Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Promotion”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,639 records · Page 91Linked to original sources
PubMed2001

Deletional analysis of the murine IL-12 p35 promoter comparing IFN-gamma and lipopolysaccharide stimulation.

IL-12, pivotal to the development of Th1 cells and formed by association of p35 and p40 subunits, is made by macrophages and the macrophage cell line RAW264.7. In this study, the promoter for p35 was cloned and analyzed. The murine IL-12 p35 gene has promoters upstream from each of the first two exons. The exon 1 and exon 2 promoters, cloned into a reporter vector, were responsive to LPS or IFN-gamma/CD40 ligation in transfected RAW264.7 cells. The exon 2 promoter containing bp -809 to +1 has significant homology to the human p35 promoter. Thus, deletion analysis was performed to determine the regions required for responsiveness to LPS, CD40, and/or IFN-gamma. Base pairs -809 to -740 influenced responsiveness to LPS. In contrast, bp -740to -444 and bp -122 to -100 were required for responses to IFN-gamma, IFN-gamma/LPS, or IFN-gamma/CD40 ligation. Removal of bp -444 to -392 increased the response of the exon 2 promoter to each stimulant. IFN regulatory factor (IRF)-1 is involved in the activity of this promoter at bp -108 to -103 because levels of nuclear IRF-1 correlated with exon 2 promoter activity in response to IFN-gamma and IRF-1 overexpression stimulated and enhanced exon 2 promoter activity. Also, site or deletion mutation of the IRF-1 element at bp -108 to -103 reduced the responsiveness of the promoter and IRF-1 bound to an oligonucleotide containing bp -108 to -103. The data suggest that the response of the p35 promoter to IFN-gamma requires a distinct IRF-1 positive regulatory element at bp -108 to -103.

Animals↗
PubMed2005

A novel NF-kappa B-regulated site within the human I gamma 1 promoter requires p300 for optimal transcriptional activity.

Transcriptional activation of germline (GL) promoters occurs through binding of NF-kappaB to three evolutionarily conserved sites within a CD40 response region in the human and mouse GL Igamma and Iepsilon promoters. Here we identify and characterize a novel NF-kappaB binding site (kappaB6) within the human GL Igamma1 promoter that plays an essential role in basal- and CD40-induced transcription. This site is adjacent to identified CREB/activating transcription factor (ATF) sites, present in the Igamma1 but not the Igamma3 promoter, which are important for the amplification of transcription. Our data suggest a cohesive protein complex regulating Igamma1 promoter activity because disruption of any individual NF-kappaB or CREB/ATF site markedly lowers the overall inducible activity of the promoter. In addition, alteration of helical phasing within the promoter indicates spatial orientation of CREB/ATF and NF-kappaB, proteins contributes directly to promoter activity. We found that CREB and p50 transactivators, as well as coactivator p300, interact in vivo with the Igamma1 promoter in the presence and absence of CD40 signaling in Ramos and primary B cells. However, the level of CREB and p300 binding differs as a consequence of activation in primary B cells. Furthermore, overexpression of p300, and not a mutant lacking acetyltransferase activity, significantly increases Igamma1 construct-specific transcription. Together these data support a model whereby CREB and multiple NF-kappaB complexes bind to the Igamma1 promoter and recruit p300. CD40 signals induce p300-dependent changes that result in optimal Igamma1 promoter activity.

Activating Transcription Factors↗
PubMed1999

[Attitudes of occupational medicine physician towards health promotion].

The objective of the survey was to judge the attitudes of occupational medicine physicians towards health promotion in the workplace. To this end, a special questionnaire has been developed. In total, 142 physicians qualified in preventive medicine were surveyed. Some of them have been working as occupational physicians for six years and some were in the course of specialisation in occupational medicine (the 1st and the 2nd grades). The survey yielded the following results: 84.5% of respondents considered that occupational medicine physicians should be involved in health promotion in the workplace, but only 37.1% of them were ready to undertake individual actions in this area; a large majority of respondents listed the following factors as the main obstacles in initiating health promotion activities: (a) the lack of interest in health promotion among employers (27.5%), (b) the lack of interest in health promotion among employees (25.5%), (c) the lack of time (25.5%), (d) the ack of sufficient financial means for health promotion in the workplace. Only 2.8% of persons reported no problems encountered in their health promotion work in the workplace. In addition, 39.4% of respondents were interested in the organisation and coordination of health promotion programmes in conditions existing nowadays in Poland. To sum up the results of the survey, it is necessary to emphasise a positive observation that the majority of respondents want to participate in health promotion programmes, although they feel that 'know-how' knowledge, professional publications and medical equipment are still far from being satisfactory. Thus, it is deemed necessary to develop further health promotion programmes to encourage positive attitudes towards health promotion among employers and employees.

Attitude of Health Personnel↗
PubMed1998

A systematic review of the effectiveness of health promotion aimed at improving oral health.

OBJECTIVE: To examine the quality of oral health promotion research evidence and to assess the effectiveness of health promotion, aimed at improving oral health using a systematic and scientifically defensible methodology. BASIC RESEARCH DESIGN: Systematic review of oral health promotion research evidence using electronic searching, iterative hand-searching, critical appraisal and data synthesis. CLINICAL SETTING: The settings of the primary research reviewed were clinical, community, schools or other institutions. The participants were children, the elderly, adults and people with handicaps and disabilities. INTERVENTIONS: Only studies which reported an evaluative component were included. Theoretical and purely descriptive papers were excluded. MAIN OUTCOME MEASURES: The review examined the evidence of effectiveness of oral health promotion on caries, oral hygiene, oral health related knowledge, attitudes and behaviours. RESULTS: Very few definitive conclusions about the effectiveness of oral health promotion can be drawn from the currently available evidence. Caries and periodontal disease can be controlled by regular toothbrushing with a fluoride toothpaste but a cost-effective method for reliably promoting such behaviour has not yet been established. Knowledge levels can almost always be improved by oral health promotion initiatives but whether these shifts in knowledge and attitudes can be causally related to changes in behaviour or clinical indices of disease has also not been established. CONCLUSIONS: Oral health promotion which brings about the use of fluoride is effective for reducing caries. Chairside oral health promotion has been shown to be effective more consistently than other methods of health promotion. Mass media programmes have not been shown to be effective. The quality of oral health promotion evaluation research needs to be improved.

Adult↗
PubMed2001

Human telomerase reverse transcriptase promoter regulation in normal and malignant human ovarian epithelial cells.

The telomerase RNA-protein complex responsible for maintenance of telomeric DNA at chromosome ends, is usually inactive in most primary somatic human cells, but is specifically activated with in vitro immortalization and during tumorigenesis. Although expression of the RNA component of telomerase appears to be constitutive, the expression pattern of human telomerase reverse transcriptase (hTERT), the catalytic subunit of telomerase, is correlated with measured enzyme activity. In particular, a >80% concordance has been reported between telomerase activity and hTERT mRNA expression in ovarian tumors. Accordingly, to learn more about the mechanism regulating hTERT gene expression in ovarian carcinoma, we have performed a detailed analysis of the 5'-flanking promoter region of the hTERT gene. We have reported previously the isolation and analysis of a 5.8-kb genomic fragment containing the human hTERT gene promoter (M. Tzukerman et al., Mol. Biol. Cell, 11: 4381-4391, 2000). Deletion analysis of this promoter was carried out using transient transfection of promoter-reporter constructs in four different telomerase-expressing, ovarian carcinoma-derived cell lines, the tumorigenic properties of which have been characterized, and was compared with telomerase-negative primary human fibroblasts and nontransformed ovarian epithelial cells. These assays have shown that the hTERT promoter is inactive in telomerase-negative cells and is active in telomerase-positive cell lines. A core promoter of 283 bp upstream of the transcription initiation site (TI) was found to be sufficient for maximum promoter activity, suggesting the presence of inhibitory elements within the larger promoter sequence. Gel shift analysis of the core promoter using nuclear extracts from the ovarian and control cell lines revealed specific transcription factor binding using extracts from telomerase-positive cells. Among the binding elements, we identified two E-boxes (CACGTG) as well as a novel element (MT-box), which we identified recently in a number of differentiation systems. Site-directed mutagenesis was used to introduce mutations into this novel transcription factor binding element. These mutations significantly affect the transcriptional activity of hTERT promoter in a cell type-specific manner and suggest that the transcription factors that bind to the E-box and the novel element cooperatively function as major determinants of hTERT expression and telomerase activity in ovarian cancer. Further comparison of promoter activity, telomerase activity, and telomere length among the different ovarian cancer cells indicated that a threshold level of telomerase activity is apparently sufficient to protect telomere integrity and permit the immortal state of the different ovarian cancer cell lines.

Base Sequence↗
PubMed2002

[Correlation between polymorphism of IL-4 and IL-10 gene promoter and childhood asthma and their impact upon cytokine expression].

OBJECTIVE: To investigate the correlation between the polymorphism of IL-4 and IL-10 gene promoters and the susceptibility of Chinese children to asthma and to study the impact of such polymorphism upon cytokine production. METHODS: The data of medical history, pulmonary function, hypersensitive test, and serum IgE were recorded among 168 unrelated Chinese children with asthma aged 5 approximately 15. Four polymorphism sites of IL-4 and IL-10 gen promoter regions were determined by PCR/RFLP. The peripheral blood monocyte (PBMC) was cultured and stimulated by lipopolysacchride (LPS). Then the contents of IL-4 and IL-10 gene promoter regions were determined by ELISA. 53 age-matched children without asthma were used as control. RESULTS: (1) The allele frequencies of-598 (C/T) site of IL-4 gene promoter was significantly different between Chinese children and children of Caucasian and Afro-American origin (P = 0.01). The allele frequency of -1082 (G/A) site, -819 (C/T) site, and -592 (A/C) site in IL-10 gene promoter was significantly different between Chinese children and their British counterparts (P = 0.01). (2) The serum total IgE level was significantly different among children with different allelic sites in IL-4 and IL-10 gene promoters. A allele in IL-10 - 1082 (G/A) site and T allele in IL-10 - 819 (C/T) site -1082 were associated with elevated total serum IgE (P < 0.01, OR = 3.16; P < 0.05, OR = 1.84). (3) The IL-10 level in the supernatant of PBMC culture of children with homozygous genotypes of -819 TT and ATA/ATA in IL-10 gene promoter after stimulation of LPS was the lowest in comparison with those in the supernatant of PBMC culture of children with other genotypes (all P < 0.05). (4) No correlation was found between -589 (C/T) site in IL-4 gene promoter and asthma. There was no significant difference between the increase of IL-4 level in the supernatant of PBMC culture of children with the two different homozygous genotypes of IL-4 gene promoter. CONCLUSIONS: (1) There is no significant correlation between the polymorphism sites in IL-4 and IL-10 gene promoters and the susceptibility to asthma among Chinese. (2) The polymorphism of IL-10 gene promoter may be an important candidate gene for severity of asthma. The allele -819T plays an important role in increase of the total serum IgE by reducing the upregulation of IL-10 gene expression.

Adolescent↗
PubMed2003

Hypermethylation of RASSF1A promoter is associated with the age at starting smoking and a poor prognosis in primary non-small cell lung cancer.

Cigarette smoking is the most common cause of lung cancer. The greatest risk of lung cancer is among those who started smoking early in life and continued throughout their lives. However, the molecular mechanisms responsible for the susceptibility to lung cancer in the young smoker are not clear. Recently, several groups have reported that the hypermethylation of CpG islands is associated with exposure to tobacco smoke. We studied the association between the age at starting smoking and hypermethylation of p14, p16, and RASSF1A promoters in 204 primary non-small cell lung cancer patients. We also examined whether hypermethylation of the RASSF1A promoter is an independent prognostic factor. Methylation rates in the 204 samples were detected in 9% for p14, 27% for p16, and 32% for RASSF1A. There was no relationship between the hypermethylation of p14 and p16 and the age at starting smoking. However, hypermethylation of the RASSF1A promoter was found to be significantly associated with the age at starting smoking (P = 0.001). No relationship was found between the methylation status of the RASSF1A promoter and other smoking variables, such as pack-years, smoking status, and the duration of smoking. The age at starting smoking in patients with hypermethylation of RASSF1A was earlier than that of patients without hypermethylation of the RASSF1A promoter (19 +/- 8 versus 25 +/- 7; P = 0.001). Young smokers who started smoking before age 19 were 4.23 times [95% confidence interval (CI) = 1.03-9.67; P = 0.001] more likely to have hypermethylation of the RASSF1A promoter than smokers who started smoking after the age of 19. Furthermore, hypermethylation of the RASSF1A promoter was found to be associated with a poor prognosis in non-small cell lung cancer patients at stages 1 and 2 (P = 0.02 and 0.01, respectively; Log-rank test). The hazard of failure was approximately 3.27 times higher for patients with hypermethylation of the RASSF1A promoter than for those without hypermethylation of the RASSF1A promoter (95% CI = 1.42-8.71; P = 0.01). Young smokers who started the habit before the age of 19 also had a poorer prognosis than those who started after the age of 19 (hazard ratio = 2.14, 95% CI = 1.22-9.11; P = 0.02). Our results suggest that starting cigarette smoking at an early age is associated with hypermethylation of the RASSF1A promoter and that hypermethylation of the RASSF1A promoter may be an independent prognostic factor in primary non-small cell lung cancer.

Adult↗
PubMed2004

Content analysis of the core promoter region of human genes.

We analyzed an extended core promoter regions covering [-70,+60] segment relative to the transcription start site of human promoters contained in the Eukaryotic Promoter Database. The analysis was made by using the Match program ver. 1.9 with an optimized setting and the TRANSFAC Professional database ver. 7.2. This analysis revealed that the most common transcription factor binding site in the examined collection of core promoters appears to be initiator (characterized by GEN_INI), which is expected. The other less obvious sites found were Spz1, E2F-1, ZF5, and C/EBP. The 'cap' site was also in this most common group. Over-representation of these sites relative to the non-promoter background data ranged from 0.3167 to 32.1645. These sites were characterized by being present in more than 60% of promoter sequences. Interestingly, the TATA-box has been found in only 11.63% of all examined promoters. The study is complemented by separate analyses of promoter groups having different GC content. These additional analyses revealed that the most common promoter elements found also include AP-2, CdxA, Pax-2, SRY, STAT1 and STAT5A. It was also observed that a number of promoter elements show strong preference either for the GC-rich or the GC-poor core promoters.

Binding Sites↗
PubMed2003

[Vascular-specific promoters and cis-regulatory elements].

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.

Gene Expression Regulation, Plant↗
PubMed2006

Health promotion policies in the Republic of Korea and Japan: a comparative study.

Health promotion strategies have been developed and implemented in some Asian countries, particularly in the Republic of Korea (Korea) and Japan. It would help to understand features of health promotion in each country to compare health promotion strategies between them. In this study, using categories developed by HP-Source.net, we conducted a comparative analysis of health promotion strategies between Korea and Japan to understand features of health promotion in each country and contribute to the improvement of population health. One of the goals of Health Plan 2010 is to assess its achievements with numerical targets, which is also the case in Japan. One of the important discussion points involves a decision on the optimal number of targets for evaluation. There is a major difference in the funding of health promotion activities between Korea and Japan. They are financed through the general account in Japan, while in Korea a foundation for health promotion has been established and the income from tobacco tax is ring-fenced for this fund. The database and methodology of HP-Source needs adaptation for global use. We encountered some disadvantages in using its current framework for comparing and analysing information on health promotion in Korea and Japan. It has been recognised that HP-Source could influence the development and implementation of health promotion strategies in other parts of the world. Health promotion tools can help decision makers, planners and researchers to formulate and enhance comprehensive plans. In this study we learned many lessons in expanding policy tools outside of one region to aid the global development of effective health promotion policy and practice.

Health Promotion↗
PubMed1991

The upstream stimulatory factor binds to and activates the promoter of the rat class I alcohol dehydrogenase gene.

The gene encoding rat class I alcohol dehydrogenase (ADH) is expressed primarily in the liver. Recent studies in our laboratories indicate that multiple cellular factors present in the rat liver interact with various regions of the promoter of this gene. One of the regions contains the sequence 5'-CACATG-3' that has an "E box" homology to which a number of transcription factors containing the basic helix-loop-helix motif bind. We now demonstrate that the human transcription factor, upstream stimulatory factor (USF), a basic helix-loop-helix-containing protein, binds to and activates the promoter of the rat class I ADH gene. Electrophoretic mobility shift assays of labeled oligonucleotide containing the 5'-CACATG-3' sequence within the ADH promoter revealed the formation of multiple DNA-protein complexes when nuclear extracts obtained from adult rat liver were used. The binding of proteins to the DNA could be competed away with an oligonucleotide specifying a sequence within the adenovirus major late promoter (MLP) that had previously been shown to bind USF. Similar complexes were observed when electrophoretic mobility shift assays of labeled MLP oligonucleotide were performed with rat liver nuclear extracts. Conversely, nuclear extracts isolated from HeLa cells, cells known to have abundant USF, contain factors that interact with the sequence present in the ADH promoter. This interaction could be competed efficiently by the MLP oligonucleotide. USF synthesized in an in vitro transcription and translation system also binds to the ADH promoter as well as to the MLP. In addition, antiserum directed against USF recognizes factors present in the rat liver nuclear extracts that interact with the ADH promoter. Furthermore, transcription directed from both the ADH and the adenovirus major late promoters was inhibited by an oligonucleotide representing the USF-binding site within the ADH promoter in a cell-free in vitro transcription system. Lastly, an ADH promoter-reporter gene construct was transactivated by an eukaryotic expression vector containing USF in HepG2 cells co-transfected with the two constructs. These experiments demonstrate that USF is present in the rat liver and that it binds to and activates the promoter of the rat class I ADH gene in a sequence-specific manner.

Alcohol Dehydrogenase↗
PubMed1991

Functional characteristics of the rrnD promoters of Escherichia coli.

The function of the tandem rrnD promoters (P1, P2) of Escherichia coli, which are highly efficient in directing rRNA synthesis, was studied in vitro using the strong hybrid promoter PtacI as a reference. One of the characteristics of the rrnD promoters is a pronounced instability of binary and initiating complexes formed with RNA polymerase. The rate of productive complex formation and of chain initiation at these promoters was found to be limited by a step in binary complex transitions with an apparent first-order rate constant equal to 3.9 x 10(-2) s-1. A comparison of this rate with that determined previously by filter binding assays (Gourse, R. (1988) Nucleic Acids Res. 16, 9789-9809) suggests that the rate-limiting step is a conversion of an intermediate species of open complex to one that is efficient in productive initiation. The slow rate of this reaction and the instability of open complexes account for the relatively low competitive strengths of the rrnD promoters. However, this limitation of rrn promoter function changes with promoter occupancy because the rate of chain initiation increased after completion of the first round of initiation. Despite their poor competitive strength, the rrnD promoters are more productive than PtacI at nonlimiting RNA polymerase concentrations. This can be ascribed to the different rates with which RNA polymerases leave PtacI and the rrnD promoters. These functional differences of the promoters are consistent with a "stressed intermediate" model of chain initiation (Straney, D.C., and Crothers, D.M. (1987) J. Mol. Biol. 193, 267-278) which predicts that rapid clearance of the rrn promoters is mechanistically related to the instability of the binary complexes.

Chromosome Deletion↗
PubMed1991

Synergism between steroid response and promoter elements during cell-free transcription.

We have analyzed quantitatively the influence of distal promoter elements on steroid-responsive gene expression in vitro. Functional synergism between enhancer and distal promoter elements was examined using two model promoters, one containing a natural promoter (mouse mammary tumor virus long terminal repeat) and one constructed artificially. Human glucocorticoid receptor (GR) expressed in baculovirus induces transcription from a mouse mammary tumor virus long terminal repeat-containing DNA template. Transcription is diminished by oligonucleotides containing a nuclear factor 1 (NF-1)-binding site or a glucocorticoid/progesterone response element. Quantitative analysis indicates that NF-1 and GR act synergistically during transcriptional activation. In contrast, efficient activation by GR or purified chick progesterone receptor of a glucocorticoid/progesterone response element-linked ovalbumin promoter does not require interaction with the chicken ovalbumin upstream promoter (COUP) element in the distal promoter. Lack of synergism is not related to enhancer strength, since the glucocorticoid/progesterone response elements can be moved further from the promoter or reduced to a single copy response element without increasing the dependence upon COUP. Strong synergism is restored following substitution of an NF-1 distal promoter element for the COUP element in this construct. Our results suggest that synergism between steroid response and distal promoter elements is dependent upon the identity of the promoter element rather than upon the inherent strength of the enhancer element.

Animals↗
PubMed1991

Hormonal control of interacting promoters introduced into cells by retroviruses.

The interaction of promoters contained in a Moloney murine leukemia virus (MoMLV)-based retroviral vector was studied after infection of FTO-2B rat hepatoma and NIH 3T3 mouse fibroblast cells. Segments of the phosphoenolpyruvate carboxykinase (PEPCK) promoter-regulatory region, which are known from previous studies to confer responsiveness to hormones, were linked to the structural genes for bovine growth hormone, amino-3'-glycosyl phosphotransferase (neo), and herpes-virus thymidine kinase and inserted into a MoMLV-based retroviral vector. In vectors in which PEPCK was the only internal promoter, it was the major site of gene transcription. This dominant effect was independent of the orientation of the PEPCK promoter relative to the 5' long terminal repeat of the provirus and was noted with as little as -174 base pairs of the 5'-flanking sequence. NIH 3T3 cells, which do not express the endogenous PEPCK gene, transcribed the transduced PEPCK-chimeric genes at the same high levels as was observed in hepatoma cells. When two promoters were present in the provirus, the expression of chimeric structural genes depended on the relative position and orientation of these genes as well as the type of cell infected by the retrovirus. Differential responses of proviral promoters in infected cells were also observed in the presence of hormones. Dibutyryl cyclic AMP increased the expression of genes linked to the PEPCK promoter in FTO-2B and NIH 3T3 cells, whereas glucocorticoids stimulated transcription from both the PEPCK promoter and the long terminal repeat in FTO-2B cells. The effect of these hormones on transcription of proviral promoters depended on their position relative to the 5' long terminal repeat. In contrast, insulin uniformly inhibited transcription from the PEPCK promoter in a position-independent manner but only in hepatoma cells and not in fibroblasts. In clonally isolated FTO-2B cells infected with a retrovirus, the site of proviral integration was also a major factor determining the expression and hormonal regulation from the internal promoters. The data suggest that the hormonal regulation of the expression of genes contained in retroviral vectors depends on the type and position of the regulatory elements present in the provirus and the lineage of the infected cell.

Animals↗
PubMed1987

[Structural-functional characteristics of Bacillus mesentericus promoters cloned in Bacillus subtilis cells].

Bacillus mesentericus DNA fragments carrying promoters were cloned in Bacillus subtilis. The nucleotide sequences of four promoters, the sites of transcription initiation and the levels of promoter-mediated expression of pPL603 CAT gene at different stages of cell growth were determined. It was identified, that the two promoters (P435 and P442) are the typical sigma 43-RNA polymerase promoters. Promoter P462 possessed the unusual nucleotide sequence and induced the expression of indicator CAT gene at the middle of the stationary phase of cell growth. The next P428 promoter was found to be a complex promoter composed of three overlapping ones: P428-1, P428-2 and P428-3. P428-3 is the sigma 43-specific promoter which revealed the high degree of homology with Bacillus subtilis spoOB gene promoter. We suggest the promoters P428-1 and P428-2 to be sigma 43- and sigma 37-RNA polymerase specific, respectively.

Bacillus↗
PubMed1994

Augmentation of gamma-globin gene promoter activity by carboxylic acids and components of the human beta-globin locus control region.

Butyric acid increases fetal hemoglobin synthesis in adult animals and in erythroid cells in culture and induces the gamma-globin gene promoter in transient expression experiments in K562 cells (McDonagh KT, Nienhuis AW, Blood 78:255a, 1992 [abstr, suppl 1]). We compared the effect of butyrate and other short-chain carboxylic acids in transient expression studies with K562 cells using an expression plasmid bearing a luciferase reporter gene driven by the normal human A gamma-globin gene promoter. Butyrate (4 carbons) increased the activity of the human A gamma-globin gene promoter up to 123 times. Marked augmentation of the normal gamma-promoter activity was also noted with 5-carbon valeric acid (up to 394 times) and 3-carbon propionic acid (up to 129 times). The branched isobutyric acid as well as phenylacetate showed less ability to increase promoter activity. Addition of the tandemly repeated AP-1/NF-E2 (AP) enhancer sequences from hypersensitive site 2 (HS2) of the locus control region (LCR) increased gamma-promoter activity up to 24 times. Addition of a nearby 16-bp conserved motif (CM) in HS2 (Safaya S, Rieder RF, Blood 78:146a, 1992 [abstr, suppl 1]) to the AP-containing plasmid construct further increased gamma-promoter activity. In the presence of butyrate, the plasmid bearing both the AP and CM sequences showed gene expression up to 477 times greater than that of the basal gamma-promoter-driven luciferase plasmid in the absence of inducer. A plasmid bearing the herpes simplex thymidine kinase promoter was also tested and gene expression was markedly increased by the same organic acids. MEL cells responded to butyrate, valerate, and propionate with induction of hemoglobin synthesis. Responses to isobutyrate and 6-carbon caproate required higher concentrations of the compounds. Thus, other short-chain organic acids as well as butyrate increase gamma-promoter activity in the transient expression system, and this activity can be further augmented by incorporating LCR elements into the expression vector. Nonglobin promoters also respond to the same carboxylic acids.

Animals↗
PubMed1993

Polymerase chain reaction amplification and functional characterization of sockeye salmon histone H3, metallothionein-B, and protamine promoters.

The histone H3 (H3), metallothionein-B (MT-B), protamine (PT) promoters of sockeye salmon were cloned by PCR using primers based on the DNA sequences of the rainbow trout promoters. Comparison of the DNA sequences of the sockeye salmon and the rainbow trout histone H3, MT-B, and PT promoters revealed that their DNA sequences and putative transcriptional cis-elements are remarkably conserved. Promoter activity of the sockeye salmon H3, MT-B, and PT promoters were examined by transfection studies using cell lines from fish and human. The H3 and MT-B promoters were shown to be active in all fish cell lines but were only weakly active in HeLa and GM637 cells. The MT-B promoter was also inducible by zinc and cadmium in RTH-149 cells. In contrast, the PT promoter was inactive in all fish cell lines. Transfection experiments also established that the HCMV IE promoter has very strong activity in the various fish cell lines. Our results suggest that the HCMV IE promoter and the sockeye salmon H3 and MT-B promoters are useful for the construction of expression vectors for transgenic and gene transfer studies in fishes.

Animals↗
PubMed1994

Structural and functional characterization of the human decorin gene promoter. A homopurine-homopyrimidine S1 nuclease-sensitive region is involved in transcriptional control.

Decorin is a leucine-rich, chondroitin/dermatan sulfate proteoglycan which binds collagen and growth factors. We have recently completed the genomic organization of human decorin and discovered two alternatively spliced leader exons, designated exon Ia and Ib, in the 5'-untranslated region. Initial analysis of the sequences upstream to these two exons showed that promoter Ia contained only two GC boxes while promoter Ib contained a CAAT and two TATA boxes in close proximity to the transcription start site. To determine if these 5'-flanking sequences exhibited promoter activity, chimeric chloramphenicol acetyltransferase expression plasmids containing the promoter region of either exon Ia or Ib were transfected into HeLa and MG-63 osteosarcoma cells. The results showed that only the region flanking exon Ib was functional. In vitro transcription assay generated two transcripts of 92 and 82 base pairs (bp) indicating that both TATA boxes could be used. Using stepwise 5' deletion analysis we found that the minimum promoter region at -140 bp from the transcription start site, which contained only the CAAT and the two TATA boxes, exhibited strong promoter activity. When a larger construct containing an additional 800 bp of upstream region was tested, a significant increase in transcriptional activity was observed. Interestingly, this promoter region contained several putative binding sites for ubiquitous factors (AP1, AP5, and NF-kappa B) and for transforming growth factor-beta and a 150-bp homopurine/homopyrimidine element with several mirror repeats. When contained in a supercoiled plasmid, this sequence exhibited sensitivity to endonuclease S1, an enzyme that preferentially digests single-stranded DNA. Precise S1 mapping, obtained by direct sequencing of nine distinct S1-generated clones, revealed that in all cases the borders of the sensitive sequence resided within the pur/pyr segment. We propose that this region of the promoter could adopt an intramolecular hairpin triplex structure in vivo and may play a role in the chromatin organization at the decorin gene locus. In addition, this region was able to up-regulate a minimal heterologous promoter in transient transfection assays. The results show that the structure of the decorin gene promoter is different from that of any other proteoglycan promoter characterized so far and indicate that the pur/pyr segment plays a role in the regulation of gene transcription.

Base Sequence↗