Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “sequences”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,729 records · Page 96Linked to original sources
PubMed1992

Selective detection of Mycoplasma fermentans by polymerase chain reaction and by using a nucleotide sequence within the insertion sequence-like element.

A new assay using the polymerase chain reaction to amplify a 206-nucleotide specific gene sequence within the insertion sequence-like element of Mycoplasma fermentans has been developed. The unique insertion sequence-like element exists in multiple copies in the M. fermentans genome. The assay selectively amplifies DNA from all strains of M. fermentans tested. In contrast, DNA from other species of human and nonhuman mycoplasmas, common tissue culture-contaminating mycoplasmas, and bacteria, as well as human, monkey, and mouse tissues do not produce the amplified DNA products specific for M. fermentans.

Animals↗
PubMed2002

Sequence diversity of Neisseria meningitidis 16S rRNA genes and use of 16S rRNA gene sequencing as a molecular subtyping tool.

We investigated the diversity of the primary sequences of 16S rRNA genes among Neisseria meningitidis strains (Men) and evaluated the use of this approach as a molecular subtyping tool. We aligned and compared a 1,417-bp fragment of the 16S rRNA gene from 264 Men strains of serogroups A, B, C, and Y (MenA, MenB, MenC, and MenY, respectively) isolated throughout the world over a 30-year period. Thirty-one positions of difference were found among 49 16S types: differences between types ranged from 1 to 14 positions (0.07 to 0.95%). 16S types and serogroups were highly associated; only 3 out 49 16S types were shared by two or more serogroups. We have identified 16S types that are exclusively associated with strains of certain hypervirulent clones: 16S type 5 with MenA subgroup III, 16S type 4 with the MenB electrophoretic type 5 (ET-5) complex, and 16S types 12 and 13 with MenC of the ET-37 complex. For MenC strains, 16S sequencing provided the highest sensitivity and specificity and the best overall association with the outbreak-related versus sporadic isolates when compared with pulsed-field gel electrophoresis, multilocus enzyme electrophoresis, and multilocus sequence typing. We demonstrated for the first time an unexpected diversity among 16S rRNA genes of Men strains, identified 16S types associated with well-defined hypervirulent clones, and showed the potential of this approach to rapidly identify virulent strains associated with outbreaks and/or an increased incidence of sporadic disease.

Bacterial Typing Techniques↗
PubMed1982

Nucleotide sequence of a cloned woodchuck hepatitis virus genome: comparison with the hepatitis B virus sequence.

The complete nucleotide sequence of a woodchuck hepatitis virus genome cloned in Escherichia coli was determined by the method of Maxam and Gilbert. This sequence was found to be 3,308 nucleotides long. Potential ATG initiator triplets and nonsense codons were identified and used to locate regions with a substantial coding capacity. A striking similarity was observed between the organization of human hepatitis B virus and woodchuck hepatitis virus. Nucleotide sequences of these open regions in the woodchuck virus were compared with corresponding regions present in hepatitis B virus. This allowed the location of four viral genes on the L strand and indicated the absence of protein coded by the S strand. Evolution rates of the various parts of the genome as well as of the four different proteins coded by hepatitis B virus and woodchuck hepatitis virus were compared. These results indicated that: (i) the core protein has evolved slightly less rapidly than the other proteins; and (ii) when a region of DNA codes for two different proteins, there is less freedom for the DNA to evolve and, moreover, one of the proteins can evolve more rapidly than the other. A hairpin structure, very well conserved in the two genomes, was located in the only region devoid of coding function, suggesting the location of the origin of replication of the viral DNA.

Amino Acid Sequence↗
PubMed1984

Nucleotide sequence of a cloned duck hepatitis B virus genome: comparison with woodchuck and human hepatitis B virus sequences.

The nucleotide sequence of an EcoRI duck hepatitis B virus (DHBV) clone was elucidated by using the Maxam and Gilbert method. This sequence, which is 3,021 nucleotides long, was compared with the two previously analyzed hepatitis B-like viruses (human and woodchuck). From this comparison, it was shown that DHBV is derived from an ancestor common to the two others but has a slightly different genomic organization. There was no intergenic region between genes 5 and 8, which were fused into a single open reading frame in DHBV. Genes for the surface and core proteins were assigned to open reading frames 7 and 5/8. Amino acid comparisons showed some structural relationship between gene 6 product and avian reverse transcriptase, suggesting either evolution from a common ancestor or convergence to some particular structure to fulfill a specific function. This should be correlated with the synthesis of an RNA intermediate during DNA replication. This is also taken as an argument in favor of the hypothesis that gene 6 codes for the DNA polymerase that is found within the virion. DNA sequence comparison also showed that the two mammalian hepatitis B viruses are more homologous to each other than they are to DHBV, indicating that DHBV starts to evolve on its own earlier than the two other viruses, as do birds compared with mammals. From this it is proposed that the viruses evolved in a fashion parallel to the species they infect.

Amino Acid Sequence↗
PubMed1986

Human parainfluenza type 3 virus hemagglutinin-neuraminidase glycoprotein: nucleotide sequence of mRNA and limited amino acid sequence of the purified protein.

The nucleotide sequence of mRNA for the hemagglutinin-neuraminidase (HN) protein of human parainfluenza type 3 virus obtained from the corresponding cDNA clone had a single long open reading frame encoding a putative protein of 64,254 daltons consisting of 572 amino acids. The deduced protein sequence was confirmed by limited N-terminal amino acid microsequencing of CNBr cleavage fragments of native HN that was purified by immunoprecipitation. The HN protein is moderately hydrophobic and has four potential sites (Asn-X-Ser/Thr) of N-glycosylation in the C-terminal half of the molecule. It is devoid of both the N-terminal signal sequence and the C-terminal membrane anchorage domain characteristic of the hemagglutinin of influenza virus and the fusion (F0) protein of the paramyxoviruses. Instead, it has a single prominent hydrophobic region capable of membrane insertion beginning at 32 residues from the N terminus. This N-terminal membrane insertion is similar to that of influenza virus neuraminidase and the recently reported structures of HN proteins of Sendai virus and simian virus 5.

Amino Acid Sequence↗
PubMed1990

Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.

Base Composition↗
PubMed1997

The composition of coding joints formed in V(D)J recombination is strongly affected by the nucleotide sequence of the coding ends and their relationship to the recombination signal sequences.

V(D)J recombination proceeds in two stages. Precise cleavage at the border of the conserved recombination signal sequences (RSSs) and the coding ends results in flush double-stranded signal ends and coding ends terminating in hairpins. In the second stage, the signal and coding ends are processed into signal and coding joints. Coding ends containing certain nucleotide homopolymers affect the efficiency of V(D)J recombination. In this study, we have tested the effect of small changes in coding-end nucleotide composition on the frequency of coding- and signal joint formation. Furthermore, we have determined the sequences of coding joints resulting from recombination of coding ends with different compositions. We found that the presence of two T nucleotides 5' of both RSSs, but not a single T, reduces the frequency of signal joint formation, i.e., interferes with the cleavage stage of V(D)J recombination. However, coding-joint processing is sensitive even to a single T. Both the sequence of the coding ends and the particular RSS (12-mer or 23-mer) with which the coding end is associated affect the final composition of the coding joints. Thus, the presence of P nucleotides, the conservation of one undeleted coding end, the formation of joints without any deletions, and the template-dependent insertion of nucleotides are strongly influenced by the coding-end nucleotide composition and/or RSS association. The implications of these results with respect to the processing of coding ends are discussed.

Animals↗
PubMed2003

ProSplicer: a database of putative alternative splicing information derived from protein, mRNA and expressed sequence tag sequence data.

ProSplicer is a database of putative alternative splicing information derived from the alignment of proteins, mRNA sequences and expressed sequence tags (ESTs) against human genomic DNA sequences. Proteins, mRNA and ESTs provide valuable evidence that can reveal splice variants of genes. The alternative splicing information in the database can help users investigate the alternative splicing and tissue-specific expression of genes.

Alternative Splicing↗
PubMed1992

The 10 S BC-1 ribonucleoprotein particle contains identifier sequence-binding proteins that interact with an array of GCAAG/CTTGC motifs between split promoter sequences for RNA polymerase III.

BC-1 RNA is a brain-specific small RNA transcript of identifier sequences present in the somas and dendrites of neurons. We recently reported that the RNA is complexed with a protein(s) to form a 10 S ribonucleoprotein particle (Kobayashi, S., Goto, S., and Anzai, K. (1991) J. Biol. Chem. 266, 4726-4730). We demonstrate here that this 10 S BC-1 ribonucleoprotein particle contains a DNA-binding protein(s) (Bp-1 protein) capable of interacting with a region between split promoter sequences for RNA polymerase III within the identifier sequences. The region has short inverted repeats: a perfect octanucleotide repeat (GCGCTTGCCTAGCAAGCGC) and an imperfect heptanucleotide repeat (GCCTAGCAAGCGCAAGGC), each of which contains a GCAAG/CTTGC motif. We also demonstrate that the binding of this protein either to the array of pentamer motifs or to BC-1 RNA is mutually exclusive. The molecular masses of photo-cross-linking adducts of Bp-1 protein to a 32P-labeled GCAAG/CTTGC motif-specific probe were estimated to be about 31 and 36 kDa, indicating that two species of Bp-1 proteins may be present in the brain.

Animals↗
PubMed1992

cDNA sequencing confirms HTLV-I expression in adult T-cell leukemia/lymphoma and different sequence variations in vivo and in vitro.

Human T-lymphotropic virus type I (HTLV-I) is the etiological agent of adult T-cell leukemia/lymphoma (ATL) and of tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). In both diseases, expression of viral message can generally only be demonstrated by the reverse transcriptase-polymerase chain reaction (RT-PCR) technique. We have previously reported on the the expression of at least four types of alternatively spliced pX mRNAs in vitro and in vivo (1). The sequence variation between HTLV-I pX cDNAs cloned from two different HTLV-I-infected cell lines and from uncultured primary peripheral blood mononuclear cells (PBMC) from two ATL patients was examined. None of the cDNA clones from one of the ATL samples was completely identical to any of the previously cloned cell line messages, establishing that the demonstration of HTLV-I mRNA in ATL is not the result of PCR contamination. Sequence analysis showed that differences between samples can be clustered according to their geographic origin. Cell line cDNAs showed a more marked sequence drift than ATL cDNAs, especially in the long terminal repeat (LTR), demonstrating association of intrastrain variability with culture in vitro. Intrastrain cDNA variability in vivo also suggests ongoing viral replication in infected individuals. A premature stop codon in the pX-II open reading frame (orf) was a common finding, suggesting that the complete putative pX-II protein is not essential for T-cell immortalization or HTLV-I replication.

Base Sequence↗
PubMed1985

The amino acid sequence of a crystal protein from Bacillus thuringiensis deduced from the DNA base sequence.

We have determined the nucleotide sequence of a 4222-base segment of DNA which contains the promoter, the coding region, and the terminator of a crystal protein gene cloned from a Bacillus thuringiensis plasmid. A sequence of 1176 amino acids encoding a Mr 133,500 peptide was deduced from the single open reading frame. This protein-coding region was analyzed for codon usage, predicted hydropathy, and predicted secondary structure. Examination of the base sequence revealed the presence of several inverted and direct repeats located in both the coding and noncoding regions. S1 nuclease mapping was used to locate the transcription termination point at a site following a potentially very stable stem-and-loop structure.

Amino Acid Sequence↗
PubMed1987

The primary structure of rat ribosomal protein L19. A determination from the sequence of nucleotides in a cDNA and from the sequence of amino acids in the protein.

The covalent structure of rat ribosomal protein L19 was inferred from the sequence of nucleotides in a recombinant cDNA and confirmed from the sequence of amino acids in a portion of the protein. Ribosomal protein L19 contains 196 amino acids and has a molecular weight of 26,971. There are indications that a segment of 23 residues in rat L19 is related to sequences of the same length in Escherichia coli ribosomal proteins L30, L18, and S2.

Amino Acid Sequence↗
PubMed1983

A family of repeated DNA sequences, one of which resides in the second intervening sequence of the mouse dihydrofolate reductase gene.

One member of a repeated sequence family has been found in the second intron of the mouse dihydrofolate reductase gene. The family consists of approximately 20 members/haploid genome, two of which have been sequenced and found to contain a 480-base pair region of homology with a significant amount of sequence divergence. Rat, Chinese hamster, Syrian hamster, and human DNAs contain homologous repetitious elements, and the four rodent species have a member of this family associated with the dihydrofolate reductase gene.

Animals↗
PubMed1982

Molecular cloning and sequence analysis of highly repetitive DNA sequences contained in the eliminated genome of Ascaris lumbricoides.

High molecular weight DNA from germ line and somatic cells of the DNA eliminating nematode Ascaris lumbricoides has has been isolated and digested with different restriction enzymes. The resulting DNA fragments were separated by agarose gel electrophoresis. Germ line but not somatic DNA shows a prominent band about 120 bp long as well as multiples of that length. These fragments are shown to be monomers and multimers of a highly repetitive satellite DNA, which is eliminated mostly but not completely during the process of chromatin diminution. Restriction digests, hybridization experiments and sequence analysis revealed that this eliminated satellite is composed of a whole set of different but related variant classes, all of them showing the same repeating unit length of about 120 bp. Members of the same variant class are tandemly linked and therefore physically separated from other variant classes. All satellite sequences can be derived from the same common ancestor sequence, differing only by base substitutions, insertions and deletions. There is no evidence for transcription of satellite DNA at any stage and tissues analyzed.

Animals↗
PubMedDate not supplied

[Reconstruction of a sequenced sequence using results of stacked hybridization with an oligonucleotide matrix].

The efficiency of additional rounds of continuous stacking hybridization in DNA sequence reconstruction by hybridization with oligonucleotide matrix (SHOM) is considered. At first, DNA is hybridized with a matrix of oligonucleotides of the length L. The overlapping of the tuples which have formed perfect duplexes with the DNA, on the one hand, has enabled us to reconstruct unambiguously a part of the sequence, and on the other hand, suggested a modified scheme for reconstructing the remaining part. Then the additional hybridizations should be carried out in the presence of shorter oligonucleotides of the length l, that are able to form perfect duplexes of the length L + l in continuous hybridization closely to matrix tuples. In this case the stability of a duplex consisting of l-tuples and long DNA is enhanced due to stacking interaction. The information obtained about the succession of L + l sites considerably increases the efficiency of reconstruction, which can eventually reach the efficiency of a matrix consisting of (L + l)-tuples. We propose here an algorithm for compiling such a set of l-tuples to be added that the number of additional hybridizations can be appreciably diminished. For an octanucleotide matrix and different sets of pentanucleotides to be used for continuous stacking hybridization, the length of unambiguously sequenced DNA undergoes a rise from 200 to some thousands bp.

Base Sequence↗
PubMed1998

Sequence determinants of DNA binding by the hematopoietic helix-loop-helix transcription factor TAL1: importance of sequences flanking the E-box core.

TAL1 is a helix-loop-helix transcription factor that is essential for hematopoiesis. In vitro DNA binding site selection experiments have previously identified the preferred binding site for TAL1 heterodimers as AACAGATGGT. TAL1 homodimers do not bind DNA with significant affinity. A subset of other E-box sequences is also bound by TAL1 heterodimers. Here, we present an analysis of TAL1 heterodimer DNA binding specificity, using E-boxes derived from genomic clones, which were isolated by immunoadsorption of K562 erythroleukemia cell chromatin with a TAL1 antibody. We show that TAL1 heterodimer binding to a CAGATG E-box is strongly modulated by nucleotides flanking the E-box. A 10 base pair element consisting of the CAGATG E-box and two flanking nucleotides in both the 5' and 3' direction is sufficient for high-affinity binding. Certain mutations of nucleotides in either the 5' (-1 and -2) or 3' (+1 and +2) direction strongly inhibit binding. The importance of flanking nucleotides also exists in the context of nonpreferred E-boxes recognized by TAL1 heterodimers. Although there are no known target genes for TAL1, the regulatory regions of several genes involved in hematopoiesis contain the preferred E-box CAGATG. However, based on our results, the E-boxes in these potential target genes contain flanking sequences that would be expected to significantly reduce TAL1 heterodimer binding in vitro. Thus, additional stabilizing forces, such as protein-protein interactions between TAL1 heterodimers and accessory factors, may be required to confer high-affinity TAL1 heterodimer binding to such sequences.

Animals↗
PubMed2006

The complete chloroplast genome sequences of Solanum tuberosum and comparative analysis with Solanaceae species identified the presence of a 241-bp deletion in cultivated potato chloroplast DNA sequence.

The complete nucleotide sequence of the chloroplast genome of potato Solanum tuberosum L. cv. Desiree was determined. The circular double-stranded DNA, which consists of 155,312 bp, contains a pair of inverted repeat regions (IRa, IRb) of 25,595 bp each. The inverted repeat regions are separated by small and large single copy regions of 18,373 and 85,749 bp, respectively. The genome contains 79 proteins, 30 tRNAs, 4 rRNAs, and unidentified genes. A comparison of chloroplast genomes of seven Solanaceae species revealed that the gene content and their relative positions of S. tuberosum are similar to the other six Solanaceae species. However, undefined open reading frames (ORFs) in LSC region were highly diverged in Solanaceae species except N. sylvestris. Detailed comparison was identified by numerous indels in the intergenic regions that were mostly located in the LSC region. Among them, a single large 241-bp deletion, was not associated with direct repeats and found in only S. tuberosum, clearly discriminates a cultivated potato from wild potato species Solanum bulbocastanum. The extent of sequence divergence may provide the basis for evaluating genetic diversity within the Solanaceae species, and will be useful to examine the evolutionary processes in potato landraces.

Agriculture↗
PubMed1999

The Corynebacterium glutamicum insertion sequence ISCg2 prefers conserved target sequences located adjacent to genes involved in aspartate and glutamate metabolism.

An IS element, termed ISCg2, was identified in the chromosome of Corynebacterium glutamicum ATCC 13032. After screening a cosmid library of the C. glutamicum ATCC 13032 genome, six copies of ISCg2 including their flanking regions were sequenced and analyzed. ISCg2 is 1636 bp in length and has 26-bp imperfect inverted repeats flanked by 3-bp direct repeats. By comparisons with other IS elements, ISCg2 was classified as a member of the IS30 family of insertion sequences. The six copies of ISCg2 were identical at the nucleotide level and were located in intergenic, AT-rich regions of the chromosome. The regions in which the six copies of ISCg2 were inserted displayed significant similarities. This similarity extends over a region of 65 bp, which was assumed to be the target region for ISCg2. Interestingly, five of the six copies of ISCg2 were located adjacent to genes that may be involved in aspartate and glutamate metabolism or its regulation. Investigation of the distribution of ISCg2 showed that the IS element is restricted to certain C. glutamicum strains. Analysis of various integration regions indicates active transposition of ISCg2 in C. glutamicum.

Amino Acid Sequence↗