Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “3' Untranslated Regions”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 recordsLinked to original sources
PubMed2001

The role of 3'-untranslated region (3'-UTR) mediated mRNA stability in cardiovascular pathophysiology.

Knowledge of transcription and translation has advanced our understanding of cardiac diseases. Here, we present the hypothesis that the stability of mRNA mediated by the 3'-untranslated region (3'-UTR) plays a role in changing gene expression in cardiovascular pathophysiology. Several proteins that bind to sequences in the 3'-UTR of mRNA of cardiovascular targets have been identified. The affected mRNAs include those encoding beta-adrenergic receptors, angiotensin II receptors, endothelial and inducible nitric oxide synthases, cyclooxygenase, endothelial growth factor, tissue necrosis factor (TNF-alpha), globin, elastin, proteins involved in cell cycle regulation, oncogenes, cytokines and lymphokines. We discuss: (a) the types of 3'-UTR sequences involved in mRNA stability, (b) AUF1, HuR and other proteins that bind to these sequences to either stabilize or destabilize the target mRNAs, and (c) the potential role of the 3'-UTR mediated mRNA stability in heart failure, myocardial infarction and hypertension. We hope that these concepts will aid in better understanding cardiovascular diseases and in developing new therapies.

3' Untranslated Regions↗
PubMed2005

Regulatory role of the 3' untranslated region (3'UTR) of rat 5' deiodinase (D1). effects on messenger RNA translation and stability.

The previous findings that both a long and a short type 1 deiodinase (D1) mRNA are present in different tissues and that the D1 gene contains two potential polyA signals suggest that the two mRNAs result from differential polyA signal usage. In this study, we examined the properties of the two D1 mRNAs generated in HEK 293 cells by the alternative use of each of the poly A signals in order to ascertain the potential regulatory role of the 3'UTR of this gene. Our results showed that the long mRNA is less stable, but that it is translated more efficiently than the short mRNA. The net result of these differences is a higher D1 activity with the long message. These data suggest that the D1 3'UTR may play an important role in regulating the stability and translational efficiency of the D1 mRNA, both of which could be physiologically relevant when the demand for D1 activity is high.

3' Untranslated Regions↗
PubMed1995

Inhibitory effect of 3'-untranslated region (3'-UTR) of human tissue-plasminogen activator (ht-PA) mRNA on its expression.

A series of t-PA cDNA mutants containing different parts of 3'-UTR sequences have been constructed. In vitro translation of t-PA transcripts in rabbit reticulocyte lysates and its expression in COS-7 cells show that the 3'-UTR sequence has a very strong inhibitory effect on t-PA translation. The deletion of 3'-UTR results in 3-8-fold increase of t-PA expression. Further study shows that an AU-rich sequence of some 200 nt at 3' end of 3'-UTR is responsible for the translational inhibition. RNA stability experiment reveals that the AU-rich segment leads to a 3-fold decrease of t-PA mRNA stability. The insertion of this segment into the 3'-UTR of luciferase gene results in an obvious inhibition of Luc expression. A model is proposed for the regulation of t-PA expression.

Animals↗
PubMed2003

[Cloning and identification of 5'-untranslated region (UTR) and 3'-untranslated region of neutrophil gelatinase-associated lipocalin (NGAL) gene from esophageal carcinoma cell line SHEEC].

BACKGROUND & OBJECTIVE: Neutrophil gelatinase-associated lipocalin (NGAL) was a novel member of the lipocalin family. The authors previously found that NGAL was overexpressed in the progress of malignant transformation from human immortalized esophageal epithelial cell line SHEE to esophageal carcinoma cell line SHEEC. However, the regulation mechanism of NGAL overexpression was not known. The objective of this study was to clone 5'-untranslated region(5'-UTR) and 3'untranslated region (3'-UTR) of NGAL in SHEEC and to analyze their structural characters. METHODS: 5'-UTR and 3'-UTR of NGAL were cloned from SHEEC using rapid amplification of cDNA ends(RACE). After sequencing the alignment of their nucleotides was analyzed by BLAST database of NCBI and the potential cis-acting elements in the 3'-UTR were identified by computer analysis. RESULTS: The authors cloned and sequenced 69 bp 5'-UTR and 147 bp 3'-UTR of NGAL gene on the basis of the previous works and did not find any base pair mutation. CONCLUSION: NGAL gene from SHEEC had the entire 5'-UTR and 3'-UTR.

3' Untranslated Regions↗
PubMed1996

Classification of turnip mosaic virus isolates according to the 3'-untranslated region.

The 3'-untranslated region (3'UTR) of five isolates of turnip mosaic virus (TuMV) from United Kingdom, Canada, Greece, the Czech Republic and from Uzbekistan were sequenced and compared with another nine previously sequenced TuMV isolates. All the isolates had 209 nucleotides long 3'UTR, with the exception of the Uzbekistan isolate, which had one-base deletion at nucleotide (nt) position 162. Phylogenetic analysis identified three clusters of related isolates. The clusters correlated with secondary folding of the 3'UTRs, partially with the source host plant of the isolates but not with their geographical origin.

Base Sequence↗
PubMed1998

Stability determinants are localized to the 3'-untranslated region and 3'-coding region of the neurofilament light subunit mRNA using a tetracycline-inducible promoter.

The tetracycline-responsive expression system of Bujard was used to compare rates of decay of wild-type and mutant neurofilament (NF) light subunit (NF-L) mRNAs. Optimal conditions for activation and inactivation of the target transgene were determined using a luciferase reporter gene. Analyses of mRNA stability were thereupon conducted on cells that were doubly transfected with transactivator and inducible target genes and derived from pooled clones of transfected cells. Rates of mRNA decay were compared upon inactivation of the transgenes after high levels of mRNA had been induced. Deletion of the 445-nucleotide (nt) 3'-untranslated region (3'-UTR) (L/++(+)-) or 527 nt of the 3'-coding region (3'-CR) (L/++-+) increased the stability of NF-L mRNA compared with the full-length (L/++(++)) transcript in neuronal (N2a and P19 cells) and non-neuronal (L cells) lines. Deletion of both the 3'-UTR and 3'-CR (L/++--) led to a further stabilization of the transcript. A major stability determinant was then localized to a 68-nt sequence that forms the junction between the 3'-CR and 3'-UTR of NF-L and is the binding site of a unique ribonucleoprotein complex (Cañete-Soler, R., Schwartz, M. L., Hua, Y., and Schlaepfer, W. W. (1998) J. Biol. Chem. 273, 12655-12661). The studies establish a novel system for mapping determinants of mRNA stability and have applied the system to localize determinants that regulate the stability of the NF-L mRNA.

Animals↗
PubMed1999

Identification of a large region of secondary structure in the 3'-untranslated region of chicken elastin mRNA with implications for the regulation of mRNA stability.

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal vascular development. Our laboratory has previously shown that changes in elastin mRNA stability contribute to this developmental decrease in elastin production. Here we identify a large region of stable secondary structure in the 3'-untranslated region (3'-UTR) of chicken elastin mRNA. Reverse transcriptase polymerase chain reaction or polymerase chain reaction amplification of the 3'-UTR consistently resulted in products with an approximately 328-bp deletion from the central region of the 3'-UTR, suggesting the presence of secondary structure. The presence of this structure was confirmed by probing the 3'-UTR with RNases with selectivity for single- or double-stranded RNA. Gel migration shift assays using cytosolic extracts from 2-day old chicken aorta demonstrate specific binding of a cytosolic protein to riboprobes containing the 3'-UTR of elastin but not to riboprobes either corresponding to other areas of the message or containing the 3'-UTR but lacking the region of secondary structure. Binding of cytosolic protein was particularly prominent in aortic extracts from 2-day old chickens, a time when elastin message is stable, as compared with 8- and 15-week old chickens, when the elastin message is relatively unstable, suggesting that this region of secondary structure may play a role in developmental regulation of stability of elastin mRNA.

Animals↗
PubMed2005

Differential mRNA stability to endogenous ribonucleases of the coding region and 3' untranslated regions of wheat (Triticum aestivum L.) manganese superoxide dismutase genes.

The sequences of the 3' untranslated region (UTR) of the manganese superoxide dismutase (MnSOD) genes in wheat (Triticum aestivum) were found to be quite variable with different predicted thermostabilities. The degradation rates of the 3' UTR variants and the coding region were measured following exposure to endogenous nucleases. The degradation rates of the 3' UTR variants for 15 min were not significantly different, meaning the degradation rates of the 3' UTR variants were not directly related to the thermostabilities. However, the degradation rate of the coding region was significantly faster than those of the 3' UTR variants. Further investigation revealed the coding region seemed to have specific sites for degradation, indicating a possibility of increasing MnSOD expression by the degradation site alteration.

3' Untranslated Regions↗
PubMed1996

Construction of cDNA library from liver RNA of heat shocked rats and DNA sequence analysis of the clone containing the 3'-end untranslated region (3'UTR) of the heat inducible gene hsp70.2.

cDNA library constructed from liver RNA of rats subjected to hyperthermia was used to isolate divergent 3' end untranslated regions (3'UTR) of heat inducible hsp70.1 and hsp70.2 genes. As a result of a double selection procedure with the use of DNA-DNA hybridization and PCR analysis 9 clones containing cDNA sequences derived from the 3'UTR of the hsp70.2 gene were selected. Nucleotide sequence of the cloned inserts was established and the Northern blot analysis was performed to identify the heat inducible transcript encoded by the hsp70.2 gene.

Animals↗
PubMed2000

In yeast, the 3' untranslated region or the presequence of ATM1 is required for the exclusive localization of its mRNA to the vicinity of mitochondria.

We isolated mitochondria from Saccharomyces cerevisiae to selectively study polysomes bound to the mitochondrial surface. The distribution of several mRNAs coding for mitochondrial proteins was examined in free and mitochondrion-bound polysomes. Some mRNAs exclusively localize to mitochondrion-bound polysomes, such as the ones coding for Atm1p, Cox10p, Tim44p, Atp2p, and Cot1p. In contrast, mRNAs encoding Cox6p, Cox5a, Aac1p, and Mir1p are found enriched in free cytoplasmic polysome fractions. Aac1p and Mir1p are transporters that lack cleavable presequences. Sequences required for mRNA asymmetric subcellular distribution were determined by analyzing the localization of reporter mRNAs containing the presequence coding region and/or the 3'-untranslated region (3'UTR) of ATM1, a gene encoding an ABC transporter of the mitochondrial inner membrane. Biochemical analyses of mitochondrion-bound polysomes and direct visualization of RNA localization in living yeast cells allowed us to demonstrate that either the presequence coding region or the 3'UTR of ATM1 is sufficient to allow the reporter mRNA to localize to the vicinity of the mitochondrion, independently of its translation. These data demonstrate that mRNA localization is one of the mechanisms used, in yeast, for segregating mitochondrial proteins.

3' Untranslated Regions↗
PubMed2001

Healthy mice with an altered c-myc gene: role of the 3' untranslated region revisited.

c-Myc is a protooncogene involved in the control of cellular proliferation, differentiation and apoptosis. Like many other early response genes, regulation of c-myc expression is mainly controlled at the level of mRNA stability. Multiple cis-acting destabilizing elements have been described that are located both in the protein-coding region and in the 3' untranslated region (3' UTR). However, it is not known when they function during development and whether they act as partly redundant or independent elements to regulate c-myc mRNA level of expression. To begin to address these questions, we created a series of c-myc alleles modified in the 3' UTR, using homologous recombination and the Cre/loxP system, and analysed the consequences of these modifications in ES cells and transgenic animals. We found that deletion of the complete 3' UTR, including runs of Us and AU-rich elements proposed, on the basis of cell-culture assays, to be involved in the control of c-myc mRNA stability, did not alter the steady-state level of c-myc mRNA in any of the various situations analysed in vivo. Moreover, mice homozygous for the 3' UTR-deleted gene were perfectly healthy and fertile. Our results therefore strongly suggest that the 3' UTR of c-myc mRNA does not play a major role in the developmental control of c-myc expression.

3' Untranslated Regions↗
PubMed1987

Unusual sequence conservation in the 5' and 3' untranslated regions of the sea urchin spec mRNAs.

The Spec1 and Spec2 mRNAs (Strongylocentrotus purpuratus ectoderm mRNAs) represent a small gene family that encodes 10-12 members of the troponin C superfamily of calcium-binding proteins. These mRNAs and proteins accumulate in the aboral (dorsal) ectoderm of sea urchin embryos and larvae. Using genomic and cDNA clones, we have compared the sequences of four Spec mRNAs: Spec1, Spec2a, Spec2c, and Spec2d. The mRNAs all have at least 120 bases of 5' untranslated leader, approximately 450 bases of open reading frame, and 900 bases (Spec1) or 1250 bases (Spec2a, 2c, 2d) of 3' untranslated trailer. Unexpectedly, when long stretches of 5' untranslated regions or 3' untranslated regions are compared to one another, they are found to be less divergent than the protein-coding regions. Comparing Spec2d, the most divergent member of the family, with the other Spec mRNAs shows that while the protein-coding regions are 60-62% matched, the untranslated regions are greater than 80% matched. Comparisons among Spec1, Spec2a, and Spec2c demonstrate similar but less dramatic conservation of untranslated regions. Our data imply that the Spec gene family has evolved differently from most gene families, with mutations accumulating most rapidly in intron regions, less rapidly in protein-coding regions, and least rapidly in 5' and 3' untranslated regions.

Animals↗
PubMed1992

Sequence of the gamma 2b membrane 3' untranslated region: polya site determination and comparison to the gamma 2a membrane 3' untranslated region.

We present here the nucleotide sequence of the gamma 2b membrane 3' untranslated region as well as approximately 443 nucleotides of 3' flanking sequence. Although this region contains two potential polyadenylation hexanucleotides AATAAA (located 1328 and 1407 nucleotides downstream of the last membrane exon), it appears that only the first site directs polyadenylation of the mature mRNA. The first AATAAA is followed by several sequences which may influence its relative strength: the region downstream of this AATAAA is 44% T-rich and contains a pair of CAYTG sequences (4/5 match) which overlap two sequences which have a 6/8 match to the sequence YGTGTTYY. These sequences have been found in proximity to a large number of 3' ends [Gil and Proudfoot, Cell 49, 399-406 (1987); McLauchlan et al., Nucl. Acids Res. 13, 1347-1368. (1985); Berget, Nature 309, 179-182 (1984)]. The AATAAA site at position 1407 is not flanked by a T- or GT-rich sequence and is followed by a single CAYTG sequence (4/5 match) and a single YGTGTTYY sequence (6/8 match). The region downstream of the second AATAAA site also contains a sequence which has an 8/12 match with a sequence found in all heavy chain secreted 3' untranslated regions [Kobrin et al., Molec. Cell. Biol. 6, 1687-1697 (1986)]. Consistent with sequence comparisons between other regions of these two genes, the gamma 2b sequence has striking homology with the gamma 2a 3' untranslated region. A notable difference between gamma 2b and gamma 2a is the absence of an extensive array of GAA, GA, GGAA, and GGA repeats from the gamma 2b sequence. The GA repeats are postulated to form a stem loop structure in the gamma 2a 3' untranslated region; gamma 2b then would be missing the 5' half of the stem. Interestingly, neither the gamma 2b nor the gamma 2a 3' untranslated regions show large homologies to the mu, delta, gamma 3, or the alpha membrane 3' untranslated regions.

Animals↗
PubMed2000

Vigilin binding selectively inhibits cleavage of the vitellogenin mRNA 3'-untranslated region by the mRNA endonuclease polysomal ribonuclease 1.

In Xenopus, estrogen induces the stabilization of vitellogenin mRNA and the destabilization of albumin mRNA. These processes correlate with increased polysomal activity of a sequence-selective mRNA endonuclease, PMR-1, and a hnRNP K homology-domain RNA-binding protein, vigilin. Vigilin binds to a region of the vitellogenin mRNA 3'-untranslated region (3'-UTR) implicated in estrogen-mediated stabilization. The vigilin-binding site in the vitellogenin B1 mRNA 3'-UTR contains two consensus PMR-1 cleavage sites. The availability of purified PMR-1 and recombinant vigilin made it possible to test the hypothesis that RNA-binding proteins interact with cis-acting elements to stabilize target mRNAs by blocking cleavage by site-specific mRNA endonucleases. Vigilin binds to the vitellogenin mRNA 3'-UTR site with at least 30-fold higher affinity than it exhibits for the albumin mRNA segment containing the mapped PMR-1 cleavage sites. This differential binding affinity correlates with differential in vitro susceptibility of the protein-RNA complexes to cleavage by PMR-1. Whereas recombinant vigilin has no detectable protective effect on PMR-1 cleavage of albumin mRNA, it retards in vitro cleavage of the vitellogenin mRNA 3'-UTR by purified PMR-1. The PMR-1 sites in the vitellogenin mRNA 3'-UTR are functional because they are readily cleaved in vitro by purified PMR-1. These results provide direct evidence for differential susceptibility to endonuclease-mediated mRNA decay resulting from the differential affinity of a RNA-binding protein for cis-acting stability determinants.

3' Untranslated Regions↗
PubMed2000

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability.

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.

3' Untranslated Regions↗
PubMed1994

Regulation of mammalian ribonucleotide reductase R1 mRNA stability is mediated by a ribonucleotide reductase R1 mRNA 3'-untranslated region cis-trans interaction through a protein kinase C-controlled pathway.

Ribonucleotide reductase catalyses the reaction that eventually provides the four deoxyribonucleotides required for the synthesis and repair of DNA. U.v.-cross-linking and band-shift experiments have identified in COS 7 monkey cells an approx. 57 kDa ribonucleotide reductase R1 mRNA-binding protein called R1BP, which binds specifically to a 49-nt region of the R1 mRNA 3'-untranslated region (3'UTR). The R1BP-RNA binding activity was down-regulated by the tumour promoters phorbol 12-myristate 13-acetate (PMA; 'TPA') and okadaic acid, and up-regulated by the protein kinase C inhibitor staurosporine, in a dose-dependent fashion. Furthermore, staurosporine treatment decreased the stability of R1 and CAT (chloramphenicol acetyltransferase)/R1 hybrid mRNAs, whereas PMA and okadaic acid increased the stability of these messages, in a dose-dependent manner. In contrast, treatment of cells with forskolin, a protein kinase A inhibitor, did not alter either R1BP-RNA binding or R1 mRNA-stability characteristics. Transfectants containing R1 or CAT/R1 cDNA constructs with a deletion of the 49-nt 3'UTR sequence failed to respond in message-stability studies to the effects of PMA, staurosporine or okadaic acid. These observations indicate that a protein kinase C signal pathway regulates ribonucleotide reductase R1 gene expression post-transcriptionally, through a mechanism involving a specific cis-trans interaction at a 49-nt region within the R1 mRNA 3'UTR.

3T3 Cells↗
PubMed2007

Triplet repeat in the Repin1 3'-untranslated region on rat chromosome 4 correlates with facets of the metabolic syndrome.

BACKGROUND: Congenic and subcongenic rat strains confirmed the quantitative trait loci (QTLs) for facets of the metabolic syndrome between 60.53 and 77.11 Mb on chromosome 4. The analysis of candidate genes in this region favoured the replication initiator 1 (Repin1) characterized by a SNP in the coding region and a triplet repeat (TTT) in the 3'-untranslated region (3'UTR). METHODS: We analysed nine rat strains (BB/OK, SHR, F344, BN, DA, LEW, hHTg, WOKW, and their founders WOK-F) and four wild rats on DNA (sequencing) and RNA level (gene expression in blood, liver, subcutaneous, and epididymal adipocytes). In addition, the rats were phenotypically characterized in order to link the rat phenotype to genotype differences in the QTL on chromosome 4. RESULTS: Wild rats were heterozygous for the SNP (C/T), whereas all the inbred strains were homozygous. The shortest triplet repeat was found in SHR (5) and the highest was found in hHTg and WOKW (11), which developed metabolic disorders. The repeat number correlated with most phenotypic traits studied. Using linear multiple regression analysis with repeat size as the dependent variable and considering all the data of this study, it was clearly demonstrated that not only VLDL cholesterol and serum insulin but also the expression of Repin1 in the liver is significantly associated with the repeat size of the 3'UTR. CONCLUSIONS: It is concluded that the triplet repeat expansion in 3'UTR is involved in metabolic alterations as found in hHTg and WOKW rats and that the functional unknown gene, Repin1, could be a novel candidate gene for the development of facets of the metabolic syndrome.

3' Untranslated Regions↗
PubMed2005

Distinct 3'-untranslated region elements regulate stage-specific mRNA accumulation and translation in Leishmania.

We recently characterized a large developmentally regulated gene family in Leishmania encoding the amastin surface proteins. While studying the regulation of these genes, we identified a region of 770 nucleotides (nt) within the 2055-nt 3'-untranslated region (3'-UTR) that regulates stage-specific gene expression at the level of translation. An intriguing feature of this 3'-UTR regulatory region is the presence of a approximately 450-nt element that is highly conserved among several Leishmania mRNAs. Here we show, using a luciferase reporter system and polysome profiling experiments, that the 450-nt element stimulates translation initiation of the amastin mRNA in response to heat shock, which is the main environmental change that the parasite encounters upon its entry into the mammalian host. Deletional analyses depicted a second region of approximately 100 nucleotides located at the 3'-end of several amastin transcripts, which also activates translation in response to elevated temperature. Both 3'-UTR regulatory elements act in an additive manner to stimulate amastin mRNA translation. In addition, we show that acidic pH encountered in the phagolysosomes of macrophages, the location of parasitic differentiation, triggers the accumulation of amastin transcripts by a distinct mechanism that is independent of the 450-nt and 100-nt elements. Overall, these important findings support the notion that stage-specific post-transcriptional regulation of the amastin mRNAs in Leishmania is complex and involves the coordination of distinct mechanisms controlling mRNA stability and translation that are independently triggered by key environmental signals inducing differentiation of the parasite within macrophages.

3' Untranslated Regions↗