Mutational analysis of proapoptotic death associated protein 3 (DAP3) P-loop domain in common human carcinomas.
Explore the source record for details and available documents.
Apoptosis↗
SEARCH · Search PubMed
Results for “mutation analysis”
Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Mutation analysis in Bruton's tyrosine kinase, the X-linked agammaglobulinaemia gene, including identification of an insertional hotspot.
Explore the source record for details and available documents.
Agammaglobulinaemia Tyrosine Kinase↗
Mutational analysis reveals functional similarity between NARX, a nitrate sensor in Escherichia coli K-12, and the methyl-accepting chemotaxis proteins.
During anaerobic growth, nitrate induces synthesis of the anaerobic respiratory enzymes formate dehydrogenase-N and nitrate reductase. This induction is mediated by a transcription activator, the narL gene product. The narX gene product may be involved in sensing nitrate and phosphorylating NARL. We isolated narX mutants, designated narX*, that caused nitrate-independent expression of the formate dehydrogenase-N and nitrate reductase structural genes. We used lambda narX specialized transducing phage to genetically analyze these lesions in single copy. Two previously isolated narX* mutations, narX32 and narX71, were also constructed by site-specific mutagenesis. We found that each of these alleles caused nitrate-independent synthesis of formate dehydrogenase-N and nitrate reductase, and each was recessive to narX+. The narX* mutations lie in a region of similarity with the methyl-accepting chemotaxis protein Tsr. We suggest that the narX* proteins have lost a transmembrane signalling function such that phosphoprotein phosphatase activity is reduced relative to protein kinase activity.
Amino Acid Sequence↗
Mutational analysis of cysteine residues within the extracellular domains of the human vasoactive intestinal peptide (VIP) 1 receptor identifies seven mutants that are defective in VIP binding.
We have used site-directed mutagenesis to investigate the requirement of cysteine residues in the extracellular domains of the human VIP 1 receptor for binding VIP. Cys37, Cys50, Cys63, Cys72, Cys86, Cys105 and Cys122 (N-terminal extracellular domain), Cys208 and Cys215 (second extracellular loop) and Cys288 (third extracellular loop) were mutated into glycine, and mutated cDNAs transfected into Cos-7 cells. It appeared that mutants C50G, C63G, C72G, C86G, C105G, C122G, and C288G did not bind VIP whereas mutants C37G, C208G and C215G bound VIP with the same dissociation constant (#0.5 nM) as the wild-type receptor. All mutated receptor proteins were synthesized by Cos-7 cells (Western blot) and delivered at the plasma membrane level (confocal microscopy). The fact that C208G and C215G mutants retained a complete binding activity while the C288G mutant was inactive does not suggest the presence of a functionally relevant disulfide bond between the second and third extracellular loop of the human VIP receptor contrary to what has been shown in several other heptahelical receptors. It is also concluded that the six crucial cysteine residues, e.g., Cys50, Cys63, Cys72, Cys86, Cys105 and Cys122 in the N-terminal extracellular domain, may be functionally important by forming intramolecular disulfide bonds which help to maintain the topology for ligand binding in human VIP 1 receptors.
Amino Acid Sequence↗
Mutational analysis of barley stripe mosaic virus RNA beta.
Barley stripe mosaic virus (BSMV), the type member of the hordeivirus group, has a plus-stranded genome comprising RNA species designated alpha, beta, and gamma. Although RNA beta is essential for infection of whole plants, it is dispensable for infection of barley protoplasts. We have used a full-length cDNA clone of RNA beta from which infectious in vitro transcripts can be derived to construct a number of mutations in its four genes. Mutations introduced into the beta b, beta c, or beta d genes eliminated infectivity of the RNA. The coat protein and the RNA sequences encoding the coat protein were completely dispensable for infection of barley plants by BSMV, and no detrimental effect on systemic movement of the virus was observed. However, besides eliminating coat protein expression in vivo, mutations within the coat protein gene and the first intercistronic region affected a number of other phenotypes: (1) expression of a downstream gene (beta b), (2) stability of the genomic RNA during virus multiplication in planta, (3) the requirement for a trans-acting BSMV protein (gamma b), (4) symptomatology and disease development in infected barley plants, and (5) host range.
Base Sequence↗
Mutational analysis of cysteine-rich domains of the epithelium sodium channel (ENaC). Identification of cysteines essential for channel expression at the cell surface.
One of the characteristic features of the structure of the epithelial sodium channel family (ENaC) is the presence of two highly conserved cysteine-rich domains (CRD1 and CRD2) in the large extracellular loops of the proteins. We have studied the role of CRDs in the functional expression of rat alphabetagamma ENaC subunits by systematically mutating cysteine residues (singly or in combinations) into either serine or alanine. In the Xenopus oocyte expression system, mutations of two cysteines in CRD1 of alpha, beta, or gamma ENaC subunits led to a temperature-dependent inactivation of the channel. In CRD1, one of the cysteines of the rat alphaENaC subunit (Cys158) is homologous to Cys133 of the corresponding human subunit causing, when mutated to tyrosine (C133Y), pseudohypoaldosteronism type 1, a severe salt-loosing syndrome in neonates. In CRD2, mutation of two cysteines in alpha and beta but not in the gamma subunit also produced a temperature-dependent inactivation of the channel. The main features of the mutant cysteine channels are: (i) a decrease in cell surface expression of channel molecules that parallels the decrease in channel activity and (ii) a normal assembly or rate of degradation as assessed by nondenaturing co-immunoprecipitation of [35S]methionine-labeled channel protein. These data indicate that the two cysteines in CRD1 and CRD2 are not a prerequisite for subunit assembly and/or intrinsic channel activity. We propose that they play an essential role in the efficient transport of assembled channels to the plasma membrane.
Animals↗
Cloning and mutational analysis of human malonyl-coenzyme A decarboxylase.
Malonyl coenzyme A (CoA) decarboxylase (E.C.4. 1.1.9) catalyzes the conversion of malonyl CoA to acetyl CoA. The metabolic role of malonyl CoA decarboxylase has not been fully defined, but deficiency of the enzyme has been associated with mild mental retardation, seizures, hypotonia, cardiomyopathy, vomiting, hypoglycemia, metabolic acidosis, and malonic aciduria. Here we report the isolation and sequencing of the human gene encoding malonyl CoA decarboxylase, and the identification of a mutation causing malonyl CoA decarboxylase deficiency. Human malonyl CoA decarboxylase cDNA sequences were identified by homology to the goose gene, and the intron/exon boundaries were determined by direct sequencing of a PAC clone containing the entire human gene. The 1479 basepair human cDNA is 70 percent identical to the goose sequence, and the intron/exon boundaries are completely conserved between the two species. The genetic mutation underlying malonyl CoA decarboxylase deficiency was determined in a patient with clinical features of this defect, malonic aciduria, and markedly reduced malonyl CoA decarboxylase activity.
Amino Acid Sequence↗
A mutational analysis of the Abetaz/Aalphad major histocompatibility complex class II molecule that restricts autoreactive T cells in (NZBxNZW)F1 mice. The critical influence of alanine at position 69 in the Aalphad chain.
Autoimmune symptoms of (NZBxNZW)F1 (H-2d/z) mice are reported to be critically related to the heterozygosity at the H-2 complex of the murine major histocompatibility complex (MHC). We previously showed that several Abetaz/Aalphad MHC class II molecule-restricted autoreactive T-cell clones from B/WF1 mice were pathogenic upon transfer to preautoimmune B/WF1 mice. In this study, to identify the crucial amino acid residues in Abetaz/Aalphad molecules for T-cell activation, we generated a panel of transfectant cell lines. These transfectant cell lines express the Abetaz/Aalphad MHC molecules with a mutation at each residue alpha11, alpha28, alpha57, alpha69, alpha70, alpha76 of Aalphad chain and beta86 of Abetaz chain. Replacing alpha69 alanine with threonine, valine or serine completely eliminated the ability to stimulate autoreactive T-cell clones without affecting the ability to present foreign antigen keyhole limpet haemocyanin (KLH) or L-plastin peptide to specific T-cell clones. Replacing beta86 valine with aspartic acid resulted in a decrease in the stimulation for antigen-reactive as well as autoreactive T-cell clones. Substitutions at other residues had minimal or no effect on the stimulation of either auto- or antigen-reactive T-cell clones. These results suggest that alanine at residue 69 of the Aalphad chain is critical for the activation of autoreactive Abetaz/Aalphad-restricted T-cell clones. Possible explanations for this are discussed.
Alanine↗
Rapid mutational analysis of N-ras proto-oncogene in hematologic malignancies: study of 77 Greek patient.
BACKGROUND AND OBJECTIVES: N-ras mutations are the most commonly detected molecular abnormalities in hematologic malignancies, especially in those of myeloid origin. Different techniques have been used to detect N-ras mutations; however, most of them are either labor intensive or provide sequence data for only a limited number of codons. Consequently, study of the N-ras oncogene has not been convenient in every day clinical practice being restricted, as a rule, to retrospective analysis of patients. DESIGN AND METHODS: In this study we used a recently developed method that enables rapid and reliable detection of mutations at the cDNA level, namely, the non-isotopic RNase cleavage assay (NIRCA). Using this method we were able to screen the N-ras oncogene rapidly and determine the incidence and prognostic significance of N-ras mutations in 77 Greek patients with acute leukemia, myelodysplastic syndromes and chronic myeloproliferative disorders, both at the presentation and during relapse or progression of the disease. RESULTS: Activating N-ras mutations were detected in 7 patients and our results were confirmed by direct sequencing. Interestingly, two novel alterations were identified, a mutation at codon 8 (characterized by a substitution of valine by leucine) in a patient with chronic myeloid leukemia during hematologic relapse of the disease and a polymorphism at codon 92 (1002T-->C, without amino acid substitution) in a patient with chronic myelomonocytic leukemia. INTERPRETATION AND CONCLUSIONS: A rapid and easy protocol that allows the analyses of N-ras sequences has been developed. This reverse transcription-polymerase chain reaction (RT-PCR)/NIRCA protocol can allow the study of this proto-oncogene in every day clinical practice, rapidly facilitating the validation of the diagnostic and prognostic value of N-ras mutational analyses in patients with hematologic malignancies.
Adolescent↗
Mutational analysis of beta '260-309, a sigma 70 binding site located on Escherichia coli core RNA polymerase.
In eubacteria, the final sigma subunit binds to the core RNA polymerase and directs transcription initiation from any of its cognate set of promoters. Previously, our laboratory defined a region of the beta' subunit that interacts with final sigma(70) in vitro. This region of beta' contained heptad repeat motifs indicative of coiled coils. In this work, we used 10 single point mutations of the predicted coiled coils, located within residues 260-309 of beta', to look at disruption of the final sigma(70)-core interaction. Several of the mutants were defective for binding final sigma(70) in vitro. Of these mutants, three (R275Q, E295K, and A302D) caused cells to be inviable in an in vivo assay in which the mutant beta' is the sole source of beta' subunit for the cell. All of the mutants were able to assemble into the core enzyme; however, R275Q, E295K, A302D were defective for Efinal sigma(70) holoenzyme formation. Several of the mutants were also defective for holoenzyme assembly with various minor final sigma factors. In the recently published crystal structure of Thermus aquaticus core RNA polymerase (Zhang, G., Campbell, E. A., Minakhin, L., Richter, C., Severinov, K. , and Darst, S. A. (1999) Cell 98, 811-824), the region homologous to beta'(260-309) of Escherichia coli forms a coiled coil. Modeling of our mutations onto that coiled coil places the most defective mutations on one face of the coiled coil.
Amino Acid Sequence↗
RDMAS: a web server for RNA deleterious mutation analysis.
BACKGROUND: The diverse functions of ncRNAs critically depend on their structures. Mutations in ncRNAs disrupting the structures of functional sites are expected to be deleterious. RNA deleterious mutations have attracted wide attentions because some of them in cells result in serious disease, and some others in microbes influence their fitness. RESULTS: The RDMAS web server we describe here is an online tool for evaluating structural deleteriousness of single nucleotide mutation in RNA genes. Several structure comparison methods have been integrated; sub-optimal structures predicted can be optionally involved to mitigate the uncertainty of secondary structure prediction. With a user-friendly interface, the web application is easy to use. Intuitive illustrations are provided along with the original computational results to facilitate quick analysis. CONCLUSION: RDMAS can be used to explore the structure alterations which cause mutations pathogenic, and to predict deleterious mutations which may help to determine the functionally critical regions. RDMAS is freely accessed via http://biosrv1.bmi.ac.cn/rdmas.
Databases, Nucleic Acid↗
Mutational analysis of the human immunodeficiency virus type 1 Eli Nef function.
The studies presented here define an internally consistent experimental system that permits systematic analysis of the effect of nef on the rate of the human immunodeficiency virus type 1 (HIV-1) replication in a CD4+ tumor T-cell line and in primary peripheral blood mononuclear cells. The parental full-length Nef protein, derived from the Eli strain of HIV-1, accelerates virus replication in both cell types. Mutations that destabilize or alter the intracellular location of the protein affect the ability of the Nef protein to accelerate virus replication. A set of mutants was made in amino acids proposed to be required for Nef function, including threonine and serine residues proposed to be targets for phosphorylation, and in sequences thought to resemble the G-1, G-3, and G-4 sites of the family of G proteins. In most cases alterations of the critical amino acids yield stable Nef proteins of parental phenotype. These results challenge the existing theories for the mechanism of Nef function. The results also identify two residues in the carboxyl half of the protein that are important for Nef function.
Amino Acid Sequence↗
Mutational analysis of Moloney murine leukaemia virus surface protein gp70.
Ten mutations were generated in the env gene of Moloney murine leukaemia virus DNA. The mutations were made by site-directed mutagenesis to alter basic amino acids (lysine or arginine) in the surface glycoprotein gp70. Mutants were investigated following transfection into NIH/3T3 cells. All 10 mutants released virion particles into the medium, suggesting that none of the mutations affected overall viral gene expression or virion budding. Two mutants were positive in XC plaque assay, reverse transcriptase assay and re-infection experiments, showing that these mutations occurred in parts of the molecule not essential for infection. Three mutants were negative in both the XC plaque assay and re-infection experiments, suggesting that they make non-infectious virus particles. The results indicate a defect in the early phase of infection, perhaps in receptor binding or in the fusion of virion and host membranes. The other mutations resulted in reduced infectivity of released virion particles.
3T3 Cells↗
Mutational analysis of protein binding sites involved in formation of the bacteriophage lambda attL complex.
Bacteriophage lambda site-specific recombination requires the formation of higher-order protein-DNA complexes to accomplish synapsis of the partner attachment (att) sites as well as for the regulation of the integration and excision reactions. The att sites are composed of a core region, the actual site of strand exchange, and flanking arm regions. The attL site consists of two core sites (C and C'), an integration host factor (IHF) binding site (H'), and three contiguous Int binding arm sites (P'1, P'2, and P'3). In this study, we employed bacteriophage P22 challenge phages to determine which protein binding sites participate in attL complex formation in vivo. The C', H', and P'1 sites were critical, because mutations in these sites severely disrupted formation of the attL complex. Mutations in the C and P'2 sites were less severe, and alteration of the P'3 site had no effect on complex formation. These results support a model in which IHF, bound to the H' site, bends the attL DNA so that the Int molecule bound to P'1 also interacts with the C' core site. This bridged complex, along with a second Int molecule bound to P'2, helps to stabilize the interaction of a third Int with the C core site. The results also indicate that nonspecific DNA binding is a significant component of the Int-core interactions and that the cooperativity of Int binding can overcome the effects of mutations in the individual arm sites and core sites.
Attachment Sites, Microbiological↗
Mutational analysis of the human immunodeficiency virus vpr open reading frame.
Mutations were introduced by recombinant DNA techniques into the vpr open reading frame of an infectious molecular clone of human immunodeficiency virus type 1. The effect of these changes on the replicative and cytopathologic properties of the virus recovered from transfected cells was studied in several human CD4+ lymphocyte cell lines. In all cases, mutant viruses were infectious and cytopathic. However, when a low-input dose was used, mutants grew significantly more slowly than the wild-type virus. The growth kinetics of vpr mutants were distinct from those of vif and vpu mutants.
Cytopathogenic Effect, Viral↗
Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.
In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.
Base Composition↗
Mutational analysis of the PRL receptor gene in human breast tumors with differential PRL receptor protein expression.
PRL is a major growth and differentiating hormone in the human breast, with activation of the PRL-PRL receptor complex increasingly recognized as an important mechanism in the induction and progression of mammary tumors. Although constitutive activation of various hormone and growth factor receptors is newly recognized as a common cause of tumor development, the PRL receptor gene has not been analyzed for similar aberrations in breast and other tumors. Therefore, using bacterial artificial chromosomes containing the PRL receptor gene and intron-spanning PCR, we determined the exon-surrounding intron sequences providing primers for the first analysis of the entire coding region of the human PRL receptor gene. We examined the presence of PRL receptor in 41 breast tumors by immunohistochemistry and attempted a correlation of its expression to pathological grading of the disease. Then tumor cells were isolated by laser capture microdissection to examine DNA from 30 patients for PRL receptor mutations. The PRL receptor immunoreactive score did not correlate to the tumor size, histopathological grading, age, or family history of patients. PRL receptor immunoreactivity was predominantly found in steroid hormone receptor-positive tumors, but without overall correlation of immunoreactive score. In both PRL receptor-positive and PRL receptor- negative breast cancer cells, direct sequencing of the coding sequence of the PRL receptor gene did not detect any somatic or hereditary gene aberrations. In conclusion, PRL receptor mutations do not appear to be common in human breast cancer, suggesting that constitutive activation of the PRL receptor can be excluded as a major cause of mammary tumor genesis. The molecular structure of the PRL receptor seems to remain intact in tumor tissue, and systemic and local production of PRL may participate in tumor cell growth and proliferation through functional receptors.
Adult↗
Mutational analysis of the p73 gene in human breast cancers.
In primary breast cancer, mutations of the p53 tumor suppressor gene lead to loss of growth-suppressive properties and poor outcome. Recently, a p53-related gene, termed p73, has been cloned and its gene product possesses a function similar to p53. p73 has been mapped at chromosome 1p36.3, a region frequently deleted in breast cancer, neuroblastoma and other malignancies. To elucidate the functional significance of p73 in the oncogenesis of breast cancer, we have studied genetic alterations of p73 in tissue specimens obtained from 87 patients with primary breast cancer. Thirteen percent of informative cases showed loss of heterozygosity (LOH) at the p73 gene. However, there was no correlation between the p73 LOH and clinical features such as histopathological types, metastatic behavior or expression of estrogen or progesterone receptor. The levels of p73 transcript in primary breast cancer were not significantly different from those in normal breast tissue. Moreover, PCR-SSCP analysis failed to detect any missense or frameshift mutations in the p73 gene. Our observations suggest that allelic loss, expression levels and mutations of the p73 gene may not contribute to oncogenesis of primary breast cancers.
Adult↗