Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “CpG”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 163 records · Page 9Linked to original sources
PubMed2004

Chloroquine protects mice from challenge with CpG ODN and LPS by decreasing proinflammatory cytokine release.

Bacterial DNA (bDNA) and lipopolysaccharide (LPS) are potent activators of immune cells such as monocytes and macrophages, which contribute to systemic inflammatory response syndrome (SIRS) and sepsis. To date, no effective anti-sepsis drugs have been developed for clinical use. Chloroquine (CQ), a diprotic weak base traditionally used for treating malaria, was recently shown to decrease cytokine release from macrophages induced by LPS and CpG oligonucleotide (CpG ODN). In the present study, Escherichia coli DNA (EC DNA), CpG ODN and LPS were used to induce SIRS/sepsis in animal models. We found that 30 mg/kg of CQ could protect mice from lethal challenge by CpG ODN and LPS, and 25 mg/kg of CQ could decrease serum TNF-alpha and IL-6 in rats injected with sublethal doses of CpG ODN and LPS. In addition, treatment of murine macrophage ANA-1 cells with 2 mM CQ potently inhibited the release of TNF-alpha, IL-6 and IL-12 induced by CpG ODN and LPS. In human peripheral blood mononuclear cells (hPBMC), 100-200 microM CQ almost completely abrogated release of both TNF-alpha and IL-6 induced by CpG ODN and LPS, whereas IL-6 release induced by EC DNA was not significantly affected by 50 microM CQ. Furthermore, CQ reduced the expression of TLR9 and TLR4 mRNA and the activation of NFkappaB and AP-1 stimulated by CpG ODN and LPS in ANA-1 cells. Flow cytometry and confocal microscopy revealed that CQ increased the accumulation of CpG ODN within ANA-1 cells without influence on its uptake, suggesting that the delayed degradation of CpG ODN was associated with the reduction of proinflammatory cytokine release from the cells. Our results demonstrated that CQ-mediated protection of lethal challenge by CpG ODN and LPS was associated with the reduction of proinflammatory cytokine release.

Adjuvants, Immunologic↗
PubMed2006

CpG oligodeoxynucleotides are potent enhancers of radio- and chemoresponses of murine tumors.

BACKGROUND AND PURPOSE: Synthetic oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs bind to Toll-like receptor 9 (TLR9) and stimulate both innate and adaptive immune reactions and possess anti-tumor activity. We recently reported that CpG ODN 1826 strongly enhances radioresponse of both immunogenic [Milas L, Mason K, Ariga H, et al. CpG oligodeoxynucleotide enhances tumor response to radiation. Cancer Res 2004;64:5074-7] and non-immunogenic [Mason KA, Ariga H, Neal R, et al. Targeting toll-like receptor-9 with CpG oligodeoxynucleotides enhances tumor response to fractionated radiotherapy. Clin Cancer Res 2005;11:361-9] murine tumors. Using two immunogenic murine tumors, a fibrosarcoma (FSa) and a mammary carcinoma (MCa-K), the present study explored whether CpG ODN 1826 also improves the response of murine tumors to the chemotherapeutic agent docetaxel (DOC). MATERIALS AND METHODS: CpG ODN 1826 (100 microg) was given sc three times: when leg tumors were 6mm, when they grew to 8mm and again 1 week later. DOC (33 mg/kg iv) and local tumor radiation (10Gy) were given when tumors were 8mm. Effects of the treatments were assayed by tumor growth delay, defined as days for tumors to grow from 8 to 12 mm in diameter. RESULTS: Treatment with CpG ODN 1826 resulted in strongly enhanced response of FSa tumors to radiation and MCa-K tumors to the chemotherapeutic agent DOC. Enhancement of tumor treatment response was demonstrated by a strong prolongation in the primary tumor treatment endpoint, tumor growth delay. Coincidentally, this treatment also resulted in a higher rate of tumor cure than that observed after tumor radiotherapy or chemotherapy alone. When all three agents were combined the effect was comparable to that of the combination of CpG ODN 1826 with radiation in the case of FSa or of the combination of CpG ODN 1826 with DOC in the case of MCa-K. CONCLUSION: Overall results show that CpG ODN 1826 can markedly improve tumor response to radiation and chemotherapy (DOC), suggesting that CpG ODNs have potential to be beneficial when used singly or in combination with other standard treatment modalities such as taxane chemotherapy, radiotherapy or both.

Animals↗
PubMed2006

Systemic innate immune responses following intrapulmonary delivery of CpG oligodeoxynucleotides in sheep.

Mucosal delivery of CpG oligodeoxynucleotide (ODN) in mice has been shown to induce potent innate immunostimulatory responses and protection against infection. We evaluated the efficacy of CpG ODN in stimulating systemic innate immune responses in sheep following delivery to the pulmonary mucosa. Intrapulmonary (IPM) administration of B-Class CpG ODN in saline induced transient systemic responses which included increased rectal temperatures, elevated serum 2'5'-A synthetase and haptoglobin concentrations. The ODN dose required to induce detectable systemic responses following IPM delivery could be reduced by approximately 80% if the CpG ODN was administered in 30% emulsigen instead of saline. Intrapulmonary B-Class CpG ODN formulated in 30% emulsigen produced similar effects when compared to those seen following SC injection. These responses were CpG ODN-specific since control GpC ODN did not induce any detectable response. Intrapulmonary administration of both B-Class and the newly described C-Class CpG ODN produced similar effects indicating that both classes of CpG ODN were comparably effective in stimulating innate immune system following mucosal delivery. Administration of CpG ODN directly into the lungs or delivery of CpG ODN via an intratracheal (IT) infusion also produced similar systemic responses. These observations support the conclusion that mucosal delivery of CpG ODN is an effective route for induction of systemic acute phase responses and antiviral effector molecules in large animals, and may be helpful in controlling systemic infections.

2',5'-Oligoadenylate Synthetase↗
PubMed2005

Multiple administrations of oligodeoxynucleotides containing CpG motifs influence Ig isotype production.

Oligodeoxynucleotides containing CpG motifs (CpG-ODN) activate cells of the innate immune system. Recent studies have shown that sole CpG-ODN administration induces resistance against infection and tumors. Effects of CpG-ODN administration are rapidly induced, and regarding infections only short-term protection was seen. One conceivable strategy to prolong protective effects is multiple administrations of CpG-ODN. However, inappropriate immune activation via CpG motifs has been implicated in septic shock and autoimmunity. To investigate effects of multiple CpG-ODN administrations, we analyzed Th1- and Th-2-associated Ig antibody levels, during and after multiple treatment with CpG-ODN. Our results show that multiple administrations of CpG-ODN lead to an increase in total IgG2c levels in CpG-ODN-treated mice in comparison to controls with distinct time and frequency correlation, in the absence of additional stimuli. This indicates a humoral Th1 bias based on stimulation of Th1-Ig isotype-producing B cells. These effects could account for observed anti-infection and anti-tumor properties of multiple CpG-ODN administrations; on the other hand, they might cause autoimmune disease.

Animals↗
PubMed2003

P-chirality-dependent immune activation by phosphorothioate CpG oligodeoxynucleotides.

Many of the biologic activities of phosphorothioate oligodeoxynucleotides (PS-oligos) are affected by the sense of chirality of the phosphorus atoms of the internucleotide linkages. Some of the activities are increased by the Rp stereoisomer, and others are increased by the Sp stereoisomer. In previous studies, we showed that PS-oligos containing unmethylated CpG dinucleotides in particular sequence contexts can stimulate B cells and other immune cells. These CpG PS-oligos trigger mitogenactivated protein kinase (MAPK) signaling pathways, causing the induction of B cell proliferation and cytokine and immunoglobulin secretion. We investigated whether the immune stimulation by CpG PS-oligos depends on the sense of their P-chirality. CpG PS-oligos synthesized with internucleotide phosphorothioates of Rp configuration at P-atom showed much stronger MAPK activation and induction of I kappa B degradation after 40 minutes of stimulation compared with PS-oligos synthesized with Sp linkages. In order to determine if the enhanced stimulatory effects of the Rp stereoisomer may result from differential cellular uptake, we examined the rates at which fluorescently labeled Rp or Sp CpG PS-oligos were taken up by B cells, but these were found to be identical to each other and to stereorandom PS-oligos. The stronger stimulatory effect of the R stereoisomer did not last for 48 hours, and (3)H-thymidine incorporation assays at this point showed that only the S stereoisomer was active--to approximately the same level as induced by PS-oligos with stereorandom phosphorothioate linkages. This loss of activity of the R stereoisomer most likely resulted from rapid degradation of the oligonucleotides rather than from reduced interaction with the CpG receptor because PS-oligos in which only the CpG dinucleotide was stereodefined were most stimulatory when the CpG was Rp but not when the CpG was Sp. These studies demonstrate that the sense of Pchirality of PS-oligos plays a major role in determining the biologic activities of CpG motifs. Rp-chirality at the CpG is preferred for best stimulation at early time points, but Sp-chirality of the PS-oligo appears to improve stability and may provide more durable effects in prolonged tissue culture systems.

Adjuvants, Immunologic↗
PubMed1989

In vitro methylation of CpG-rich islands.

CpG islands are distinguishable from the bulk of vertebrate DNA for being unmethylated and CpG-rich. Since CpG doublets are the specific target of eukaryotic DNA methyltransferases, CpG-rich sequences might be expected to be good methyl-accepting substrates in vitro, despite their unmethylated in vivo condition. This was tested using a partially purified DNA-methyltransferase from human placenta and several cloned CpG-rich or CpG-depleted sequences. The efficiency of methylation was found to be proportional to the CpG content for CpG-depleted regions, which are representative of the bulk genome. However, methylation was much less efficient for CpG frequencies higher than 1 in 12 nucleotides, reaching only 60% of the expected level. That suggests that the close CpG spacing typical of CpG-islands somehow inhibits mammalian DNA methyltransferase. The implications of these findings on the in vivo pattern of DNA methylation are discussed.

Base Sequence↗
PubMed1997

Restriction endonuclease isoschizomers ItaI, BsoFI and Fsp4HI are characterised by differences in their sensitivities to CpG methylation.

BsoFI , ItaI and Fsp4HI are isoshizomers of Fnu4HI (5'-GC NGC-3'). Both Fnu4HI and BsoFI have previously been shown to be inhibited by cytosine-specific methylation within the recognition sequence. Fnu4HI is inhibited if either the internal cytosine at position 2 or the external cytosine at position 5 of the restriction sequence is methylated, but the precise nature of the methylation sensitivity of BsoFI is unclear from the literature. The methylation sensitivities of ItaI and Fsp4HI have not previously been reported. By methylating the plasmid pUC18 with M.SssI (a DNA cytosine-5'-methyltransferase with a specificity for CpG), we have determined that ItaI is sensitive only to methylation of internal CpG sites within the restriction sequence. The methylation sensitivity of Fsp4HI is identical to that of Fnu4HI, being inhibited by methylation of either internal CpG sites or overlapping CpG sites. BsoFI , like the other isoschizomers tested, is sensitive to a combination of internal and overlapping CpG methylation. BsoFI is also sensitive to overlapping CpG methylation (in the absence of internal CpG methylation) if CpG overlap with both sides of the recognition sequence. Sites containing one overlapping CpG (in the absence of internal CpG) are cut when methylated but show marked individual variation in their rates of cleavage. Considerable variation in the rate of cleavage by BsoFI is also observed at sites containing only internal methylated CpG. Some sites are cut slowly, whilst others fail to cut even after prolonged incubation with excess of enzyme.

Base Sequence↗
PubMed2002

CpG oligonucleotides: novel regulators of osteoclast differentiation.

The macrophage capability to recognize bacterial DNA is mimicked by oligodeoxynucleotides containing unmethylated CG dinucleotides ('CpG' motifs) in specific sequence contexts (CpG ODN). CpG ODN stimulates NF-kappaB activation in murine macrophages. In light of the pivotal role played by NF-kappaB in osteoclast differentiation, we examined the ability of CpG ODN to modulate osteoclastogenesis. CpG ODN alone induced TRAP-positive cells in bone marrow macrophage (BMM) cultures, but not multinucleation or calcitonin receptor expression. CpG ODN inhibited RANKL-induced osteoclastogenesis when present from the beginning of BMM culture, but strongly increased RANKL-induced osteoclastogenesis in RANKL-pretreated BMMs. CpG ODN enhanced the expression of interleukin 1beta (IL-1beta) and tumor necrosis factor alpha (TNF-alpha). Antibodies to TNF-alpha and the TNF type 1 receptor, but not the addition of IL-1 receptor antagonist, blocked CpG ODN-induced osteoclastogenesis in RANKL-pretreated cultures. On the other hand, CpG ODN reduced expression of the M-CSF receptor, which is critical during the initiation of osteoclast differentiation. These results suggest that CpG ODN, via the induction of TNF-alpha, support osteoclastogenesis in cells that are committed to the osteoclast differentiation pathway but, due to down-modulation of M-CSF receptor, inhibit early steps of osteoclast differentiation. Thus, CpG ODN represents a potential therapeutic tool for treating bone diseases.

Acid Phosphatase↗
PubMed2004

Oligodeoxynucleotides lacking CpG dinucleotides mediate Toll-like receptor 9 dependent T helper type 2 biased immune stimulation.

Oligodeoxynucleotides (ODN) with unmethylated CpG dinucleotides mimic the immune stimulatory activity of bacterial DNA in vertebrates and are recognized by Toll-like receptor 9 (TLR9). It is also possible to detect immune activation with certain phosphorothioate sequences that lack CpG motifs. These ODN are less potent than CpG ODN and the mechanism by which they stimulate mammalian leucocytes is not understood. We here provide several lines of evidence demonstrating that the effects induced by non-CpG ODN are mediated by TLR9. First, non-CpG ODN could not stimulate cytokine secretion from the splenocytes of TLR9-deficient (TLR9(-/-)) mice. Second, immunization of TLR9(+/+) but not TLR9(-/-) mice with non-CpG ODN enhanced antigen-specific antibody responses, although these were T helper type 2 (Th2)-biased. Third, reactivity to non-CpG ODN could be reconstituted by transfection of human TLR9 into non-responsive cells. In addition, we define a new efficient immune stimulatory motif aside from the CpG dinucleotide that consists of a 5'-TC dinucleotide in a thymidine-rich background. Non-CpG ODN containing this motif induced activation of human B cells, but lacked stimulation of Th1-like cytokines and chemokines. Our study indicates that TLR9 can mediate either efficient Th1- or Th2-dominated effects depending on whether it is stimulated by CpG or certain non-CpG ODN.

Animals↗
PubMed2001

Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice.

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

Adjuvants, Immunologic↗
PubMed2005

Formulation with CpG oligodeoxynucleotides prevents induction of pulmonary immunopathology following priming with formalin-inactivated or commercial killed bovine respiratory syncytial virus vaccine.

Commercial killed bovine respiratory syncytial virus (K-BRSV) and formalin-inactivated BRSV (FI-BRSV) tend to induce Th2-type immune responses, which may not be protective and may even be detrimental during subsequent exposure to the virus. In this study we assessed the ability of CpG oligodeoxynucleotides (ODNs) to aid in the generation of effective and protective BRSV-specific immune responses. Mice were immunized subcutaneously with FI-BRSV formulated with CpG ODN, Emulsigen (Em), CpG ODN and Em, or non-CpG ODN and Em. Two additional groups were immunized with K-BRSV or K-BRSV and CpG ODN. After two vaccinations, the mice were challenged with BRSV. FI-BRSV induced Th2-biased immune responses characterized by production of serum immunoglobulin G1 (IgG1) and IgE, as well as interleukin-4 (IL-4), by in vitro-restimulated splenocytes. Formulation of FI-BRSV with CpG ODN, but not with non-CpG ODN, enhanced serum IgG2a and IFN-gamma production by splenocytes, whereas serum IgE was reduced. Although the immune response induced by K-BRSV was not as strongly Th2 biased, the addition of CpG ODN to this commercial vaccine also resulted in a more Th1-type response. Furthermore, the addition of CpG ODN to the BRSV vaccine formulations resulted in enhanced neutralizing antibody responses. Significant production of IL-5, eotaxin, and eosinophilia was observed in the lungs of FI-BRSV- and K-BRSV-immunized mice. However, IL-5 and eotaxin levels, as well as the number of eosinophils, were decreased in the mice vaccinated with the CpG ODN-formulated vaccines. Finally, when formulated with CpG ODN, both FI-BRSV and K-BRSV significantly reduced virus production after challenge with BRSV.

Adjuvants, Immunologic↗
PubMed2003

Bacterial LPS and CpG DNA differentially induce gene expression profiles in mouse macrophages.

Bacterial DNA containing unmethylated CpG dinucleotides (CpG DNA) is a potent immune stimulating agent that holds strong promise in the treatment of many disorders. Studies have established that CpG DNA triggers an immune response through activated expression of genes in immune cells including macrophages. To dissect further the molecular mechanism(s) by which CpG DNA activates the immune system, we studied macrophage gene expression profiles in response to CpG DNA using microarray technology. Since CpG DNA is reported to use the TLR9 receptor that shares homology with the TLR4 receptor used by bacterial lipopolysaccharide (LPS), we also evaluated gene expression profiles in macrophages stimulated by LPS versus CpG DNA. Both CpG DNA and LPS modulate expression of a large array of genes. However, LPS modulated the expression of a much greater number of genes than did CpG DNA and all genes induced or repressed by CpG DNA were also induced or repressed by LPS. These data indicate that the CpG DNA signaling pathway through TLR9 activates only a subset of genes induced by the LPS TLR4 signaling pathway.

Animals↗
PubMed2004

Combination immunotherapy with a CpG oligonucleotide (1018 ISS) and rituximab in patients with non-Hodgkin lymphoma: increased interferon-alpha/beta-inducible gene expression, without significant toxicity.

CpG oligodeoxynucleotides (CpG-ODNs) affect innate and adaptive immune responses, including antigen presentation, costimulatory molecule expression, dendritic cell maturation, and induction of cytokines enhancing antibody-dependent cell-mediated cytotoxicity (ADCC). We conducted a phase 1 study evaluating 4 dose levels of a CpG-ODN (1018 ISS) with rituximab in 20 patients with relapsed non-Hodgkin lymphoma (NHL). Patients received CpG once a week for 4 weeks beginning after the second of 4 rituximab infusions. Adverse events were minimal. Quantitative polymerase chain reaction (PCR) measurements of a panel of genes inducible by CpG-ODN and interferons were performed on blood samples collected before and 24 hours after CpG. A dose-related increase was measured in the expression of several interferon-inducible genes after CpG and correlated with serum levels of 2'-5' oligoadenylate synthetase (OAS), a validated interferon response marker. Genes induced selectively by interferon-gamma (IFN-gamma) were not significantly induced by CpG. In conclusion, we have defined a set of gene expression markers that provide a sensitive measure of biologic responses of patients to CpG therapy in a dose-related manner. Moreover, all the genes significantly induced by this CpG are regulated by type 1 interferons, providing insight into the dominant immune mechanisms in humans. CpG treatment resulted in no significant toxicity, providing rationale for further testing of this exciting combination immunotherapy approach to NHL.

Adult↗
PubMed2003

Interferon-alpha/beta receptor-mediated selective induction of a gene cluster by CpG oligodeoxynucleotide 2006.

BACKGROUND: Oligodeoxynucleotides containing unmethylated CpG motifs (CpG ODN) are known to exert a strong adjuvant effect on Th1 immune responses. Although several genes have been reported, no comprehensive study of the gene expression profiles in human cells after stimulation with CpG ODN has been reported. RESULTS: This study was designed to identify a CpG-inducible gene cluster that potentially predicts for the molecular mechanisms of clinical efficacy of CpG ODN, by determining mRNA expression in human PBMC after stimulation with CpG ODN. PBMCs were obtained from the peripheral blood of healthy volunteers and cultured in the presence or absence of CpG ODN 2006 for up to 24 hours. The mRNA expression profile was evaluated using a high-density oligonucleotide probe array, GeneChip. Using hierarchical clustering-analysis, out of a total of 10,000 genes we identified a cluster containing 77 genes as having been up-regulated by CpG ODN. This cluster was further divided into two sub-clusters by means of time-kinetics. (1) Inflammatory cytokines such as IL-6 and GM-CSF were up-regulated predominantly 3 to 6 hours after stimulation with CpG ODN, presumably through activation of a transcription factor, NF-kappaB. (2) Interferon (IFN)-inducible anti-viral proteins, including IFIT1, OAS1 and Mx1, and Th1 chemoattractant IP-10, were up-regulated predominantly 6 to 24 hours after stimulation. Blocking with mAb against IFN-alpha/beta receptor strongly inhibited the induction of these IFN-inducible genes by CpG ODN. CONCLUSION: This study provides new information regarding the possible immunomodulatory effects of CpG ODN in vivo via an IFN-alpha/beta receptor-mediated paracrine pathway.

Antibodies, Monoclonal↗
PubMed2000

APC stimulated by CpG oligodeoxynucleotide enhance activation of MHC class I-restricted T cells.

Oligonucleotides containing unmethylated CpG motifs (cytosine-phosphorothioate-guanine oligodeoxynucleotide (CpG ODN)) are potent immunostimulatory agents capable of enhancing the Ag-specific Th1 response when used as immune adjuvants. We evaluated the cellular mechanisms responsible for this effect. Development of a CTL response was enhanced when mice were immunized with peptide-pulsed dendritic cells (DCs) treated with CpG ODN. However, in vitro, CpG ODN had no direct effect on highly purified T cells. In vitro, CpG ODN treatment of peptide- or protein-pulsed DCs enhanced the ability of the DCs to activate class I-restricted T cells. The presence of helper T cells enhanced this effect, indicating that treatment with CpG ODN does not obviate the role of T cell help. The enhanced ability of CpG ODN-treated DCs to activate T cells was present but blunted when DCs derived from IL-12 knockout mice were used. Fixation of Ag-pulsed, CpG ODN-treated DCs limited their ability to activate T cells. In contrast, fixation had little effect on DC activation of T cells when DCs were not exposed to CpG ODN. This indicates that production of soluble factors by DCs stimulated with CpG ODN plays a particularly important role in their ability to activate class I-restricted T cells. We conclude that CpG ODN enhances the development of a cellular immune response by stimulating APCs such as DCs, to produce IL-12 and other soluble factors.

Adjuvants, Immunologic↗
PubMed2001

Divergent therapeutic and immunologic effects of oligodeoxynucleotides with distinct CpG motifs.

Immune stimulatory oligodeoxynucleotides (ODN) with unmethylated CpG motifs are potent inducers of both innate and adaptive immunity. It initially appeared that a single type of optimal CpG motif would work in all applications. We now report that specific motifs of CpG ODN can vary dramatically in their ability to induce individual immune effects and that these differences impact on their antitumor activity in different tumor models. In particular, a distinct type of CpG motif, which has a chimeric backbone in combination with poly(G) tails, is a potent inducer of NK lytic activity but has little effect on cytokine secretion or B cell proliferation. One such NK-optimized CpG ODN (1585) can induce regression of established melanomas in mice. Surprisingly, no such therapeutic effects were seen with CpG ODN optimized for activation of B cells and Th1-like cytokine expression (ODN 1826). The therapeutic effects of CpG 1585 in melanoma required the presence of NK but not T or B cells and were not associated with the induction of a tumor-specific memory response. In contrast, CpG 1826, but not CpG 1585, was effective at inducing regression of the EL4 murine lymphoma; this rejection was associated with the induction of a memory response and although NK cells were necessary, they were not sufficient. These results demonstrate that selection of optimal CpG ODN for cancer immunotherapy depends upon a careful analysis of the cellular specificities of various CpG motifs and an understanding of the cellular mechanisms responsible for the antitumor activity in a particular tumor.

Adjuvants, Immunologic↗
PubMed2000

Immunostimulatory CpG-oligonucleotides cause proliferation, cytokine production, and an immunogenic phenotype in chronic lymphocytic leukemia B cells.

Bacterial DNA and synthetic CpG-oligodeoxynucleotides (ODNs) derived thereof have attracted attention because they activate cells of the immune system in a sequence-dependent manner. Here we investigated the potential of CpG-ODNs to cause proliferation, cytokine production, and regulation of surface molecules in human B-chronic lymphocytic leukemia (CLL) cells. CpG-ODN induced proliferation in both B-CLL cells and normal B cells; however, only B-CLL cells increased proliferative responses when CpG-ODN was added to co-cultures of CD40-ligand transfected mouse fibroblasts (CD40LF) and B cells. Production of interleukin-6 and tumor necrosis factor alpha was detectable at borderline levels, using CpG-ODN as the only stimulus. In contrast, when CpG-ODN was added to co-cultures of B cells and CD40LF, a strong increase in cytokine production occurred in B-CLL cells as well as in normal B cells. The surface molecules CD40, CD58, CD80, CD86, CD54, and MHC class I molecules were up-regulated in B-CLL cells, whereas CD95 expression was not influenced by CpG-ODN stimulation. The same pattern of surface molecule regulation was observed in normal B cells, but up-regulation of CD40 was significantly stronger in B-CLL cells. Costimulation with CpG-ODN and CD40LF resulted in further up-regulation of CD58, CD80, CD86, and MHC class I molecules. In contrast, CD95 expression induced by CD40-ligation was inhibited by CpG-ODN. CpG-ODN activated B-CLL cells acquired a strong stimulatory capacity toward T cells in allogeneic mixed lymphocyte reaction. This effect was completely inhibited by a combination of anti-CD80 and anti-CD86 monoclonal antibody. Taken together, these findings suggest the possible use of CpG-ODN for immunotherapeutic strategies in patients with B-CLL.

Adjuvants, Immunologic↗
PubMed2001

CpG DNA increases primary malignant B cell expression of costimulatory molecules and target antigens.

Multiple factors, including expression of costimulatory molecules, antigen-presenting molecules, and target antigens, likely impact the efficacy of antibody therapy and other approaches to the immunotherapy of B cell malignancy. Unmethylated CpG-dinucleotides in select base contexts ("CpG motifs") that resemble sequences found in bacterial DNA are potent immunostimulatory agents capable of inducing a complex immune response, including a strong B cell stimulus. We examined the effect of a potent human CpG oligonucleotide (CpG ODN 2006) on different types of primary human malignant B cells and reactive follicular hyperplasia. CpG oligodeoxynucleotide (CpG ODN), but not control (non-CpG ODN), increased the expression of costimulatory molecules (CD40, CD80, CD86, CD54) on malignant B cells without altering the phenotype of B cells obtained from reactive follicular hyperplasia. CpG ODN also enhanced expression of class I and class II MHC in most samples. CD20 expression was increased in response to CpG ODN, most notably in B-CLL and marginal zone lymphoma. An inverse correlation was found between baseline expression of CD20 and CD40 and their expression after exposure to CpG ODN, thus the most significant increase in expression of these molecules was found in those samples that had the lowest baseline levels. In conclusion, CpG ODN can lead to increasing expression of molecules involved in costimulation, antigen presentation, and as targets for antibody-based therapy and deserve further evaluation as potential immunotherapeutic agents for B cell malignancy.

Antigen Presentation↗