Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “inverted terminal repeat”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,729 records · Page 96Linked to original sources
PubMed1993

A deletion mutant of the type IC restriction endonuclease EcoR1241 expressing a novel DNA specificity.

We have developed a complementation assay which allows us to distinguish between mutations affecting subunit assembly and mutations affecting DNA binding in the DNA recognition subunit (HsdS) of the multimeric restriction endonuclease EcoR1241. A number of random point mutations were constructed to test the validity of this assay. Two of the mutants produced were found to be truncated polypeptides that were still capable of complementation with the EcoR1241 Hsd subunits to give an active restriction enzyme of novel DNA specificity. The N-terminal variable domain (responsible for recognition of GAA from the EcoR1241 recognition sequence GAAnnnnnnRTCG) and the spacer region (central conserved region) is intact in both of these mutants. One of these mutant genes (hsdS(delta 50) has been cloned as an active Mtase. Purification of the Mtase proved to be difficult because the complex is weak. However, Mtase activity was obtained from a soluble cell extract, and this allowed us to determine the DNA recognition sequence of the Mtase to be GAAnnnnnnnTTC. This recognition sequence is an inverted repeat of 5'-end of the EcoR1241 recognition sequence. This suggests that the mutant Mtase is assembled from two inverted HsdS(D50) subunits, possibly held together by the HsdM subunits.

Amino Acid Sequence↗
PubMed1986

Sequence organization in African trypanosome minicircles is defined by 18 base pair inverted repeats.

We have found that minicircles of African trypanosomes contain 18 base pair sequences that occur as 3 or 4 pairs of imperfect inverted repeats. The 18 base pair sequence is polar; one half is almost perfectly conserved, while the other half has a more variable sequence. The distribution of the 18 base pair sequences in minicircles defines two classes of sequences ('A' and 'B' segments) that have distinct characteristics. 'A' segments vary considerably in length and contain about 10% more G+C than 'B' segments which are all about 100 base pairs long. The 18 base pair sequences are absent from minicircles of other kinetoplastids. Thus, 'B' segments along with their terminal 18 base pair sequences superficially resemble insertion sequences. Minicircles of African trypanosomes therefore conserve their organization but have only limited nucleotide sequence homology.

Animals↗
PubMed1997

Transcriptional analysis of the groESL operon of Neisseria gonorrhoeae.

The nucleotide sequence upstream of the groEL gene of Neisseria gonorrhoeae has been determined. Upstream of groEL is a homolog of groES and the divergently transcribed frpB gene. The promoter region of groES lacks the inverted repeat sequences (IR) that act as a regulatory element controlling the expression of similar operons in many other bacterial species. This region contains overlapping consensus sequences for sigma 32-dependent and sigma 70-dependent promoters, and an appropriately placed transcription start point was mapped downstream of these promoters. Northern hybridization demonstrated that synthesis of a full-length groES-groEL transcript was induced in heat-stressed cells. These experiments also revealed the presence of a shorter groES-specific transcript, apparently the result of the premature termination of transcription at an IR situated between the groES and groEL genes.

Amino Acid Sequence↗
PubMed2005

TraA and its N-terminal relaxase domain of the Gram-positive plasmid pIP501 show specific oriT binding and behave as dimers in solution.

TraA is the DNA relaxase encoded by the broad-host-range Grampositive plasmid pIP501. It is the second relaxase to be characterized from plasmids originating from Gram-positive organisms. Full-length TraA (654 amino acids) and the N-terminal domain (246 amino acids), termed TraAN246, were expressed as 6xHis-tagged fusions and purified. Small-angle X-ray scattering and chemical cross-linking proved that TraAN246 and TraA form dimers in solution. Both proteins revealed oriTpIP501 (origin of transfer of pIP501) cleavage activity on supercoiled plasmid DNA in vitro. oriT binding was demonstrated by electrophoretic mobility shift assays. Radiolabelled oligonucleotides covering different parts of oriTpIP501 were subjected to binding with TraA and TraAN246. The KD of the protein-DNA complex encompassing the inverted repeat, the nick site and an additional 7 bases was found to be 55 nM for TraA and 26 nM for TraAN246. The unfolding of both protein constructs was monitored by measuring the change in the CD signal at 220 nm upon temperature change. The unfolding transition of both proteins occurred at approx. 42 degrees C. CD spectra measured at 20 degrees C showed 30% a-helix and 13% b-sheet for TraA, and 27% alpha-helix and 18% beta-sheet content for the truncated protein. Upon DNA binding, an enhanced secondary structure content and increased thermal stability were observed for the TraAN246 protein, suggesting an induced-fit mechanism for the formation of the specific relaxase-oriT complex.

Base Sequence↗
PubMed2002

Strategies for the isolation and detection of fetal cells in transcervical samples.

OBJECTIVE: The aim of the study was to evaluate the detection of fetal cells from transcervical samples, collected in early pregnancy, by means of different molecular techniques. The value of the isolation of trophoblasts using an inverted microscope, also referred to as micromanipulation, is discussed. METHODS: All the 89 specimens were obtained by intrauterine lavages before termination of pregnancy (TOP), between 7 and 12 weeks of gestation. Micromanipulation was carried out in a subgroup of 57 for the isolation of fetal material. Fetal sexing was achieved by FISH (fluorescent in situ hybridisation) using fluorescently labelled probes for X and Y chromosomes and by polymerase chain reaction (PCR). Male samples were also investigated for aneuploidy of the chromosome 21. Quantitative fluorescent (QF)-PCR using two short tandem repeat (STR) markers for chromosome 21 was carried out in 26 micromanipulated samples. RESULTS: FISH analysis revealed that 45/89 placental samples derived from pregnancies with male fetuses. Correct sexing of the lavage samples from male pregnancies was achieved in 41/45 (91%) using dual-FISH technique, and in 43/45 (95.5%) with PCR. All the samples derived from male pregnancies tested for chromosome 21 were normal. From 57 samples subjected to micromanipulation, 51 (89.5%) showed discernible chorionic villous filaments or cell clumps of possible trophoblastic origin. One case of tetraploidy and two cases of monosomy were recorded. The rate of fetal cells, in the non-micromanipulated samples, was between 4% and 97% (mean 54.3%). In micromanipulated specimens, maternal contaminant cells were absent or extremely rare (1-2%). The efficiency of the QF-PCR analysis in detecting paternal peaks in all lavage samples was only 61.5%. CONCLUSION: The present study confirms the presence of fetal cells in a very high proportion of both whole and micromanipulated intrauterine lavage samples. The isolation of trophoblastic elements can be achieved in most cases by micromanipulation. FISH and PCR techniques allowed the analysis of the most common fetal aneuploidies, confirming the power of this minimally invasive method.

Adult↗
PubMed1984

Structural organization of the ori site of phage P22; comparison with other lambdoid ori sites.

The homologous DNA regions of phages P22, lambda and lambdoid coliphages, which code for the amino-terminal portion of genes 18 or O, contain the ori signal. Both the lambdoid and P22 ori regions can be divided into sections, A, B and C. The four direct repeats with internal rotational symmetry of section A in P22 are less regularly organized than in the corresponding signals of the phi 80 and lambda ori sites and show greatest homology to coliphage phi 82. Section B is rich in adenines in the l strand, and section C can be recognized in the P22 ori by the occurrence of overlapping inverted repeats. The latter region is not homologous to the structurally similar section C, 'EcoRI-loop', of the lambdoid coliphages. The results further define the specificity determinants of lambdoid O protein-ori interactions and demonstrate the evolutionary relationship between these functional units.

Amino Acid Sequence↗
PubMed2003

The genes coding for enterocin EJ97 production by Enterococcus faecalis EJ97 are located on a conjugative plasmid.

Enterococcus faecalis EJ97 produces a cationic bacteriocin (enterocin EJ97) of low molecular mass (5,327.7 Da). The complete amino acid sequence of enterocin EJ97 was elucidated after automated microsequencing of oligopeptides generated by endoproteinase GluC digestion and cyanogen bromide treatment. Transfer of the 60-kb conjugative plasmid pEJ97 from the bacteriocinogenic strain E. faecalis EJ97 to E. faecalis OG1X conferred bacteriocin production and resistance on the recipient. The genetic determinants of enterocin EJ97 were located in an 11.3-kb EcoRI-BglII DNA fragment of pEJ97. This region was cloned and sequenced. It contains the ej97A structural gene plus three open reading frames (ORFs) (ej97B, ej97C, and ej97D) and three putative ORFs transcribed in the opposite direction (orfA, orfB, and orfC). The gene ej97A translated as a 44-amino-acid residue mature protein lacking a leader peptide with no homology to other bacteriocins described so far. The product of ej97B (Ej97B) shows strong homology in its C-terminal domain to the superfamily of bacterial ATP-binding cassette transporters. The products of ej97C (Ej97C) and ej97D (Ej97D) could be proteins with 71 and 64 residues, respectively, of unknown functions and with no significant similarity to known proteins. There are two additional ORFs (ORF1 and ORF6) flanking the ej97 module, which have been identified as a transposon-like structure (tnp). ORF1 shows similarities to transposase of the Lactococcus lactis element ISS1 and is up to 50% identical to IS1216. This is flanked by two 18-bp inverted repeats (IRs) that are almost identical to those of ISS1 and IS1216. ORF6 (resEJ97) shows strong homology to the resolvase of plasmid pAM373 and up to 40 to 50% homology with the recombinase of several multiresistant plasmids and transposons from Staphylococcus aureus and E. faecalis. These data suggest that EJ97 could represent a new class of bacteriocins with a novel secretion mechanism and that the whole structure could be a composite transposon. Furthermore, two additional gene clusters were found: one cluster is probably related to the region responsible for the replication of plasmid pEJ97, and the second cluster is related to the sex pheromone response. These regions showed a high homology to the corresponding regions of the conjugative plasmids pAM373, pPD1, and pAD1 of E. faecalis, suggesting that they have a common origin.

Amino Acid Sequence↗
PubMed1987

Structure of the rat platelet factor 4 gene: a marker for megakaryocyte differentiation.

A rat platelet factor 4 (PF4) cDNA has been isolated by immunoscreening a g lambda 11 rat megakaryocyte cDNA expression library. Sequence analysis of the rat PF4 cDNA revealed that this megakaryocyte protein is composed of a leader sequence of 29 amino acid residues and a mature protein sequence of 76 amino acid residues. The structure of rat PF4 derived from its cDNA shows a marked homology with the amino acid sequence of human PF4 obtained by classical protein chemistry techniques. This observation is particularly striking with regard to the carboxy-terminal region of rat and human PF4, where 28 of the last 31 C-terminal residues are identical. The rat PF4 gene was obtained from a rat genomic library by using rat PF4 cDNA as a hybridization probe. Sequence analysis showed that the gene is constructed of three exons and two short introns. The transcriptional start site is located 73 base pairs upstream of the translational start codon as judged by S1 nuclease mapping and primer extension. The 5' noncoding region of the gene also exhibited a sequence homologous to the TATA box at -31, as well as a series of direct and inverted repeat sequences and a cluster of 26 T residues at -155 to -218. This latter domain may be involved in regulating PF4 gene expression during megakaryocytopoiesis.

Animals↗
PubMed1996

The herpes simplex virus type 1 UL6 protein is essential for cleavage and packaging but not for genomic inversion.

The HSV-1 genome is composed of two unique regions (UL and US) flanked by inverted repeats. During the course of DNA replication the two unique regions UL and US invert relative to one another. In this report we present evidence that cleavage is not necessary for genomic inversion to occur. We isolated and characterized a UL6::lacZ insertion mutant (hr74) that produces wild-type levels of replicating viral DNA but fails to cleave and package DNA. We demonstrate that this virus is still able to undergo genomic inversion. Furthermore we confirm that replicating DNA from cells infected with wild-type virus contains specific UL terminal but not US termini, whereas cells infected with the mutant hr74 do not contain either US or UL termini. This demonstrates that the specific UL ends found in replicating DNA are the result of the cleavage/packaging process.

Animals↗
PubMed1995

Structure and function of Tn5467, a Tn21-like transposon located on the Thiobacillus ferrooxidans broad-host-range plasmid pTF-FC2.

A 3.5-kb region of plasmid pTF-FC2, which contains a transposon-like element designated Tn5467, has been sequenced, and its biological activity has been investigated. The transposon is bordered by two 38-bp inverted repeat sequences which have sequence identity in 37 of 38 and in 38 of 39 bp to the tnpA distal and tnpA proximal inverted repeats of Tn21, respectively. Within these borders, open reading frames with amino acid similarity to a glutaredoxin-like protein, a MerR regulatory protein, and a multidrug-resistant-membrane transport-like protein were found. The gene for the glutaredoxin-like protein was expressed in Escherichia coli and enabled growth of a glutathione-requiring E. coli trxA gshA mutant on minimal medium and the reduction of methionine sulfoxide to methionine. In addition, there were two regions which, when translated, had homology to 85% of the N-terminal region of the Tn21 resolvase (tnpR) and to 15% of the C terminus of the Tn21 transposase (tnpA). A region containing res-like sites was located immediately upstream of the partial tnpR gene. Neither the partial transposase nor the resolvase genes of Tn5467 were biologically active, but Tn5467 was transposed and resolved when the Tn21 transposase and resolvase were provided in trans. Tn5467 appears to be a defective transposon which belongs to the Tn21 subgroup of the Tn3 family.

Amino Acid Sequence↗
PubMed2002

Diversity of Tn4001 transposition products: the flanking IS256 elements can form tandem dimers and IS circles.

We show that both flanking IS256 elements carried by transposon Tn4001 are capable of generating head-to-tail tandem copies and free circular forms, implying that both are active. Our results suggest that the tandem structures arise from dimeric copies of the donor or vector plasmid present in the population by a mechanism in which an IS256 belonging to one Tn4001 copy attacks an IS256 end carried by the second Tn4001 copy. The resulting structures carry abutted left (inverted left repeat [IRL]) and right (inverted right repeat [IRR]) IS256 ends. Examination of the junction sequence suggested that it may form a relatively good promoter capable of driving transposase synthesis in Escherichia coli. This behavior resembles that of an increasing number of bacterial insertion sequences which generate integrative junctions as part of the transposition cycle. Sequence analysis of the IRL-IRR junctions demonstrated that attack of one end by the other is largely oriented (IRL attacks IRR). Our experiments also defined the functional tips of IS256 as the tips predicted from sequence alignments, confirming that the terminal 4 bp at each end are indeed different. The appearance of these multiple plasmid and transposon forms indicates that care should be exercised when Tn4001 is used in transposition mutagenesis. This is especially true when it is used with naturally transformable hosts, such as Streptococcus pneumoniae, in which reconstitution of the donor plasmid may select for higher-order multimers.

DNA Transposable Elements↗
PubMed1993

Characterization of the binding sites of two proteins involved in the bacteriophage P2 site-specific recombination system.

Integration of the bacteriophage P2 genome into the Escherichia coli host chromosome occurs by site-specific recombination between the phage attP and E. coli attB sites. The phage-encoded 38-kDa protein, integrase, is known to be necessary for both phage integration as well as excision. In order to begin the molecular characterization of this recombination event, we have cloned the int gene and overproduced and partially purified the Int protein and an N-terminal truncated form of Int. Both the wild-type Int protein and the integration host factor (IHF) of E. coli were required to mediate integrative recombination in vitro between a supercoiled attP plasmid and a linear attB substrate. Footprint experiments revealed one Int-protected region on both of the attP arms, each containing direct repeats of the consensus sequence TGTGGACA. The common core sequences at attP and attB were also protected by Int from nuclease digestion, and these contained a different consensus sequence, AA T/A T/A C/A T/G CCC, arranged as inverted repeats at each core. A single IHF-protected site was located on the P (left) arm, placed between the core- and P arm-binding site for Int. Cooperative binding by Int and IHF to the attP region was demonstrated with band-shift assays and footprinting studies. Our data support the existence of two DNA-binding domains on Int, having unrelated sequence specificities. We propose that P2 Int, IHF, attP, and attB assemble in a higher-order complex, or intasome, prior to site-specific integrative recombination analogous to that formed during lambda integration.

Bacterial Proteins↗
PubMed2002

Growth phase-dependent regulation of target gene promoters for binding of the essential orphan response regulator HP1043 of Helicobacter pylori.

Helicobacter pylori encodes three two-component systems and two orphan response regulators (RRs) that are predicted to be involved in transcriptional regulation. The HP1043 gene encodes an essential OmpR-like RR, 1043RR, for which no histidine kinase has been identified. Gel filtration and cross-linking experiments on the purified 1043RR protein reveals that this protein is a dimer and in vivo dimerization assays localize the dimerization to the N-terminal regulatory domain. DNA-binding studies have revealed two targets for specific binding of the 1043RR protein and moreover, phosphorylation of the protein was not needed for the activation of binding. Footprinting analysis demonstrated that the 1043RR protein binds to its own promoter, P(1043), overlapping the -35 promoter element from positions -17 to -45, suggesting that this protein is autoregulatory. In addition, it binds at a similar location, spanning nucleotides from positions -22 to -51 at the promoter of the methyl-accepting chemotaxis tlpB gene, P(tlpB). A possible inverted repeat was identified in the binding sites of both promoters. In an attempt to overexpress 1043RR in H. pylori, the 10-fold induction in transcription of a second copy of HP1043 with use of an inducible promoter failed to increase cellular levels of the RR protein, suggesting that 1043RR is tightly regulated at a posttranscriptional level. The P(1043) and P(tlpB) promoters were demonstrated to be coordinately regulated in response to growth phase in H. pylori. The essential role of HP1043 in encoding a cell cycle regulator is discussed.

Bacterial Proteins↗
PubMed1999

Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.

Carcinoma, Non-Small-Cell Lung↗
PubMed1994

Forced integration of Moloney murine leukemia virus DNA with a mutant integration site occurs through recombination with VL30 DNA.

The integration of retroviral DNA to form the provirus requires the presence of short inverted repeat sequences at the termini of the linear viral DNA. We have previously described the construction of a mutant of Moloney murine leukemia virus, carrying an 8-bp deletion in the U5 terminus, that is defective in establishing the integrated provirus. We have now used a selectable marker to allow recovery of rare proviruses formed after transduction from NIH/3T3 cells by retroviral vectors carrying this mutation. Analysis of two such proviruses showed that both were recombinants between the vector and VL30 DNA and arose such that the VL30 sequences could provide an intact terminal sequence for integration.

3T3 Cells↗
PubMed1988

Sham drinking of glucose solutions in rats: some effects of hydration.

Sham-drinking patterns were observed in rats with oesophageal fistulae and gastric cannulae. In rats both food- and water-deprived at test, first-session sham intake was an inverted U-shaped function of glucose concentration (the preference-aversion pattern). Sham intake at low and high extremes rose with repeated exposure, so that the function flattened. When the rats were hydrated by a gastric water preload, sham intake of glucose at low concentrations was much reduced, whereas sham intake at high concentrations was little affected, so that the function became monotonic increasing. This time sham intake rose with repeated testing at high concentrations, but not low ones, so that the function steepenned. At low concentrations, the low sham intakes reflected a rapid termination of the sham-drinking bout. This does not reflect a delayed effect of the gastric water load, for introducing a further delay between load and drinking test did not enhance the effect. Finally, an intragastric load of isotonic NaCl was less effective than water in suppressing sham drinking, just as it is less effective in inhibiting thirst. We conclude: (1) sham drinking is terminated by an accumulation of orosensory feedback; and (2) the taste presented to the mouth, and the animal's hydrational status, jointly determine the amount of such feedback that is necessary to end the ingestive bout.

Animals↗
PubMed1987

A genomic clone containing the promoter for the gene encoding the human lysosomal enzyme, alpha-galactosidase A.

We have isolated and characterized a human genomic clone for a lysosomal enzyme gene. The start point of transcription was identified using primer extension of poly(A)+ mRNA. This genomic clone is specific for human alpha-galactosidase A, and it includes sequences for the promoter, complete signal peptide, first exon, and part of the first intron. Direct and inverted repeat elements of 10, 11, 16, 19, and 22 nucleotides (nt) flank the promoter site. A (GA)n repeat element of approx. 60 nt with strong homology to similar elements identified in several species is located upstream from the promoter. A GGGCGG site specific for DNA-binding protein Sp1 is located near a CAAT box, and the CCGCCC inverted repeat of the Sp1 binding sequence is located by the TATA box. The sequence immediately flanking the ATG start codon of the human alpha-galactosidase A is highly homologous to sequences flanking the ATG start codons of the other human lysosomal hydrolases for which sequence information is available (beta-glucocerebrosidase, cathepsin B, cathepsin D, and beta-hexosaminidase alpha chain), but not for any of the other 133 human signal peptides examined. Our analysis also reveals that conversion of the propeptide to the mature enzyme involves cleavage of a C-terminal rather than an N-terminal fragment. This information about the normal alpha-galactosidase A gene will be useful for comparison to data obtained from patients with Fabry disease, who are characterized by a deficiency of this enzyme. This is the first genomic clone described to date for any lysosomal enzyme, and it establishes a reference for future analyses of the molecular events that mediate the expression of this important class of enzymes.

Amino Acid Sequence↗
PubMed2002

A putative iron-regulated TonB-dependent receptor of Mannheimia (Pasteurella) haemolytica A1: possible mechanism for phase variation.

A recombinant plasmid that codes for a novel iron receptor protein (Irp) of Mannheimia (Pasteurella) haemolytica A1 was isolated by the partial complementation of an Escherichia coli fur mutant. The deduced amino acid sequence of Irp exhibited characteristics typical of TonB-dependent receptors. These include: a TonB-box at the N-terminal; a 50 amino acid region homologous to the "plug" domain of the E. coli FhuA and FepA receptors; and a C-terminal TonB-dependent signature which likely functions as an outer membrane anchoring domain. Previously uncharacterized Irp homologues were detected by BLAST analysis of available databases and incomplete microbial genomes. When the irp homologues from Neisseria gonorrhoeae and N. meningitidis were cloned by PCR and expressed in E. coli, novel proteins of the predicted size (84kDa) were detected in cell lysates, demonstrating that these are functional genes. The M. haemolytica A1 irp gene undergoes phase variation at a nucleotide region which contain the sequence AAAAAAATTAAAA (7A-2T-4A) flanked by a short inverted repeat. Site-specific mutagenesis of the 7A-2T-4A sequence as well as replacement of the inverted repeats resulted in a stable construct that expressed the Irp protein without phase variation. The expression of irp in M. haemolytica A1 was regulated by iron concentrations and most likely a Fur homologue, consistent with the proposed function of Irp in iron metabolism. The irp genes may represent contingency loci that play a role in iron acquisition during infection.

Amino Acid Sequence↗