity, as evidenced using histone H1 as a substrate. The retinoblastoma protein, pRb, was detectable in cyclin G immune complexes, raising the possibility that Rb may be one mediator of cyclin G action. Cyclin G-overexpressing cells were more sensitive to cisplatin cytotoxicity than the parent cells, probably because cyclin G overexpression overrides cell cycle checkpoint(s). Overexpression of another p53-regulated gene, GADD45, by contrast, protected cells from cisplatin killing. These findings suggest that different downstream effectors of the p53 pathway may exert different effects on cellular survival after treatment with cancer chemotherapy drugs such as cisplatin.

Antineoplastic Agents↗

Cyclin G: a new mammalian cyclin with homology to fission yeast Cig1.

A new gene encoding a cyclin-like protein has been isolated from a rat fibroblast cDNA library by cross-hybridization with a mixture of c-src family proto-oncogene kinase domains as a probe. This putative cyclin, called cyclin G, contains a typical cyclin box at the N-terminus but no apparent 'destruction box' or 'PEST' sequence. Interestingly, in its C-terminus region, it has a sequence homologous with a tyrosine phosphorylation site of the epidermal growth factor receptor. Although this cyclin is phylogenetically related to HCS26 of Saccharomyces cerevisiae, it most resembles Cig1, a B-type cyclin, of Schizosaccharomyces pombe, which has been suggested to act at the G1/S phase of the cell cycle. Cyclin G mRNA is induced within 3 h after growth stimulation and remains elevated with no apparent cell cycle dependency, indicating its close association with growth stimuli but not with the cell cycle.

Amino Acid Sequence↗

A role of cyclin G in the process of apoptosis.

Cyclin G was previously identified as a target gene of the p53 tumor suppresser protein, and levels of cyclin G are increased after induction of p53 by DNA damage. However, the function of cyclin G has not been established. To determine the effect of increased expression of cyclin G, retroviruses encoding cyclin G were constructed and used to infect three different murine cell lines. Cyclin G protein levels induced by the retroviruses were within the range seen after DNA damage induction of p53. In each case we observed that such over-expression of cyclin G augments the apoptotic process. TNF-alpha induction of apoptosis is increased by expression of cyclin G in NIH3T3 fibroblasts which express p53, as well as in 10.1 fibroblasts which contain no p53 allele. Additionally, we observed that while cyclin G expression is markedly reduced upon aggregate formation in embryonic carcinoma P19 cells, retrovirus-mediated over-expression of cyclin G enhances apoptotic cell death in aggregated P19 cells, and increases the extent of apoptosis caused by retinoic acid or serum starvation of these cells. These data demonstrate that cyclin G plays a facilitating role in modulating apoptosis induced by different stimuli. Moreover, we have discovered that cyclin G expression is rapidly induced in P19 cells after exposure to Bone Morphogenic Protein-4 (BMP-4), suggesting that cyclin G may mediate apoptotic signals generated by BMP-4.

3T3 Cells↗

Modulation of p53 and p73 levels by cyclin G: implication of a negative feedback regulation.

Cyclin G is a transcriptional target gene of tumor suppressor p53. Recent studies present evidence that cyclin G may play a central role in the p53-Mdm2 autoregulated module, but the precise function of cyclin G remains elusive. Here, we show a negative effect of cyclin G on the stability of p53 and p73. Cyclin G expression resulted in a dramatic decrease of p53 protein levels in response to DNA damage and abrogated irradiation-mediated G1 arrest along with an increase of S phase in MCF7 cells containing wild-type p53. In p53-null Saos2 cells, cyclin G inhibited p73 induction in response to genotoxic stress and delayed the camptothecin-mediated cell cycle arrest. Cyclin G interacts with p53 as well as p73, and its binding to p53 or p73 presumably mediates downregulation of p53 and p73. We also found that cyclin G-mediated reduction of p53 but not of p73 is Mdm2-dependent. Moreover, inhibition of cyclin G by small interfering RNA (siRNA) caused the accumulation of p53 and p73 protein levels in response to DNA damage. Therefore, our results imply that cyclin G is transcriptionally activated by p53 or p73, and, in turn, cyclin G negatively regulates the stabilization of p53 family proteins through an unknown mechanism different from ubiquitination or transcriptional control.

Blotting, Northern↗

Structure and chromosomal assignment of the human cyclin G gene.

Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.

Amino Acid Sequence↗

The negative role of cyclin G in ATM-dependent p53 activation.

Cyclin G is one of the earliest p53 target genes to be identified, but its function in the p53 pathway has been elusive. Although the precise mechanisms of cyclin G in this novel network have not been explored, recent studies have demonstrated that cyclin G is a key regulator of the p53-Mdm2 network. Here we present evidence that cyclin G-mediated p53 regulation is dependent upon the status of ataxia-telangiectasia mutated (ATM) protein, which activates p53 in response to DNA damage. Abrogation of cyclin G enhances p53 accumulation and phosphorylation of p53 at the Ser-15 residue, resulting in cell cycle arrest. Ectopically expressed cyclin G significantly reduces the steady-state levels of p53 as well as that of phosphorylated p53 at Ser-15 after DNA damage in normal human dermal fibroblasts containing normal ATM. However, cyclin G does not cause similar reductions in p53 levels in ATM-mutated cells. We also show that translocation of cyclin G to the nucleus requires functional ATM. Thus, our findings identify a new role of cyclin G in ATM-dependent p53 regulation and in cell cycle regulation during DNA damage.

Ataxia Telangiectasia Mutated Proteins↗

Cyclin G recruits PP2A to dephosphorylate Mdm2.

The function of cyclin G, a commonly induced p53 target, has remained elusive. We show that cyclin G forms a quaternary complex in vivo and in vitro with enzymatically active phosphatase 2A (PP2A) holoenzymes containing B' subunits. Interestingly, cyclin G also binds in vivo and in vitro to Mdm2 and markedly stimulates the ability of PP2A to dephosphorylate Mdm2 at T216. Consistent with these data, cyclin G null cells have both Mdm2 that is hyperphosphorylated at T216 and markedly higher levels of p53 protein when compared to wild-type cells. Cyclin G expression also results in reduced phosphorylation of human Hdm2 at S166. Thus, our data suggest that cyclin G recruits PP2A in order to modulate the phosphorylation of Mdm2 and thereby to regulate both Mdm2 and p53.

Animals↗

A better cell cycle target for gene therapy of colorectal cancer: cyclin G.

The purpose of this study was to evaluate the overexpression of cyclin G in colorectal neoplasia, which may be a more frequent event than cyclin D1 during the cell cycle and thus may have a more enhanced therapeutic potential in treating colorectal cancer. Ninety formalin-fixed, paraffin-embedded human colon and rectal specimens were obtained from the Pathology Department of Norris Cancer Center/University of Southern California. The tissues had been obtained after surgical resection between 1995 and 2001, and had been processed by routine clinical histopathologic methods. Ninety-one percent of colorectal tumors had cyclin G overexpression. These cyclin-positive patients were evenly distributed between men and women, and between tumor locations, that is, 36% rectal tumors and 34% right-sided tumors. Thirty-two percent were well differentiated, and 66% were moderately differentiated. Thirty patients (38%) had stage I disease, 16 (20%) had stage II disease, 25 (32%) had stage III, and seven (9%) had stage IV disease. Eight patients (10%) in this group had recurrent disease during follow-up. There was no correlation between cyclin G overexpression and clinical and pathologic characteristics. Cyclin D1 overexpression was found to be present in only 42% of colorectal adenocarcinomas. There was no correlation between cyclin D1 overexpression and clinical and pathologic characteristics. The present study demonstrates that cyclin G overexpression is a frequent event in colorectal cancer. This frequent event in colorectal carcinogenesis may facilitate new therapeutic approaches acting as a target for gene therapy, possibly directed at downregulating cyclin G in colorectal cancer.

Adenocarcinoma↗

Identification of p53 target genes through immune selection of genomic DNA: the cyclin G gene contains two distinct p53 binding sites.

An immune-selection procedure was employed in order to isolate p53-binding sites from rat genomic DNA. One such site was found to reside within the first intron of the cyclin G gene. Cyclin G mRNA levels are strongly elevated upon induction of wild type p53 activity in cells carrying a temperature sensitive p53 mutant. The cyclin G gene also carries a second p53-binding motif upstream to its transcriptional start site. The presence of two high affinity p53-binding sites may confer upon the cyclin G gene the potential to be activated very efficiently by p53. These data raise the possibility that cyclin G may be a downstream mediator of at least some of the biological effects of p53.

Amino Acid Sequence↗

Altered regulation of cyclin G in human breast cancer and its specific localization at replication foci in response to DNA damage in p53+/+ cells.

Cyclin G, a recent addition to the cyclin family, was initially identified in screens for new src kinase family members and soon thereafter by differential screening for transcriptional targets of the tumor suppressor gene, p53. We have identified cyclin G as being overexpressed in breast and prostate cancer cells using differential display polymerase chain reaction screening. We demonstrate here that cyclin G is overexpressed in human breast and prostate cancer cells and in cancer cells in situ from tumor specimens. Cyclin G expression was tightly regulated throughout the cell cycle in normal breast cells, peaking at the S and G2/M phases of the cell cycle with lower levels in G1. The cell cycle-dependent expression was absent in breast cancer cells. Following DNA damage in normal p53+/+ cells, cyclin G is triggered to cluster in discrete nuclear DNA replication foci that contain replication-associated proteins such as proliferating cell nuclear antigen (PCNA). While p53-/- cells displayed a faint cyclin G nuclear staining pattern, there was no increased expression and no change in distribution of the staining pattern after DNA damage. The specific subcellular localization of cyclin G at DNA replication foci provides an additional link between p53-mediated growth arrest and cell cycle regulation and suggests that cyclin G may act as an effector of p53-mediated events by functional association with replication foci protein(s).

Base Sequence↗

p53-independent cyclin G expression in a group of mature neurons and its enhanced expression during nerve regeneration.

An increase in cyclin G expression after nerve injury was demonstrated by differential display PCR, carried out to compare references in expression of mRNAs between axotomized and normal hypoglossal motoneurons in the rat. The nerve injury dramatically upregulated the expression of cyclin G mRNA in the motoneurons during the early phase of the nerve regeneration process, suggesting an involvement of cyclin G in the early stage of nerve regeneration. In brain, in situ hybridization studies also demonstrated cyclin G expression in a restricted group of matured neurons, particularly in the telencephalon and the thalamus. This constitutive expression in mature neurons suggests that cyclin G may have a function different from other members of the cyclin group. In addition, although cyclin G has been shown to be a transcription target of p53, the upregulation of cyclin G in injured motoneurons, as well as the expression in the adult rat brain, was not affected in the p53-deficient mouse. These data suggest that the expression of cyclin G, at least in the nervous system, is not regulated by p53 predominantly, and that there may be alternative regulatory factors or pathways for cyclin G expression.

Animals↗

p53-dependent association between cyclin G and the B' subunit of protein phosphatase 2A.

We and others previously showed that cyclin G is a transcriptional target of the p53 tumor suppressor protein. However, cellular proteins which might form a complex with cyclin G have not yet been identified. To gain insight into the biological role of cyclin G, we used the yeast two-hybrid screen and isolated two mouse cDNAs encoding cyclin G-interacting proteins. Interestingly, both positive cDNAs encoded B' regulatory subunits of protein phosphatase 2A (PP2A). One clone encodes B'alpha, while the other clone codes for a new member of the B' family, B'beta. B'beta is 70% identical to other members of the B' family. B'alpha associated both in vitro and in vivo with cyclin G but not with the other mammalian cyclins. Furthermore, cyclin G formed a complex with B'alpha only after induction of p53 in p53 temperature-sensitive cell lines. These results indicate that cyclin G forms a specific complex with the B' subunit of PP2A and that complex formation is regulated by p53. Potential roles for the cyclin G-B' complex in p53-mediated pathways are discussed.

Alternative Splicing↗

Cyclin G is a transcriptional target of the p53 tumor suppressor protein.

Through a PCR-based differential screening method, cyclin G was identified as a novel transcriptional target of the p53 tumor suppressor gene product. In both a mouse p53 temperature-sensitive leukemic cell line and mouse embryonic fibroblasts (MEF) after gamma-irradiation, cyclin G mRNA was rapidly induced. MEF from a p53-deficient mouse expressed cyclin G at a level > 10-fold lower than that from a wild-type mouse. Using a DNA binding assay, a specific p53 binding site was identified upstream from the cyclin G gene, which functioned as a p53-dependent cis-acting element in a transient transfection assay. These results suggest that cyclin G might participate in a p53-mediated pathway to prevent tumorigenesis.

Amino Acid Sequence↗

GAK: a cyclin G associated kinase contains a tensin/auxilin-like domain.

We have cloned a cDNA encoding a novel association partner of cyclin G by West-Western blotting. The cDNA encodes a protein that harbors a Ser/Thr protein kinase-like catalytic domain at the N-terminal. Hence, we named it GAK (cyclin G-associated kinase). The long C-terminal extension shares homology with tensin and auxilin, and contains a leucine zipper region. Co-immunoprecipitation and Western blotting showed that GAK and cyclin G associate together in vivo. GAK also co-precipitated with CDK5, and CDK5 was found to be associated with cyclin G. We also showed by BIAcore analysis that the GAK-cyclin G interaction was direct.

Adaptor Proteins, Vesicular Transport↗

Cyclin G: a regulator of the p53-Mdm2 network.

A recent study published in the April issue of Molecular Cell has shown that cyclin G, a p53 target, is a regulatory component of the active PP2A holoenzyme, which activates Mdm2 through dephosphorylation. These findings suggest that cyclin G is a key regulator of the p53-Mdm2 network.

Animals↗

Chromatin relaxation by overexpression of mutant p53, HPV16-E6, or cyclin G transgenes.

In this study, using a cell line that carries endogenous wild-type p53 genes, we show that transfection of cells with mutant p53, HPV16-E6, or cyclin G transgenes results in the disruption of higher-order chromatin structure, as evidenced by enhanced sensitivity to micrococcal nuclease. Multiple mechanisms may contribute to this phenotype, including histone H1 phosphorylation, direct binding of oncoproteins to nuclear matrix attachment sites, and altered expression of component genes of the p53 pathway, whose products may function in maintenance of chromatin structure.

Carcinoma↗

Possible biomarkers for ionizing radiation exposure in human peripheral blood lymphocytes.

Biomarkers to indicate past exposure to radiation have not been entirely satisfactory. Using cDNA microarray hybridization to find new potential biomarkers, we identified highly expressed genes in human peripheral blood lymphocytes (PBLs) after irradiation 1 Gy ex vivo. The present set of radiation markers in PBLs was identified 12 h after radiation. A total of 44 genes were identified. However, when RT-PCR was performed with mRNA from the PBLs of five individuals, only four genes, including TRAIL receptor 2, DRAL (now known as FHL2), cyclin G, and cyclin protein gene, showed greater than 50% agreement between gene induction as detected by microarray analysis and by RT-PCR. When more than 32 donors were tested for the above four genes, greater than 85% agreement was obtained between gene induction measured by microarray analysis and by RT-PCR. There was a linear dose-response relationship between 0.5 and 4 Gy 12 h after irradiation; however, there was less linearity at later times. These results suggested that the relative expression levels of genes such as TRAIL receptor 2, FHL2, cyclin G, and cyclin protein gene in PBLs may provide estimates of radiation exposures.

Biomarkers↗

Isolation of Trypanosoma brucei CYC2 and CYC3 cyclin genes by rescue of a yeast G(1) cyclin mutant. Functional characterization of CYC2.

Two Trypanosoma brucei cyclin genes, CYC2 and CYC3, have been isolated by rescue of the Saccharomyces cerevisiae mutant DL1, which is deficient in CLN G(1) cyclin function. CYC2 encodes a 24-kDa protein that has sequence identity to the Neurospora crassa PREG1 and the S. cerevisiae PHO80 cyclin. CYC3 has the most sequence identity to mitotic B-type cyclins from a variety of organisms. Both CYC2 and CYC3 are single-copy genes and expressed in all life cycle stages of the parasite. To determine if CYC2 is found in a complex with previously identified trypanosome cdc2-related kinases (CRKs), the CYC2 gene was fused to the TY epitope tag, integrated into the trypanosome genome, and expressed under inducible control. CYC2ty was found to associate with an active trypanosome CRK complex since CYC2ty bound to leishmanial p12(cks1), and histone H1 kinase activity was detected in CYC2ty immune-precipitated fractions. Gene knockout experiments provide evidence that CYC2 is an essential gene, and co-immune precipitations together with a two-hybrid interaction assay demonstrated that CYC2 interacts with CRK3. The CRK3 x CYC2ty complex, the first cyclin-dependent kinase complex identified in trypanosomes, was localized by immune fluorescence to the cytoplasm throughout the cell cycle.

Amino Acid Sequence↗