Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “RNA sequencing”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,711 records · Page 95Linked to original sources
PubMed1991

An RNA-amino acid complex and the origin of the genetic code.

The group I RNAs, of which the Tetrahymena ribosomal RNA intron is the most investigated example, catalyze their own splicing reactions. Splicing is initiated at a conserved site on the RNA that facilitates attack by exogenous guanosine (or its nucleotides) on the exon-intron junction. The guanosine site in the RNA's catalytic center also binds arginine, and is quite selective for the arginine side chain. This amino acid-RNA interaction is stereoselective, and L-arginine is preferred. Immediately at the site at which arginine binds there is one of only four RNA triplets in 92 group I RNA sequences: AGA/G and CGA/G. Thus the arginine contact site is within any of four different codons for arginine. Mutation of the conserved G in the middle of the triplet decreases affinity for the amino acid, showing that binding is sequence-specific. A pathway for the origin of the genetic code for arginine is suggested, based on the existence and properties of this sequence-specific, amino acid-specific RNA complex. The existence of a proto-ribosome related to the group I RNAs seems the most likely hypothesis. This notion is used to distinguish three periods in the development of the code. Restrained and exuberant hypotheses about the origin of the genetic code are distinguished, and some objections to these hypotheses are considered.

Animals↗
PubMed1995

Origin of a negative calcium response element in an ALU-repeat: implications for regulation of gene expression by extracellular calcium.

The negative calcium response element type 2 (nCARE) is a regulatory DNA sequence consisting of a palindromic core sequence and several upstream T residues, which was originally described in the 5' flank of the human PTH gene. The nCARE functions in an orientation-specific manner to inhibit PTH transcription in response to raised extracellular calcium levels. Here we report that the PTH nCARE lies within a hitherto unrecognized ALU-like element situated approximately 3.6 kB upstream of the human PTH gene transcriptional start site. Since ALU elements are repetitive DNA sequences, which are widely distributed throughout the human genome, we hypothesized that other nCARE elements might also exist. A search of the GenBank/EMBL databases with the nCARE core sequence confirmed this to be the case showing the presence of 111 copies of the nCARE in human/primate sequences. Analysis of the 7SL RNA sequence from which ALU elements derive also showed the presence of an nCARE "core" sequence immediately upstream of the poly-A+ tail. These data suggest that the nCARE is derived from retrotransposition of 7SL RNA and forms an integral part of many ALU elements; reverse transcription of the poly-A+ tail of 7SL RNA adds T residues, which on retrotransposition into genomic DNA with the core sequence, forms an ALU element containing a functional nCARE. Some of the genes associated with nCARE elements express products which are affected by extracellular calcium concentrations and work is in progress to determine the functional effects of nCARE at these sites.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗
PubMed1985

Conserved sequences and coding of two strains of lymphocytic choriomeningitis virus (WE and ARM) and Pichinde arenavirus.

Analyses of the 3' end sequences of the small, S, and large, L, RNA species of lymphocytic choriomeningitis (LCM) virus isolates ARM and WE, and DNA clones of LCM-WE, have shown that there are extensive RNA sequence homologies between the 3' ends of the two RNA species of both LCM strains. Limited sequence data of DNA clones representing the LCM-WE L RNA species indicate that a gene product (presumably the minor 200 kdalton virion protein) is coded in a viral-complementary mRNA species. Sequence analyses of LCM-WE S DNA clones indicate that approximately 50% of the 2040 nucleotides representing the 3' half of the viral RNA species (and its encoded 558 amino acid gene product) are identical in type and position to those of Pichinde arenavirus (Auperin, D., et al. (1984a), Virology 134, 208-219). For Pichinde virus, it has been shown that the 3' proximal gene product (the nucleoprotein, N) is translated from a subgenomic, viral-complementary mRNA (Auperin et al., 1984a). Data have recently been obtained (Auperin, D., et al. (1984b) J. Virol., in press) that indicate that the Pichinde glycoprotein precursor, GPC, is coded in a viral-sense subgenomic mRNA species corresponding to the 5' half of the S RNA. The nucleotide sequence that immediately follows the N coding region of both LCM-WE and Pichinde viruses can be arranged in a hairpin configuration. In view of this, and if, like Pichinde virus, LCM has an ambisense S RNA coding strategy, then it is probable that the intergenic hairpins function as transcription terminators for the N and GPC mRNA species of both viruses.

Amino Acid Sequence↗
PubMed2004

Bridging expressed sequence alignments through targeted cDNA sequencing.

One of the major challenges in genome research is the identification of the complete set of genes in a genome. Alignments of expressed sequences (RNA and EST) with genomic sequences have been used to characterize genes. However, the number of alignments far exceeds the likely number of genes in a genome, suggesting that, for many genes, two or more alignments can be joined through overlapping sequences to yield accurate gene structures. High-throughput EST sequencing becomes less efficient in closing those alignment gaps due to its nonselective nature. We sought to bridge these alignments through a novel approach: targeted cDNA sequencing. Human expressed sequences from GenBank version 124 were aligned with the genomic sequence from NCBI build 24 using LEADS, Compugen's EST and RNA clustering and assembly software system. Nine hundred forty-eight pairs of alignments were selected based on EST clone information and/or their homology to the same known proteins. Reverse transcriptase PCR and sequencing yielded sequences for 363 of those pairs. These sequences helped characterize over 60 novel or otherwise incomplete genes in the recent UniGene build 153, which included over 1 million additional ESTs. These results indicate that this integrated and targeted strategy, combining computational prediction and experimental cDNA sequencing, can efficiently generate the overlapping sequences and enable the full characterization of genomes. Additional information about the contig pairs, the resultant overlapping sequences, tissue sources, and tissue profiles are available in a supplemental file.

Cloning, Molecular↗
PubMed2004

Recognition of the mRNA AU-rich element by the zinc finger domain of TIS11d.

The tandem zinc finger (TZF) domain of the protein TIS11d binds to the class II AU-rich element (ARE) in the 3' untranslated region (3' UTR) of target mRNAs and promotes their deadenylation and degradation. The NMR structure of the TIS11d TZF domain bound to the RNA sequence 5'-UUAUUUAUU-3' comprises a pair of novel CCCH fingers of type CX(8)CX(5)CX(3)H separated by an 18-residue linker. The two TIS11d zinc fingers bind in a symmetrical fashion to adjacent 5'-UAUU-3' subsites on the single-stranded RNA via a combination of electrostatic and hydrogen-bonding interactions, with intercalative stacking between conserved aromatic side chains and the RNA bases. Sequence specificity in RNA recognition is achieved by a network of intermolecular hydrogen bonds, mostly between TIS11d main-chain functional groups and the Watson-Crick edges of the bases. The TIS11d structure provides insights into the RNA-binding functions of this large family of CCCH zinc finger proteins.

3' Untranslated Regions↗
PubMed2006

ChloroplastDB: the Chloroplast Genome Database.

The Chloroplast Genome Database (ChloroplastDB) is an interactive, web-based database for fully sequenced plastid genomes, containing genomic, protein, DNA and RNA sequences, gene locations, RNA-editing sites, putative protein families and alignments (http://chloroplast.cbio.psu.edu/). With recent technical advances, the rate of generating new organelle genomes has increased dramatically. However, the established ontology for chloroplast genes and gene features has not been uniformly applied to all chloroplast genomes available in the sequence databases. For example, annotations for some published genome sequences have not evolved with gene naming conventions. ChloroplastDB provides unified annotations, gene name search, BLAST and download functions for chloroplast encoded genes and genomic sequences. A user can retrieve all orthologous sequences with one search regardless of gene names in GenBank. This feature alone greatly facilitates comparative research on sequence evolution including changes in gene content, codon usage, gene structure and post-transcriptional modifications such as RNA editing. Orthologous protein sets are classified by TribeMCL and each set is assigned a standard gene name. Over the next few years, as the number of sequenced chloroplast genomes increases rapidly, the tools available in ChloroplastDB will allow researchers to easily identify and compile target data for comparative analysis of chloroplast genes and genomes.

Chloroplasts↗
PubMed1981

An evaluation of the phylogenetic position of the dinoflagellate Crypthecodinium cohnii based on 5S rRNA characterization.

Partial nucleotide sequences for the 5S and 5.8S rRNAs from the dinoflagellate Crypthecodinium cohnii have been determined, using a rapid chemical sequencing method, for the purpose of studying dinoflagellate phylogeny. The 5S RNA sequence shows the most homology (75%) with the 5S sequences of higher animals and the least homology (less than 60%) with prokaryotic sequences. In addition, it lacks certain residues which are highly conserved in prokaryotic molecules but are generally missing in eukaryotes. These findings suggest a distant relationship between dinoflagellates and the prokaryotes. Using two different sequence alignments and several different methods for selecting an optimum phylogenetic tree for selecting an optimum phylogenetic tree for a collection of 5S sequences including higher plants and animals, fungi, and bacteria in addition to the C. cohnii sequence, the dinoflagellate lineage was joined to the tree at the point of the plant-animal divergence well above the branching point of the fungi. This result is of interest because it implies that the well-documented absence in dinoflagellates of histones and the typical nucleosomal subunit structure of eukaryotic chromatin is the result of secondary loss, and not an indication of an extremely primitive state, as was previously suggested. Computer simulations of 5S RNA evolution have been carried out in order to demonstrate that the above-mentioned phylogenetic placement is not likely to be the result of random sequence convergence. We have also constructed a phylogeny for 5.8S RNA sequences in which plants, animals, fungi and the dinoflagellates are again represented. While the order of branching on this tree is the same as in the 5S tree for the organisms represented, because it lacks prokaryotes, the 5.8S tree cannot be considered a strong independent confirmation of the 5S result. Moreover, 5.8S RNA appears to have experienced very different rates of evolution in different lineages indicating that it may not be the best indicator of evolutionary relationships. We have also considered the existing biological data regarding dinoflagellate evolution in relation to our molecular phylogenetic evidence.

Animals↗
PubMed1976

Analysis of chromatin-associated fiber arrays.

Electron microscopic examination of chromatin from embryonic nuclei of Oncopeltus fasciatus and Drosophila melanogaster reveals arrays of chromatin associated fibers. The lengths and spacings of these fibers were analyzed to provide a basis for defining and interpreting regions of transcriptionally active chromatin. The results of the analysis are consistent with the interpretation of some fibers as nascent RNA with associated protein (RNP). The chromatin segments underlying these fiber arrays were classified as ribosomal or non-ribosomal transcription units according to definitions and criteria described by Foe et al. (1976). Nascent fibers on active ribosomal transcription units were analyzed and compared for Drosophila melanogaster, Triturus viridescens, and Oncopeltus fasciatus. A common feature of the fiber patterns on ribosomal TUs is that origin-distal fibers exhibit greater length variability and a lower slope relative to proximal fibers. The region of increased variability in fiber lengths is correlated with the expected location of 28S ribosomal RNA sequences in the distal half of each ribosomal transcription unit. Because 28S ribosomal RNA appears to contain more extensive regions of base sequence complementarity, we suggest that the length of ribosomal RNP fibers is influenced under our spreading conditions by the secondary structure of the nascent RNA. In order to calculate the RNA content of RNP fibers, chromatin morphology was used to estimate lengths of transcribed DNA. The packing ratio of DNA in chromatin, which we express as the length of B-structure DNA divided by length of chromatin, is 1.1-1.2 and 1.6 for the DNA in active ribosomal and non-ribosomal chromatins, respectively. These DNA packing ratios are used to determine the extent to which nascent RNP fibers are shorter than the transcribed DNA (expressed as DNA/RNP length ratio). For non-ribosomal transcription units and for proximal fibers of ribosomal transcription units. DNA/RNP length ratios are relatively constant within each array. However, considerable variability in this ratio (4-23) is observed for different arrays of fibers. Possible sources of this variability are considered by comparing ratios derived from the presumably identical ribosomal transcription units. Further analysis of the morphology of nascent fibers may elucidate the contributions of proteins and successive RNA sequences to RNP structure.

Animals↗
PubMed1987

Phylogenetic diversity and position of the genus Campylobacter.

RNA sequence analysis has been used to examine the phylogenetic position and structure of the genus Campylobacter. A complete 5S rRNA sequence was determined for two strains of Campylobacter jejuni and extensive partial sequences of the 16S rRNA were obtained for several strains of C. jejuni and Wolinella succinogenes. In addition limited partial sequence data were obtained from the 16S rRNAs of isolates of C. coli, C. laridis, C. fetus, C. fecalis, and C. pyloridis. It was found that W. succinogenes is specifically related to, but not included, in the genus Campylobacter as presently constituted. Within the genus significant diversity was noted. C. jejuni, C. coli and C. laridis are very closely related but the other species are distinctly different from one another. C. pyloridis is without question the most divergent of the Campylobacter isolates examined here and is sufficiently distinct to warrant inclusion in a separate genus. In terms of overall position in bacterial phylogeny, the Campylobacter/Wolinella cluster represents a deep branching most probably located within an expanded version of the Division containing the purple photosynthetic bacteria and their relatives. The Campylobacter/Wolinella cluster is not specifically includable in either the alpha, beta or gamma subdivisions of the purple bacteria.

Base Sequence↗
PubMed1997

The early emergence of platyhelminths is contradicted by the agreement between 18S rRNA and Hox genes data.

The phylogenetic position of the platyhelminths within the metazoan tree is examined using two independent sets of molecular characters, the evolution of 18S ribosomal RNA sequences and the diversity of the genes belonging to the HOX cluster. Among the various hypotheses that have been considered by zoologists, a position of the platyhelminths within the protostomes, related to the phyla with typical spiral cleavage, appears to be favoured when taking into account all separate lines of evidence. It is in conflict with the traditional hypothesis of an early emergence at the base of the bilaterally symmetrical animals. This relatively late emergence is compatible with the old idea that flatworms are derived from a coelomate ancestor. New evidence from the sequences of Hox genes suggests that the duplicated genes Ultrabithorax/abdominal-A constitute a genetic synapomorphy of the whole protostome clade.

Animals↗
PubMed1994

On the use of phasing experiments to measure helical repeat and bulge loop-associated twist in RNA.

In a phasing experiment, two bends are introduced into a long duplex RNA or DNA and the number of base pairs between them varied. When electrophoresed in a gel, the set of molecules may show a periodic variation in mobility that contains information about the twist associated with the bends and the intervening helix. We show how a set of three phasing experiments can be used to extract this information, and apply it to an RNA helix bend at the bulge sequence A2. The bulge introduces a negative (left-handed) twist of approximately 30 degrees; at low temperatures, it is mostly confined to the 5' side of the bulge. The apparent helical repeat of random sequence RNA measured in these experiments was 10.2 +/- 0.1 base pairs, an unexpectedly low value. It is likely that moderate curvative of the RNA helix axis (30-40 degrees over 80 bp) has affected the measurement.

Base Composition↗
PubMed2000

[Study on the origin of influenza A(H1N2) virus HA and NA genes].

OBJECTIVE: To determine the origins of the HA and NA genes of new subtype (H1N2) of influenza A virus. METHODS: Virus was amplified in embryonated chicken eggs, then virion RNA was transcribed into cDNA by reverse transcriptase, cDNA amplified by PCR, the products of PCR were purified. Afterward, RNA sequence analysis was performed by the dideoxynucleotide chain termination method, using synthetic oligodideoxynucleotide primers. Finally, phylogenetic analysis of the sequencing data was per-formed with MegAlign (Version 1.03) and Editseq (Version 3.69) software. RESULTS: The homology of amino acid sequences of protein molecules on HAl domains when compared, with A/PR/8/34(H1N1) and A/Guangdong/6/91(H1 N1) viruses was 98.2% and 99.4%, respectively. The homology of amino acid sequences of NA protein molecules between the novel reassortant and H1N1 virus was only 83.4 %, but the homology of those between H1N2 strain and H3N2 virus circulating in men in 1995 was as high as 99.1 %. CONCLUSIONS: The new reassortant (H1N2) virus HA gene was derived from A/PR/8/34(H1N1) like virus, but its NA gene was derived from H3N2 virus circulating in men in 1995.

Adult↗
PubMed1976

Effect of estrogen on gene expression in the chick oviduct. In vitro transcription of the ovalbumin gene in chromatin.

RNA was transcribed from chromatin isolated from chick oviduct and spleen by using RNA polymerase from Escherichia coli. RNA was also transcribed from whole chick DNA using E. coli RNA polymerase. DNA complementary to ovalbumin messenger RNA (cDNAov) was then used as a hybridization probe to estimate the concentration of ovalbumin messenger RNA sequences (mRNAov) in these in vitro transcripts. Although chromatin from unstimulated chick oviduct was capable of substantial RNA synthesis, no detectable mRNAov sequences could be found in the transcript. Likewise, mRNAov sequences could not be found in RNA synthesized from spleen chromatin using E. coli RNA polymerase. However, chromatin from estrogen-stimulated chick oviducts was capable of supporting synthesis of ovalbumin mRNA. We estimate that approximately 0.01% of the RNA synthesized from estrogen-stimulated chromatin was mRNAov sequences. When RNA synthesized from chick DNA was tested with the cDNAov probe, mRNAov sequences could be detected in a concentration of approximately 10% that found in the RNA transcript from estrogen-stimulated chromatin. This was as expected if the ovalbumin gene is considered to be in the "open or derepressed" region of the estrogen-stimulated oviduct chromatin. Chromatin isolated from chicks withdrawn from hormone for 12 days was only capable of supporting mRNAov synthesis in vitro at a level of 5 to 10% of that observed in chromatin prepared from estrogen-stimulated chicks, thus indicating the requirement for estrogen to maintain the ovalbumin gene in the available or "open" state in the majority of oviduct cells. These data militate against post-transcriptional control as the primary mechanism of steroid hormone regulation of specific mRNA synthesis in the chick oviduct system, and favor primary gene derepression as the most likely mechanism for estrogen induction of ovalbumin synthesis.

Animals↗
PubMed2001

Effects of inactivation of the coat protein and movement genes of Tomato bushy stunt virus on early accumulation of genomic and subgenomic RNAs.

Accumulation of RNA of Tomato bushy stunt virus (TBSV) was examined within the first few hours after infection of Nicotiana benthamiana protoplasts to determine the influence of the coat protein (CP), the movement-associated proteins P22 and P19 and RNA sequences at very early stages of replication. The results showed that P19 had no effect on early RNA replication, whereas the absence of CP and/or P22 expression delayed RNA accumulation only marginally. Removal of CP-coding sequences had no added negative effects, but when the deletion extended into the downstream p22 gene, it not only eliminated synthesis of subgenomic RNA2 but also delayed accumulation of genomic RNA by 10 h. At times beyond 20 h post-transfection, RNA accumulated to normal high levels for all mutants. This illustrates that TBSV RNA sequences that have negligible impact on overall RNA levels observed late in infection can actually have pronounced effects at very early stages.

Base Sequence↗
PubMed1996

Detection of the ORF3 polypeptide of feline calicivirus in infected cells and evidence for its expression from a single, functionally bicistronic, subgenomic mRNA.

Feline calicivirus (FCV) is a small positive-stranded RNA virus within the family Caliciviridae. Its genome is 7690 nucleotides in length and encodes three open reading frames (ORFs). The smallest, ORF3, is located at the extreme 3' end of the genome and can potentially encode a polypeptide of approximately 12 kDa. In this paper, we report the identification of an ORF3-encoded polypeptide in FCV-infected cells using an antiserum raised against a bacterially-expressed bacteriophage T7 gene 10-ORF3 fusion protein. Although a small mRNA of 0-5 kb, which could potentially encode ORF3, has been described, reports on the number and size of FCV subgenomic RNAs have varied considerably. To clarify the situation, RNAs from FCV-infected cells were labelled in vivo using [32P]orthophosphate, an approach which provided definitive data. Only two RNA species were detected, the genomic RNA and a subgenomic mRNA of 2.4 kb. The 5' end of the subgenomic mRNA was mapped to position 5227 on the genomic RNA using RNA sequencing and primer extension methods. RNA isolated from FCV-infected cells in which no subgenomic RNA smaller than 2.4 kb was detectable directed the synthesis in rabbit reticulocyte lysate of the ORF3-encoded polypeptide. Furthermore, a synthetic RNA copy of the 2-4 kb subgenomic mRNA of FCV, containing both ORF2 and ORF3 polypeptides in the in vitro translation system. These data strongly suggest that ORF3 is expressed from the 2-4 kb subgenomic RNA and that this RNA is functionally bicistronic. The possible mechanisms by which ORF3 is expressed are discussed.

Animals↗
PubMed1998

Translationally repressive RNA structures monitored in vivo using temperate DNA bacteriophages.

The RNA challenge phage system enables genetic selection of proteins with RNA-binding activity in bacteria. These phages are modified versions of the temperate DNA bacteriophage P22 in which post-transcriptional regulatory events control the developmental fate of the phage. The system was originally developed to identify novel RNA ligands that display reduced affinity for the R17/MS2 coat protein, as well as to select for suppressor coat proteins that recognize mutant RNA ligands. During the course of evaluating whether the HIV-1 Rev protein could direct lysogen development for bacteriophage derivatives that encode Rev response element (RRE) RNA sequences, two examples of RRE RNA ligands that interfere with challenge phage development were identified. In the phage examples described, RRE RNA secondary structure prevents Ant protein biosynthesis and lytic development. Phage lysogen formation occurs efficiently in recipient cells, independent of the expression status of the Rev protein or trans-acting competitor RRE RNA ligands. These studies provide the first example whereby RNA challenge phages may be applied to study RNA folding events and RNA structural interactions in an in vivo context.

Bacterial Proteins↗
PubMed1982

On the phylogeny of Phycomyces blakesleeanus. Nucleotide sequence of 5 S ribosomal RNA.

The nucleotide sequence of the major 5 S ribosomal RNA from the lower fungus Phycomyces blakesleeanus has been determined. The sequence is 5' AAUCUACGGCCAUACAGAUAGUAACACACCGGAUCCCGUCUGAUCUCCGCAGUUAAGUCUCUCCUGGUAGCGUCAGUAC UAUGGUGGGGGACCACAUGGGAAUACGCUAUGUCGUAGGUU3'OH. The Phycomyces 5 S RNA sequence has invariant nucleotide positions characteristic of other eukaryotic 5 S RNAs and fits currently proposed secondary structural models. The Phycomyces of 5 S RNA shows relatively low overall sequence homology to the higher fungal (Ascomycetes) 5 S RNAs (56-60%) but shows higher sequence homology to those 5 S RNAs from Tetrahymena thermophila (68%), human KB cells (67%), and Spinacia oleracea (62%). A comparison of individual segments of the RNA also shows that the structure of Phycomyces 5 S RNA has several major differences from structures common to the higher fungi. Positions 2-14 are homologous with those of metazoan and some protozoan 5 S RNAs. At positions 30-45, the RNA sequence is closer to metazoan 5 S RNAs than to the Neurospora of Aspergillus 5 S RNAs. The Phycomyces 5 S RNA shares similar sequences with both Aspergillus and Tetrahymena 5 S RNAs at positions 79-99. Several other important homologies in primary and proposed secondary structures also have been observed in comparing Phycomyces 5 S RNA with animal and plant 5 S RNAs. We conclude that Phycomyces may not be as closely related phylogenetically to the Ascomycetes as previously thought.

Base Sequence↗
PubMed1993

The signal recognition particle database (SRPDB).

The SRPDB (signal recognition particle database) provides annotated SRP RNA sequences from Eucaryotes and Archaea, phylogenetically ordered and aligned with their bacterial equivalents. We also make available representative RNA secondary structure diagrams, where each base pair is proven by comparative sequence analysis. New to this release are 17 SRP RNA sequences (a total of 64 sequences) and alignments of proteins SRP19 and SRP54 with their RNA binding sites.

Animals↗