Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Multienzyme Complexes”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,783 records · Page 99Linked to original sources
PubMed1999

Adult onset limb-girdle type mitochondrial myopathy with a mitochondrial DNA np8291 A-to-G substitution.

We analyzed mitochondrial DNA (mtDNA) from 7 patients in four families with adult onset limb-girdle type mitochondrial myopathy to clarify their genetic background. The patients, 2 men and 5 women, showed common clinical features, characterized by isolated skeletal myopathy, high serum creatine kinase level, ragged-red fibers and cytochrome c oxidase-defective fibers. Analysis of muscle biopsy specimens indicated that cytochrome c oxidase activity was decreased relative to that of citrate synthase in 5 of the 7 patients. Southern blotting and direct sequence analyses showed an A-to-G homoplasmic transition at np8291 and intergenic COII/tRNA (Lys) 9bp deletion in all patients. This substitution was detected in only 2 of 600 control individuals including healthy subjects and patients with other neuromuscular disorders; these 2 individuals had diabetes mellitus and myotonic dystrophy, respectively. Consequently, the mtDNA transition at np8291 was a rare polymorphism. However, the 7 patients we studied had identical clinical, pathological, biochemical, and genetic features. Therefore, limb-girdle type mitochondrial myopathy with this rare polymorphism may form a subgroup of adult onset mitochondrial myopathy.

Adult↗
PubMed1987

Rapid, quantitative microassay for the monokine respiration inhibitory factor.

The murine monokine respiration inhibitory factor (RIF) induces lesions at Complex I and Complex II of the mitochondrial electron transport chain (ETC) of tumor cells; these lesions in the ETC appear closely linked with cytostasis of the targets. In this report we describe the use of the sensitive murine mammary adenocarcinoma line EMT-6 in a colorimetric microassay for the effects of RIF on the ETC and target replication. The participation of cytolytic molecules in this assay system was excluded because of the resistance of the target to their effects. The endpoint for the assay was the ETC-mediated reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to its colored formazan. The two major coupling sites of MTT in the ETC of EMT-6 cells are shown to be proximal to Coenzyme Q, detected either by malate oxidation through Complex I or succinate oxidation through Complex II. The assay was sensitive to both RIF-induced lesions at these dehydrogenases and to the cytostasis-linked reduction in target cell number. The assessment of ETC lesions by this microassay correlated directly with that determined by the less sensitive polarimetric assay based on oxygen consumption. We demonstrate the application of this microassay to parameters for the production of RIF by activated murine macrophages, and to initial molecular characterization of this mediator.

Animals↗
PubMed1991

Multiple defects of the mitochondrial respiratory chain in a mitochondrial encephalopathy (MERRF): a clinical, biochemical and molecular study.

We describe a young man with a progressive neurological disorder including myoclonus, mental retardation, muscle weakness and a mitochondrial myopathy (myoclonus epilepsy and ragged red fibres--MERRF). Multiple abnormalities of the mitochondrial respiratory chain in skeletal muscle are shown by direct measurement of the flux through the individual complexes, low-temperature redox spectroscopy and decreased immunodetectable subunits of complexes I and IV by immunoblotting. No abnormality of mitochondrial DNA was found. This is the first report of combined defects of complexes I, III and IV as a cause of this clinical syndrome. However, we propose that the occurrence of multiple respiratory chain defects may be more common than previously recognised and that this particular combination of defects, involving complexes I, III and IV, may be the predominant biochemical abnormality in MERRF.

Adult↗
PubMed2006

Glucose metabolism and cancer.

The first identified biochemical hallmark of tumor cells was a shift in glucose metabolism from oxidative phosphorylation to aerobic glycolysis. We now know that much of this metabolic conversion is controlled by specific transcriptional programs. Recent studies suggest that activation of the hypoxia-inducible factor (HIF) is a common consequence of a wide variety of mutations underlying human cancer. HIF stimulates expression of glycolytic enzymes and decreases reliance on mitochondrial oxidative phosphorylation in tumor cells, which occurs even under aerobic conditions. In addition, recent efforts have also connected the master metabolic regulator AMP-activated protein kinase (AMPK) to several human tumor suppressors. Several promising therapeutic strategies based on modulation of AMPK, HIF and other metabolic targets have been proposed to exploit the addiction of tumor cells to increased glucose uptake and glycolysis.

AMP-Activated Protein Kinases↗
PubMed2005

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗
PubMed2000

Catalytic site forms and controls in ATP synthase catalysis.

A suggested minimal scheme for substrate binding by and interconversion of three forms of the catalytic sites of the ATP synthase is presented. Each binding change, that drives simultaneous interchange of the three catalytic site forms, requires a 120 degrees rotation of the gamma with respect to the beta subunits. The binding of substrate(s) at two catalytic sites is regarded as sufficing for near maximal catalytic rates to be attained. Although three sites do not need to be filled for rapid catalysis, during rapid bisite catalysis some enzyme may be transiently present with three sites filled. Forms with preferential binding for ADP and P(i) or for ATP are considered to arise from the transition state and participate in other steps of the catalysis. Intermediate forms and steps that may be involved are evaluated. Experimental evidence for energy-dependent steps and for control of coupling to proton translocation and transition state forms are reviewed. Impact of relevant past data on present understanding of catalytic events is considered. In synthesis a key step is suggested in which proton translocation begins to deform an open site so as to increase the affinity for ADP and P(i), that then bind and pass through the transition state, and yield tightly bound ATP in one binding change. ADP binding appears to be a key parameter controlling rotation during synthesis. In hydrolysis ATP binding to a loose site likely precedes any proton translocation, with proton movement occurring as the tight site form develops. Aspects needing further study are noted. Characteristics of the related MgADP inhibition of the F(1) ATPases that have undermined many observations are summarized, and relations of three-site filling to catalysis are assessed.

ATP Synthetase Complexes↗
PubMed2000

The epsilon subunit of bacterial and chloroplast F(1)F(0) ATPases. Structure, arrangement, and role of the epsilon subunit in energy coupling within the complex.

Recent studies show that the epsilon subunit of bacterial and chloroplast F(1)F(0) ATPases is a component of the central stalk that links the F(1) and F(0) parts. This subunit interacts with alpha, beta and gamma subunits of F(1) and the c subunit ring of F(0). Along with the gamma subunit, epsilon is a part of the rotor that couples events at the three catalytic sites sequentially with proton translocation through the F(0) part. Structural data on the epsilon subunit when separated from the complex and in situ are reviewed, and the functioning of this polypeptide in coupling within the ATP synthase is considered.

ATP Synthetase Complexes↗
PubMed2000

Important subunit interactions in the chloroplast ATP synthase.

General structural features of the chloroplast ATP synthase are summarized highlighting differences between the chloroplast enzyme and other ATP synthases. Much of the review is focused on the important interactions between the epsilon and gamma subunits of the chloroplast coupling factor 1 (CF(1)) which are involved in regulating the ATP hydrolytic activity of the enzyme and also in transferring energy from the membrane segment, chloroplast coupling factor 0 (CF(0)), to the catalytic sites on CF(1). A simple model is presented which summarizes properties of three known states of activation of the membrane-bound form of CF(1). The three states can be explained in terms of three different bound conformational states of the epsilon subunit. One of the three states, the fully active state, is only found in the membrane-bound form of CF(1). The lack of this state in the isolated form of CF(1), together with the confirmed presence of permanent asymmetry among the alpha, beta and gamma subunits of isolated CF(1), indicate that ATP hydrolysis by isolated CF(1) may involve only two of the three potential catalytic sites on the enzyme. Thus isolated CF(1) may be different from other F(1) enzymes in that it only operates on 'two cylinders' whereby the gamma subunit does not rotate through a full 360 degrees during the catalytic cycle. On the membrane in the presence of a light-induced proton gradient the enzyme assumes a conformation which may involve all three catalytic sites and a full 360 degrees rotation of gamma during catalysis.

ATP Synthetase Complexes↗
PubMed2000

Organisation of the yeast ATP synthase F(0):a study based on cysteine mutants, thiol modification and cross-linking reagents.

A topological study of the yeast ATP synthase membranous domain was undertaken by means of chemical modifications and cross-linking experiments on the wild-type complex and on mutated enzymes obtained by site-directed mutagenesis of genes encoding ATP synthase subunits. The modification by non-permeant maleimide reagents of the Cys-54 of mutated subunit 4 (subunit b), of the Cys-23 in the N-terminus of subunit 6 (subunit a) and of the Cys-91 in the C-terminus of mutated subunit f demonstrated their location in the mitochondrial intermembrane space. Near-neighbour relationships between subunits of the complex were demonstrated by means of homobifunctional and heterobifunctional reagents. Our data suggest interactions between the first transmembranous alpha-helix of subunit 6, the two hydrophobic segments of subunit 4 and the unique membrane-spanning segments of subunits i and f. The amino acid residue 174 of subunit 4 is close to both oscp and the beta-subunit, and the residue 209 is close to oscp. The dimerisation of subunit 4 in the membrane revealed that this component is located in the periphery of the enzyme and interacts with other ATP synthase complexes.

ATP Synthetase Complexes↗
PubMed2002

Inborn errors of complex II--unusual human mitochondrial diseases.

The succinate dehydrogenase consists of only four subunits, all nuclearly encoded, and is part of both the respiratory chain and the Krebs cycle. Mutations in the four genes encoding the subunits of the mitochondrial respiratory chain succinate dehydrogenase have been recently reported in human and shown to be associated with a wide spectrum of clinical presentations. Although a comparatively rare deficiency in human, molecularly defined succinate dehydrogenase deficiency has already been found to cause encephalomyopathy in childhood, optic atrophy or tumor in adulthood. Because none of the typical housekeeping genes encoding this respiratory chain complex is known to present tissue-specific isoforms, the tissue-specific involvement represents a quite intriguing question, which is mostly addressed in this review. A differential impairment of electron flow through the respiratory chain, handling of oxygen, and/or metabolic blockade possibly associated with defects in the different subunits that can be advocated to account for tissue-specific involvement is discussed.

Citric Acid Cycle↗