Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “PIPERIDINES”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,621 records · Page 90Linked to original sources
PubMed1995

Local anesthetics potently block a potential insensitive potassium channel in myelinated nerve.

Effects of some local anesthetics were studied in patch clamp experiments on enzymatically demyelinated peripheral amphibian nerve fibers. Micromolar concentrations of external bupivacaine depolarized the excised membrane considerably. The flicker K+ channel was found to be the most sensitive ion channel to local anesthetics in this preparation. Half-maximum inhibiting concentrations (IC50) for extracellular application of bupivacaine, ropivacaine, etidocaine, mepivacaine, lidocaine, and QX-314 were 0.21, 4.2, 8.6, 56, 220, and > 10,000 microM, respectively. The corresponding concentration-effect curves could be fitted under the assumption of a 1:1 reaction. Application from the axoplasmic side resulted in clearly lower potencies with IC50 values of 2.1, 6.6, 16, 300, 1,200, and 1,250 microM, respectively. The log(IC50)-values of the local anesthetics linearly depended on the logarithm of their octanol:buffer distribution coefficients with two regression lines for the piperidine derivatives and the standard amino-amides indicating an inherently higher potency of the cyclic piperidine series. Amide-linked local anesthetics did not impair the amplitude of the single-channel current but prolonged the time of the channel to be in the closed state derived as time constants tau c from closed-time histograms. With etidocaine and lidocaine tau c was 133 and 7.2 ms, and proved to be independent of concentration. With the most potent bupivacaine time constants of wash in and wash out were 1.8 and 5.2 s for 600 nM bupivacaine. After lowering the extracellular pH from 7.4 to 6.6, externally applied bupivacaine showed a reduced potency, whereas at higher pH of 8.2 the block was slightly enhanced. Intracellular pH of 6.4, 7.2, 8.0 had almost no effect on internal bupivacaine block. It is concluded that local anesthetics block the flicker K+ channel by impeding its gating but not its conductance. The slow blocker bupivacaine and the fast blocker lidocaine compete for the same receptor. Lipophilic interactions are of importance for blockade but besides a hydrophobic pathway, there exists also a hydrophilic pathway to the binding site which could only be reached from the cytoplasmic side of the membrane. Under physiological conditions, blockade of the flicker K+ channel which is more sensitive to bupivacaine than the Na+ channel might lead via membrane depolarization and the resulting sodium channel inactivation to a pronounced block of conduction in thin fibers.

Anesthetics, Local↗
PubMed1989

Non-B DNA structure: preferential target for the chemical carcinogen glycidaldehyde.

The effect of DNA conformation on the reaction specificities of the chemical carcinogen glycidaldehyde (GDA) was examined. Supercoiled plasma DNA harboring a poly(dG)-poly(dC) tract, which folds sharply into halves from the center of the tract to form a tetra-stranded structure containing either a dG.dG.dC triplex structure in the presence of Mg2+ or a dC+.dC.dC triplex structure in the absence of Mg2+ was chosen as the reaction substrate. The reactive sites alkylated by GDA were determined at a single base resolution after these sites were specifically cleaved with a combination of either the hydrazine and piperidine or formic acid and piperidine reactions. The results show that at pH 5-7, GDA reacts preferentially with DNA bases that are involved in the altered DNA conformations. Interestingly, in addition to the known reaction of GDA with guanine residues, it was also found to be highly reactive with specific cytosine residues that reside in the altered DNA conformations. These GDA-reactive cytosine residues were unpaired as judged by their reactivity with the unpaired DNA base specific probe, chloroacetaldehyde. Therefore, it appears that DNA conformation plays a major role in determining the reaction specificities of GDA.

Aldehydes↗
PubMed1989

Site-specific DNA damage induced by nickel(II) ion in the presence of hydrogen peroxide.

DNA damage induced by Ni(II) plus H2O2 was investigated by a DNA sequencing technique using 32P-5'-end-labeled DNA fragments obtained from human c-Ha-ras-1 protooncogene. Ni(II) induced strong DNA cleavage in the presence of H2O2 even without piperidine treatment. Piperidine-labile sites were induced frequently at cytosine, thymine and guanine residues, and rarely at adenine residue. Diethylene-triamine N,N,N',N",N"-pentaacetic acid inhibited the DNA damage. In experiments with singlet oxygen scavengers, sodium azide and dGMP inhibited the DNA damage completely, whereas neither 1,4-diazabicyclo[2.2.2]octane nor dimethylfuran inhibited it. Among hydroxyl radical scavengers, dimethylsulfoxide and sodium formate inhibited the DNA damage considerably, whereas ethanol and mannitol did not. Methionine and methional inhibited the DNA damage completely. The results suggest that Ni(II) ion binds to DNA and subsequently reacts with H2O2 to form active species, which cause DNA damage. The possibility of Ni(II) plus H2O2-mediated DNA damage in vivo is discussed relative to the molecular mechanism of nickel carcinogenesis.

Base Sequence↗
PubMed1981

The effect of 4-substitution on the carcinogenicity of nitrosopiperidine.

Nitrosopiperidine and three derivatives substitute in the 4-position were fed to female F 344 rats in drinking water at equimolar concentration. The substituents were phenyl, cyclohexyl and tertiary-butyl. Like nitroso-piperidine, the t-butyl-and phenyl-derivatives induced tumors of the upper gastrointestinal tract (esophagus, forestomach and tongue), but the animals given nitroso-piperidine died earlier and after a smaller total dose. The rats given 4-phenylnitrosopiperidine also had a high incidence of tumors of the liver, both hepatocellular carcinomas and angiosarcomas. These tumors were absent from untreated animals of this strain. In contrast, no induced tumors were observed in rats treated with 4-cyclohexylnitrosopiperidine.

Animals↗
PubMed1987

Chemical stability of oligonucleotides containing the acetylated and deacetylated adducts of the carcinogen N-2-acetylaminofluorene.

We have prepared and characterized the single-stranded oligonucleotide heptamer 5'-ATCCGTC-3' in which the lone guanine of the oligonucleotide is modified at the C8 position with either the acetylated or deacetylated form of the carcinogenic adduct 2-aminofluorene. These two lesions represent the two major adducts formed upon the in vivo administration of the potent experimental carcinogen N-2-acetylaminofluorene. The stability of the adducts was compared by analyzing the oligonucleotide for strand scission or depurination by polyacrylamide gel electrophoresis following treatment under either neutral, acidic or basic conditions or incubation in the presence of piperidine. The results show that both adducts are stable near neutral pH but that the deacetylated adduct is less stable than the acetylated adduct to either basic or acidic conditions. Both adducts are equally susceptible to piperidine. The method of analysis described here could prove useful for characterizing other adduct structures, thus providing a general procedure to determine the stability of a variety of lesions in DNA.

2-Acetylaminofluorene↗
PubMedDate not supplied

Pyrolytic fate of piperidinocyclohexanecarbonitrile, a contaminant of phencyclidine, during smoking.

The pyrolysis products of 1-(1-piperidino)cyclo-hexanecarbonitrile (PCC), the major contaminant of illicit phencyclidine (PCP), have not been previously reported. In order to quantify PCC in mainstream smoke as well as to identify the pyrolysis products, [3H]piperidino-[14C]cyano-PCC was synthesized. Marijuana placebo cigarettes were impregnated with this double-labeled PCC and burned with an apparatus that simulated smoking. The mainstream smoke was passed through a series of traps containing glass wool, H2SO4, or NaOH. Approximately 75% of the 3H was collected in these traps, and 46, 11, and 5% of the 14C was found in the glass wool, H2SO4, and NaOH traps, respectively. Contents of the traps were analyzed by GC/MS. The glass wool trap contained 1-(1-piperidino)-1-cyclo-hexene, PCC, piperidine, and N-acetylpiperidine, and cyanide ion was detected in all three traps. Approximately 47% of the PCC was found intact in mainstream smoke. Approximately 58% was cleaved to form cyanide and 1-(1-piperidino)-1-cyclohexene. The latter was further broken down to cyclohexanone (which represented 21% of the starting material), piperidine (29%), and N-acetylpiperidine (7%), and about 2% remained intact.

Drug Contamination↗
PubMed1994

Laboratory and field trials of four repellents with Culex pipiens (Diptera: Culicidae).

During Operation "Desert Shield," 16 volunteers field-tested four insect repellents (deet, the lactone CIC-4, and the piperidine compounds AI3-37220 and AI3-35765) against biting mosquitoes at King Fahd Airport, Eastern Province, Saudi Arabia. CIC-4 and AI3-37220 (25% wt/vol) provided effective (> 90%) protection against bites for 4 h. Deet and AI3-35765 protected for only 2 h. The compounds subsequently were evaluated for repellency against laboratory-reared Culex pipiens L. CIC-4 was more effective than deet, AI3-37220, or AI3-35765 at the ED50 but not at the ED95 level in initial sensitivity tests using human volunteers. At the ED95 level, deet provided significantly better protection than either piperidine compound. In laboratory duration tests, AI3-37220 provided 8 h of effective (> 90%) protection against Cx. pipiens bites, deet and AI3-35765 7 h of protection, and CIC-4 2 h of protection.

Animals↗
PubMed1985

Solid-phase methods for sequencing of nucleic acids I. Simultaneous sequencing of different oligodeoxyribonucleotides using a new, mechanically stable anion-exchange paper.

A solid-phase method for simultaneous sequencing of large numbers of oligodeoxyribonucleotides has been developed using a new, mechanically stable anion-exchange paper. The excellent mechanical properties of the polymer allow the processing of several paper segments in one reaction vessel or to carry out all necessary operations on a larger area of the paper. In addition, DNA material can be chemically eluted from the new carrier during the piperidine reaction, thus avoiding salt elution of DNA and subsequent ethanol precipitation steps - a prerequisite for sequencing oligonucleotides. The approach involves 7 operations including: i) immobilization; ii) washing; iii) modification; iv) washing; v) sorting of the papers; vi) piperidine reaction and chemical elution and vii) lyophilization. All steps can be carried out in 4 to 5 hours independently of the number of oligonucleotides to be sequenced. It is also possible to sequence small oligonucleotides with 3 to 4 base pairs. The method can be fully automated.

Automation↗
PubMed1987

Synthesis and properties of oligodeoxynucleotides with an AP site at a preselected position.

A general synthesis of a deoxyoligonucleotide with an AP site at a preselected sequence is described. Deoxyuridine is introduced during routine oligonucleotide syntheses of d(TTTUTTTT) and d(AAAAGTTUAAAACAT). Treatment with uracil DNA-glycosylase produces d(TTTrTTTT), where r = deoxyribose, and d(AAAAGTTprpAAAACAT). KM and Vmax are: d(TTTUTTTT), 7.3 X 10(-9)M and 2.0 X 10(-9) mumol/min; d(AAAAGTTUAAAACAT), 1.5 X 10(-8) M and 6.4 X 10(-9) mumol/min. Both d(AAAAGTTprpAAAACAT) and d(TTTprpTTTT) undergo rapid beta-elimination in 1 M piperidine at 25 degrees giving two oligonucleotide fragments, d(AAAAGTTpr') and d(pAAAACAT), where r' = -O-CH2-CHOH-CH=CH-CHO (or its hemiacetal form). The fragment, d(AAAAGTTpr'), which can be isolated by reverse phase chromatography, is resistant to the 3'----5' exonuclease activity of snake venom phosphodiesterase. Endonucleolytic hydrolysis of the penultimate phosphodiester occurs removing pTpr' and generating a normal 3'-OH end. In 1 M piperidine at 90 degrees two beta-eliminations occur producing the oligonucleotides d(AAAAGTTp) and d(pAAAACAT) from d(AAAAGTTprpAAAACAT); d(TTTp) and d(pTTTT) from d(TTTprpTTTT).

Base Sequence↗
PubMed1987

Sequence-specific recognition, photocrosslinking and cleavage of the DNA double helix by an oligo-[alpha]-thymidylate covalently linked to an azidoproflavine derivative.

A 3-azidoproflavine derivative was covalently linked to the 5'-end of an octathymidylate synthesized with the [alpha]-anomers of the nucleoside. Two target nucleic acids were used for this substituted oligo-[alpha]-thymidylate: a 27-mer single-stranded DNA fragment containing an octadeoxyadenylate sequence and a 27-mer duplex containing eight contiguous A.T base pairs with all adenines on the same strand. Upon visible light irradiation the octa-[alpha]-thymidylate was photocrosslinked to the single-stranded 27-mer. Chain breaks were induced at the crosslinked sites upon piperidine treatment. From the location of the cleavage sites on the 27-mer sequence it was concluded that a triple helix was formed by the azidoproflavine-substituted oligo-[alpha]-thymidylate with its complementary oligodeoxyadenylate sequence. When the 27-mer duplex was used as a substrate cleavage sites were observed on both strands after piperidine treatment of the irradiated sample. They were located at well defined positions which indicated that the octathymidylate was bound to the (dA)8.(dT)8 sequence in parallel orientation with respect to the (dA)8-containing strand. Specific binding of the [alpha]-octathymidylate involved local triple strand formation with the duplex (dA)8.(dT)8 sequence. This result shows that it is possible to synthesize sequence-specific molecules which specifically bind oligopurine-oligopyrimidine sequences in double-stranded DNA via recognition of the major groove hydrogen bonding sites of the purines.

Acridines↗
PubMed1992

Photooxidation of d(TpG) by phthalocyanines and riboflavin. Isolation and characterization of dinucleoside monophosphates containing the 4R* and 4S* diastereoisomers of 4,8-dihydro-4-hydroxy-8-oxo-2'-deoxy-guanosine.

Phthalocyanine mediated photosensitization of 2'-deoxyguanosine (dG) in oxygen saturated aqueous solution has previously been shown to result in the addition of molecular oxygen to the guanine base generating the 4R* and 4S* diastereoisomers of 4,8-dihydro-4-hydroxy-8-oxo-2'-deoxyguanosine (dO) (the asterisk denotes unambiguous assignment of the 4R and 4S diastereoisomers). The data presented here show that the same guanine modified bases are generated in a 1:1 ratio when thymidylyl-(3',5')-2'-deoxyguanosine (d(TpG)) is similarly photo-oxidized. These modified dinucleoside monophosphates, labelled d(TpO)-A and -B, have been isolated by high performance liquid chromatography and characterized by proton NMR spectrometry, fast atom bombardment mass spectrometry, and enzymatic digestions. Photosensitization in D2O instead of H2O leads to an increase in the rate of d(TpO) formation that is consistent with a type II (singlet oxygen) reaction mechanism. Three interesting properties of these modified dinucleoside monophosphates are: i) the rate of their digestion with spleen phosphodiesterase is greatly reduced relative to d(TpG), ii) they are not digested by snake venom phosphodiesterase, and iii) they are stable to 1.0 M piperidine at 90 degrees C for 30 min. The latter observation indicates that 4,8-dihydro-4-hydroxy-8-oxoguanine is not a base lesion responsible for the strand breaks observed following hot piperidine treatment of DNA exposed to type II photosensitizers or chemically generated singlet oxygen.

Chromatography, High Pressure Liquid↗
PubMed1998

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.

Aflatoxin B1↗
PubMed1978

Base-specific reactions useful for DNA sequencing: methylene blue--sensitized photooxidation of guanine and osmium tetraoxide modification of thymine.

Exposure of DNA to methylene blue and visible or ultraviolet light causes guanine-specific modification, and subsequent treatment with piperidine leads to chain cleavage at each guanine residue. Treatment of DNA with osmium tetraoxide in dilute pyridine leads to thymidine-specific modification, and subsequent treatment with piperidine leads to chain cleavage at the modified thymidine residues. Both reactions can be used in conjunction with other base specific modifications described by Maxam and Gilbert (1) for the determination of the nucleotide sequence in DNA.

Base Sequence↗
PubMed1988

Alfentanil pharmacokinetics and metabolism in humans.

The metabolism of alfentanil was studied in three healthy subjects after a 1-h infusion of 2.5 mg alfentanil-3H. One of the subjects was a poor hydroxylator of debrisoquine. Pharmacokinetic parameters were similar in the three subjects and were in the same range as those reported for volunteers. The majority of the administered radioactivity was excreted in the urine (90% of the dose), but unchanged alfentanil represented only 0.16-0.47% of the dose. Alfentanil and metabolites were characterized by HPLC co-chromatography with reference compounds and/or by mass spectrometry and quantified by GLC and radio-HPLC. The main metabolic pathway was N-dealkylation at the piperidine nitrogen, with formation of noralfentanil (30% of the dose). Other Phase I pathways were aromatic hydroxylation, N-dealkylation of the piperidine ring from the phenylpropanamide nitrogen, O-demethylation, and amide hydrolysis followed by N-acetylation. Glucuronic acid conjugation of aromatic or aliphatic hydroxyl functions was the main Phase II pathway. The second major metabolite was the glucuronide of N-(4-hydroxyphenyl) propanamide (14% of the dose). The metabolite pattern in these subjects was qualitatively very similar to that described previously in rats and dogs. Differences in the mass balance of urinary metabolites between the three subjects were very small, and there was no qualitative or quantitative evidence for a deficiency in the metabolism of alfentanil in the subject who was a poor metabolizer of debrisoquine.

Alfentanil↗
PubMed2005

Classic benzodiazepines modulate the open-close equilibrium in alpha1beta2gamma2L gamma-aminobutyric acid type A receptors.

BACKGROUND: Classic benzodiazepine agonists induce their clinical effects by binding to a site on gamma-aminobutyric acid type A (GABAA) receptors and enhancing receptor activity. There are conflicting data regarding whether the benzodiazepine site is allosterically coupled to gamma-aminobutyric acid binding versus the channel open-close (gating) equilibrium. The authors tested the hypothesis that benzodiazepine site ligands modulate alpha1beta2gamma2L GABAA receptor gating both in the absence of orthosteric agonists and when the orthosteric sites are occupied. METHODS: GABAA receptors were recombinantly expressed in Xenopus oocytes and studied using two-microelectrode voltage clamp electrophysiology. To test gating effects in the absence of orthosteric agonist, the authors used spontaneously active GABAA receptors containing a leucine-to-threonine mutation at residue 264 on the alpha1 subunit. To examine effects on gating when orthosteric sites were fully occupied, they activated wild-type receptors with high concentrations of a partial agonist, piperidine-4-sulfonic acid. RESULTS: In the absence of orthosteric agonists, the channel activity of alpha1L264Tbeta2gamma2L receptors was increased by diazepam and midazolam and reduced by the inverse benzodiazepine agonist FG7142. Flumazenil displayed very weak agonism and blocked midazolam from further activating mutant channels. In wild-type receptors activated with saturating concentrations of piperidine-4-sulfonic acid, midazolam increased maximal efficacy. CONCLUSIONS: Independent of orthosteric site occupancy, classic benzodiazepines modulate the gating equilibrium in alpha1beta2gamma2L GABAA receptors and are therefore allosteric coagonists. A Monod-Wyman-Changeux coagonist gating model quantitatively predicts these effects, suggesting that benzodiazepines minimally alter orthosteric ligand binding.

Algorithms↗
PubMed2001

Behavioral and neurochemical effects of 3-OH-pip-BTCP, an active metabolite of BTCP in rats.

The effects of N-[1-(2-benzo[b]thiophenyl)cyclohexyl]piperidin-3-ol (3-OH-pip-BTCP), an active metabolite of N-[1-(2-benzo[b]thiophenyl)cyclohexyl]piperidine (BTCP) was examined on locomotor activity and dopamine (DA) levels in the nucleus accumbens (NAcc) in rats. To study the stimulant action of 3-OH-pip-BTCP, rats were placed into activity chambers and injected with the compound (0-40 mg/kg, i.p.). To measure the effects of 3-OH-pip-BTCP on DA levels, rats were implanted with microdialysis probes into the NAcc and the same doses as used in the locomotor activity experiment were administered i.p. 3-OH-pip-BTCP dose-dependently increased locomotor activity and DA levels in the NAcc which lasted 4-5 h at 20 and 40 mg/kg. The results suggest that 3-OH-pip-BTCP exerts long lasting stimulating effects on locomotion and extracellular DA levels in the NAcc, suggesting that 3-OH-pip-BTCP contributes importantly to the pharmacological effects of its parent compound, BTCP.

Animals↗
PubMed2003

3-OH-pip-BTCP, a metabolite of the potent DA uptake blocker BTCP, exerts cocaine-like action in rats.

A previous study showed that N-[1-(2-benzo[b]thiophenyl)cyclohexyl]piperidin-3-ol (3-OH-pip-BTCP), an active metabolite of the potent dopamine reuptake inhibitor N-[1-(2-benzo[b]thiophenyl)cyclohexyl]piperidine (BTCP), exhibits stimulant effects in rats (i.e. increases dopamine levels in the nucleus accumbens and increases locomotion). The present study sought to further characterize the behavioral profile of 3-OH-pip-BTCP, specifically, its interaction with cocaine-maintained behavior. Cocaine self-administration was examined in 3-OH-pip-BTCP pretreated rats. 3-OH-pip-BTCP (0-20 mg/kg, i.p.) dose-dependently decreased cocaine self-administration. Additionally, 3-OH-pip-BTCP (10 mg/kg) shifted the cocaine dose-response to the left. Together, these results suggest that 3-OH-pip-BTCP shares similar reinforcing effects with cocaine and therefore may serve as a substitutive drug and possible agonist therapy for cocaine addiction.

Animals↗
PubMed2003

t-3-Isopropyl-1-methyl-r-2,c-6-diphenylpiperidin-4-one thiosemicarbazone.

The piperidine ring in the title compound, C(22)H(28)N(4)S, exhibits a chair conformation. The thiosemicarbazone moiety adopts an extended conformation, and the planar phenyl rings are oriented equatorially with respect to the piperidine ring. Two intermolecular hydrogen bonds involving the S atom form molecular pairs, and the crystal structure is stabilized by weak C-H.pi interactions in addition to van der Waals forces.

Journal Article↗