Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Leukemia Inhibitory Factor”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 163 records · Page 9Linked to original sources
PubMed1994

Role of leukemia inhibitory factor and its receptor in mouse primordial germ cell growth.

The pleiotropic cytokine leukemia inhibitory factor (LIF) is able to promote the growth of mouse primordial germ cells (PGCs) in culture. It is unclear whether LIF acts directly on PGCs or indirectly via feeder cells or embryonic somatic cells. To understand the role of LIF in PGC growth, we have carried out molecular and cell culture analyses to investigate the role of both the LIF ligand and its receptor in PGC development. LIF is able to stimulate PGC growth independently of the presence of feeder cells supporting the hypothesis that LIF acts directly on PGCs to promote their growth. We show here that transcripts for the low-affinity LIF receptor (LIFR), an integral component of the functional LIF receptor complex, are expressed in the developing gonad. Fluorescence-activated cell sorter (FACS) analysis, using an anti-LIFR antiserum, demonstrates that LIFR is present on the surface of PGCs, suggesting that PGCs are likely to be a direct target of LIF action in culture. Signalling via LIFR is essential for PGC growth in culture since the anti-LIFR antiserum, which blocks LIF binding to its receptor, abolishes PGC survival in culture. Two LIF-related cytokines, namely oncostatin M and ciliary neurotrophic factor, can also promote PGC growth in culture in addition to LIF. Thus one or more of these LIFR-dependent cytokines may play an important role in PGC development in mice.

Animals↗
PubMed1998

Functional map of a placenta-specific enhancer of the human leukemia inhibitory factor receptor gene.

We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (-4625/-4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (-4617/-4602) with nuclear extract was competed by a known Oct-1 oligo and supershifted by Oct-1 antibody. Specific binding of region B (-4549/-4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (-4464/-4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE, CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary of PSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of approximately 160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in human LIFR gene.

Binding Sites↗
PubMed1996

Leukemia inhibitory factor induces mechanical allodynia but not thermal hyperalgesia in the juvenile rat.

Systemic administration or local injection to the rat hindpaw of leukemia inhibitory factor induced a prolonged, dose dependent, mechanical hypersensitivity of the hindpaw flexion withdrawal reflex. Mechanical stimuli which were innocuous prior to leukemia inhibitory factor administration, evoked a rapid hindpaw withdrawal reflex indicative of mechanical allodynia. Pre-administration of anti-leukemia inhibitory factor antibodies prevented this behavioural hypersensitivity. Hindpaw sensitivity to a noxious thermal stimulus was unaffected by leukemia inhibitory factor administration. Anti-leukemia inhibitory factor had no effect upon hindpaw withdrawal thresholds when injected alone nor influenced the mechanical hypersensitivity produced by a subcutaneous injection of nerve growth factor. Injection of the closely related cytokine ciliary neurotrophic factor did not affect mechanical or thermal reflex withdrawal thresholds. Elevation of the neuroactive cytokine leukemia inhibitory factor following peripheral nerve injury may be a contributory factor to the pathogenesis of neuropathic pain.

Age Factors↗
PubMed2001

Expression of leukemia inhibitory factor in human nerve following injury.

In animal models of peripheral nerve injury, leukemia inhibitory factor (LIF) is normally expressed at very low levels. Following nerve injury, its expression is rapidly increased in the nerve at the injury site and promotes both sensory and motor neuron survival. Once normal nerve function is restored, LIF expression returns to negligible levels. For this reason, LIF is considered to be a peripheral nerve trauma factor. We wished to determine whether LIF is also upregulated in human nerves following trauma and whether it is expressed in neuromas of varying age. Immunohistochemical staining for the presence of LIF was performed on injured and control human nerves from a number of subjects. Results demonstrate that LIF expression is increased in nerves within hours of injury and, in the case of neuroma formation, can persist for several years. LIF immunoreactivity was consistently found in Schwann cells, in peripheral nerve axons, and, at stages when an inflammatory response was present, also in neutrophils, mast cells, macrophages, and blood vessel walls. The level of staining within the connective tissue of injured nerves was elevated compared to control nerves, which may be due to the presence of LIF bound to the soluble secreted form of the LIF receptor. Whether the continued expression of LIF is unhealed injured nerves promotes the development of neuromas remains to be resolved.

Axons↗
PubMed1998

Expression of leukemia inhibitory factor and its receptor in breast cancer: a potential autocrine and paracrine growth regulatory mechanism.

Leukemia inhibitory factor (LIF) is a pluripotent cytokine which has a diverse array of effects on hematopoietic and epithelial cells. Depending on the nature of the target cells, these effects can be growth-stimulatory or growth-inhibitory. Receptors for leukemia inhibitory factor (LIFR) have been identified on a variety of hematopoietic and epithelial cells. We have recently demonstrated in vitro growth stimulation of human breast cancer cells, both primary tumors and cultured cell lines, by LIF. To begin to understand the in vivo relevance of these observations, we investigated the expression of LIF and LIFR in human breast cancer specimens. Specimens from 50 cases were immunostained with mouse monoclonal antibodies D62.3 and M1 (to stain for LIF and LIFR, respectively). LIF expression was observed in 78% of the specimens and correlated with favorable biological features, i.e. low S-phase fraction (SPF) (P = 0.001) and diploidy (P = 0.08). LIFR expression was observed in 80% of the tumors and correlated with the presence of estrogen receptor (ER) (P = 0.04) and diploidy (P = 0.07). Coexpression of LIF and LIFR was associated with diploidy (P = 0.02) and low SPF (P = 0.05). LIF staining was primarily cytoplasmic whereas LIFR staining was cytoplasmic in the majority of cases and membranous in a minority of cases. The presence of LIFR in the primary tumor specimens correlated with the growth stimulation of tumor cells (derived from the same specimens) by exogenous LIF in methylcellulose colony assays. The findings support a widespread but probably complex role for LIF and LIFR in breast tumor growth regulation which should be investigated in greater detail in larger cohorts of tumors.

Breast Neoplasms↗
PubMed1999

Cytoplasmic domains of the leukemia inhibitory factor receptor required for STAT3 activation, differentiation, and growth arrest of myeloid leukemic cells.

Leukemia inhibitory factor (LIF) induces growth arrest and macrophage differentiation of mouse myeloid leukemic cells through the functional LIF receptor (LIFR), which comprises a heterodimeric complex of the LIFR subunit and gp130. To identify the regions within the cytoplasmic domain of LIFR that generate the signals for growth arrest, macrophage differentiation, and STAT3 activation independently of gp130, we constructed chimeric receptors by linking the transmembrane and intracellular regions of mouse LIFR to the extracellular domains of the human granulocyte macrophage colony-stimulating factor receptor (hGM-CSFR) alpha and betac chains. Using the full-length cytoplasmic domain and mutants with progressive C-terminal truncations or point mutations, we show that the two membrane-distal tyrosines with the YXXQ motif of LIFR are critical not only for STAT3 activation, but also for growth arrest and differentiation of WEHI-3B D+ cells. A truncated STAT3, which acts in a dominant negative manner was introduced into WEHI-3B D+ cells expressing GM-CSFRalpha-LIFR and GM-CSFRbetac-LIFR. These cells were not induced to differentiate by hGM-CSF. The results indicate that STAT3 plays essential roles in the signals for growth arrest and differentiation mediated through LIFR.

Animals↗
PubMed1996

Localization of mRNA for leukemia inhibitory factor receptor in the adult rat brain.

The distribution of leukemia inhibitory factor receptor (LIFR) mRNA in the adult rat brain was examined by in situ hybridization technique. The intense signals of LIFR mRNA were restricted to specific brain regions relevant to the motor and sensory systems. The moderate expression of LIFR mRNA was observed in several brain regions, including the cerebral cortex, hippocampus, thalamus, hypothalamus and cerebellum. Most of the signals of LIFR mRNA were detected on likely neuronal cells. These findings suggest the possibility that LIF has potential actions on the neuronal cells in the central nervous system of the adult rat.

Animals↗
PubMed2000

Regulation of neuronal differentiation in human CNS stem cell progeny by leukemia inhibitory factor.

The generation of diverse types of neural cells during development occurs through the progressive restriction of the fate potential of neuroepithelial progenitor cells. This process is controlled by factors intrinsic and extrinsic to the cell. While the effect of extrinsic cues on multipotent stem cells of the murine central nervous system (CNS) is becoming clearer, little is known of neural stem cells of human origin. We sought to establish the roles played by two cytokines, leukemia inhibitory (LIF) and ciliary neurotrophic factor (CNTF), and by nerve growth factor (NGF) and platelet-derived growth factor (PDGF) in regulating neuronal and astroglial differentiation in cultured embryonic diencephalic human stem cells. While NGF did not influence either neuronal or glial formation, PDGF surprisingly decreased the percentage of stem cell-generated neurons, an effect opposite to that observed in murine progenitors. Furthermore, while we confirmed the known ability of LIF and CNTF to support astroglial differentiation, we also observed that, in contrast with their murine counterparts, the fraction of CNS stem cell-generated neurons in human cultures was enhanced twofold in the presence of both cytokines. These findings highlight important differences between humans and rodents in regard to the way epigenetic cues regulate the function of neural stem cells.

Astrocytes↗
PubMed1993

The effects of leukemia inhibitory factor and interleukin 6 on the growth of acute myeloid leukemia cells.

The effects of leukemia inhibitory factor (LIF) and interleukin 6 (IL-6) on blast progenitors from acute myeloblastic leukemia (AML) were examined using a blast colony assay in a serum-free culture system. LIF and IL-6 stimulated colony growth in 2 and 5, respectively, of 11 cases studied. The simultaneous addition of LIF with granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 3 (IL-3) or IL-6 produced a statistically significant increase of colony numbers in 3, 6 and 7 of 11 cases, respectively. Numbers of colonies increased significantly when IL-6 was added simultaneously with GM-CSF or IL-3 in 5 and 4 of 11 cases, respectively. LIF or IL-6 used in the primary culture did not significantly change the numbers of secondary colonies compared to GM-CSF. Previous exposure to LIF and IL-6 did not alter cellular phenotype or morphology, indicating that LIF and IL-6 did not induce the differentiation of fresh AML blasts.

Adult↗
PubMed1998

Asparagine-linked glycosylation of the rat leukemia inhibitory factor expressed by simian COS7 cells.

The leukemia inhibitory factor (LIF) is a secretory glycoprotein and a pluripotent growth factor which acts in diverse cell systems. LIF has been reported to be heavily glycosylated. In this paper, we examine the transient expression of rat LIF (rLIF) in COS7 cells and its glycosylation by a PNGaseF treatment and lectin blot. rLIF expression in COS7 cells resulted in seven molecular species being produced with zero to six N-glycosyl moieties. Mutated rLIF proteins with substitutions at the seven possible N-glycosylation sites were also expressed. An analysis of the molecular weight of the mutated rLIF confirmed the six N-glycosylation sites. Bioassays of mouse leukemia cell lines were performed to analyze the contribution of the glycosyl moieties to their functions. We found that the glycosyl moieties at each of the N-glycosylation sites were not essential to their function of the protein, but the reduced functions to promote the proliferation of DA-1a cells that had been observed for some mutants suggests a biochemical role for the in vitro function.

Amidohydrolases↗
PubMed1988

Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor.

A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the murine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors.

Amino Acid Sequence↗
PubMed1997

Distinct roles for leukemia inhibitory factor receptor alpha-chain and gp130 in cell type-specific signal transduction.

Leukemia inhibitory factor (LIF) induces a variety of disparate biological responses in different cell types. These responses are thought to be mediated through the functional LIF receptor (LIFR), consisting of a heterodimeric complex of LIFR alpha-chain (LIFRalpha) and gp130. The present study investigated the relative capacity of the cytoplasmic domains of each receptor subunit to signal particular responses in several cell types. To monitor the signaling potential of LIFRalpha and gp130 individually, we constructed chimeric receptors by linking the extracellular domain of granulocyte colony-stimulating factor receptor (GCSFR) to the transmembrane and cytoplasmic regions of either LIFRalpha or gp130. Both chimeric receptors and the full-length GCSFR in expressed in M1 myeloid leukemic cells to measure differentiation induction, in embryonic stem cells to measure differentiation inhibition, and in Ba/F3 cells to measure cell proliferation. Our results demonstrated that whereas GCSFR-gp130 receptor homodimer mediated a GCSF-induced signal in all three cell types, the GCSFR-LIFRalpha receptor homodimer was only functional in embryonic stem cells. These findings suggest that the signaling potential of gp130 and LIFRalpha cytoplasmic domains may differ depending upon the tissue and cellular response initiated.

Antigens, CD↗
PubMed1994

Leukemia inhibitory factor induces neurotransmitter switching in transgenic mice.

Leukemia inhibitory factor (LIF) is a cytokine growth factor that induces rat sympathetic neurons to switch their neurotransmitter phenotype from noradrenergic to cholinergic in vitro. To test whether LIF can influence neuronal differentiation in vivo, we generated transgenic mice that expressed LIF in pancreatic islets under the control of the insulin promoter and evaluated the neurotransmitter phenotype of the pancreatic sympathetic innervation. We also used the insulin promoter to coexpress nerve growth factor in the islets, which greatly increased the density of sympathetic innervation and facilitated analysis of the effects of LIF. Our data demonstrate that tyrosine hydroxylase and catecholamines declined and choline acetyltransferase increased in response to LIF. We conclude that LIF can induce neurotransmitter switching of sympathetic neurons in vivo.

Aging↗
PubMed1998

Functions of the N-glycans of rat leukemia inhibitory factor expressed in Chinese hamster ovary cells.

Leukemia inhibitory factor (LIF) is a pluripotent growth factor which acts in various cell systems. LIF is a glycoprotein containing six putative N-glycosylation sites. We established Chinese hamster ovary (CHO) cell lines to evaluate the biological roles of the N-glycosylation in rat LIF (rLIF). The bioactivity of rLIF was evaluated in two different bioassay systems using F9 and DA-1a cells. Employing site directed mutagenesis, six N-glycosylation-deficient LIF mutants were generated by replacing each asparagine residue (N) (at positions N9, N34, N63, N73, N96, and N116) by glutamine (Q). The resultant mutants showed similar activity in the bioassay using F9 cells. However, N34Q was about 3 times more potent than the wild-type rLIF in the assay using DA-1a cells. These findings suggest that the presence of N-glycan at N34 suppresses cell proliferation. In contrast, N63Q was about 2.5 times less potent than the wild-type rLIF indicating the pivotal role of N63 glycosylation for rLIF bioactivity. Taken together, our data suggest that the N-glycans of LIF play different roles depending on the cell line and that glycosylation of each specific residue contributes differently to its bioactivity.

Amidohydrolases↗
PubMed1997

Differential regulation of chemokines by leukemia inhibitory factor, interleukin-6 and oncostatin M.

M. Leukemia inhibitory factor (LIF). oncostatin M (OsM) and interleukin-6 (IL-6) are members of a cytokine family, which are produced by activated macrophages and glomerular mesangial cells. These cytokines have been implicated in the pathogenesis of glomerular inflammation, but their action on glomerular cells is presently unclear. Therefore, we examined the effects of IL-6, OsM and LIF on chemokine synthesis of rat mesangial cells in culture. While LIF as well as IL-6 up-regulated monocyte chemotactic protein-1 (MCP-1) mRNA expression, OsM showed no such effect. The induction of MCP-1 mRNA by LIF and IL-6 was transient, peaking at one to two hours and two to three hours, respectively, and returning to background levels within several hours. Induction of MCP-1 mRNA by LIF and IL-6 was strongly inhibited by dexamethasone. LIF activated STAT factors in mesangial cells, suggesting their involvement in signal transduction pathways that lead to LIF-stimulated up-regulation of MCP-1 mRNA. By contrast, LIF. IL-6 and OsM failed to affect the expression of the chemokines, macrophage inflammatory protein-2 (MIP-2) and RANTES. The rapid, transient and differential regulation of MCP-1 expression induced by LIF and IL-6 contrasted with uniformly powerful effects of the proinflammatory cytokines IL-1 beta and TNF alpha that induced all tested chemokines for prolonged time periods. These results suggest that the selective and transient induction of MCP-1 by LIF and IL-6 may play a role in the preferential attraction of monocytes to the injured glomerulus.

Animals↗
PubMed1994

Stimulation of HIV replication in mononuclear phagocytes by leukemia inhibitory factor.

This study examined the effects of leukemia inhibitory factor (LIF) on human immunodeficiency virus (HIV) replication in mononuclear phagocytes (MNP). LIF induced a dose-dependent increase in p24 antigen production in the chronically infected promonocytic cell line U1. The magnitude and time kinetics of the LIF effects were similar to interleukin 1 (IL-1), IL-6, and tumor necrosis factor (TNF), other cytokines known to induce HIV replication in this cell line. To characterize mechanisms responsible for these LIF effects, levels of HIV mRNA, activation of the DNA binding protein nuclear factor (NF)-kB, signal transduction pathways, and potential interactions with other cytokines were analyzed. LIF increased steady-state levels of HIV mRNA at 2.0, 4.3, and 9.2 kB. This was detectable by 24 h and persisted until 72 h. The DNA binding protein NF-kB is a central mediator in cytokine activation of HIV transcription. NF-kB levels were higher in unstimulated U1 cells as compared to the parent cell line U937. In both cell lines LIF increased NF-kB activity. Induction of NF-kB and HIV replication by cytokines are at least in part dependent on reactive oxygen intermediates. The oxygen radical scavenger N-acetyl-L-cysteine, but not an inhibitor of nitric oxide synthase, inhibited LIF-induced HIV replication. LIF induces the production of other cytokines in monocytes but its effects on HIV replication were not inhibited by antibodies to IL-1, TNF, or IL-6. These results identify LIF as a stimulus of HIV replication.(ABSTRACT TRUNCATED AT 250 WORDS)

Acetylcysteine↗
PubMed2003

Cell-specific pituitary gene expression profiles after treatment with leukemia inhibitory factor reveal novel modulators for proopiomelanocortin expression.

Leukemia inhibitory factor (LIF) mediates the hypothalamo-pituitary-adrenal stress response. Transgenic mice overexpressing LIF in the developing pituitary have altered pituitary differentiation with expansion of corticotropes, maintenance of Rathke's cleft cysts, and suppression of all other pituitary cell types. Affymetrix GeneChips were used to identify modulators of LIF effects in corticotrope (AtT-20) and somatolactotrope (GH(3)) cells. In addition to genes known to respond to LIF in corticotrope cells [e.g. suppressor of cytokine signaling-3 (SOCS-3), signal transducer and activator of transcription-3, SH2 domain-containing tyrosine phosphatase-1, and proopiomelanocortin (POMC)], corticotrope-specific changes were also observed for genes involved in glycolysis and gluconeogenesis, transcription factors, signaling molecules, and expressed sequence tags. Two transcription factors identified, CCAAT/enhancer-binding protein beta (C/EBPbeta) and glial cell-derived neurotrophic factor (GDNF)-inducible factor (GIF), dose-dependently induced expression of the rat POMC promoter when overexpressed in AtT-20 cells. LIF further induced POMC transcription with C/EBPbeta, but not with GIF. C/EBPbeta also induced expression of the SOCS-3 promoter that was further enhanced by cotreatment with LIF. However, GIF did not affect SOCS-3 expression. These results indicate that C/EBPbeta and GIF are downstream effectors of LIF corticotrope action. LIF also stimulates the expression of inhibitors of its actions, such as SOCS-3 and SH2 domain-containing tyrosine phosphatase-1. alpha(2)-HS-glycoprotein (AHSG)/fetuin, a secreted protein that antagonizes bone TGFbeta/bone morphogenic protein signaling, was induced by LIF in a signal transducer and activator of transcription-3-dependent fashion. Pretreatment with AHSG/fetuin blocked LIF-induced expression of the POMC promoter independently of SOCS-3. Thus, using GeneChips, C/EBPbeta and GIF have been identified as novel mediators and AHSG/fetuin as an inhibitor of LIF action in corticotropes.

Adrenocorticotropic Hormone↗
PubMed1994

Human carcinoma cell lines produce biologically active leukemia inhibitory factor (LIF).

We investigated the production of leukemia inhibitory factor (LIF) by human carcinoma cell lines. LIF mRNA was detected by Northern blot analysis in all 24 carcinoma cell lines of the lung, breast, stomach, colon, liver, gallbladder, pancreas and melanocytes. Seventeen of them (70.8%) secreted LIF in the culture supernatant (range: 40.4-3990.3 pg/ml, mean +/- SEM: 611.8 +/- 262.9 pg/ml). Biologic activity of LIF was confirmed in the culture supernatant of carcinoma cell lines by the MTT assay using M1 cells. The present results showed that human carcinoma cell lines are constitutively producing biologically active LIF. The possible biological significance of LIF produced by cancer cells is discussed.

Blotting, Northern↗