Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “inverted terminal repeat”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,603 records · Page 89Linked to original sources
PubMed2000

Inverted duplications are recurrent rearrangements always associated with a distal deletion: description of a new case involving 2q.

We studied the case of a subject with an inverted duplication of 40 cM of 2q33-q37 concurrent with a 10 cM deletion of the distal 2q, the latter not being detectable by cytogenetics. Microsatellite analysis demonstrated the absence of maternal alleles in the deleted region and a double dosage for one of the maternal alleles in the duplication region. We hypothesised that this type of rearrangement occurs at meiosis I, while the two homologues are synapsed for most of their length. The presence of inverted duplicons in the same chromosome arm would favour the partial refolding of one homologue into itself so leading to the intrachromatid synapsis and recombination of the inverted repeats. The arising recombinant chromosome is deleted for the region beyond the most distal repeat and with the chromatids joined together at the level of the region located between the two duplicons. At meiosis II, the two linked chromatids can join the opposite poles provided that a breakage between the two centromeres occurs leading to a duplicated/deleted chromosome and a simply deleted chromosome. This model can be extended to all the so-called inverted duplication cases and to part of the terminal deletions. In fact the finding that, in our invdup(2q), the entire 40 cM duplication region involves only one of the two maternal alleles, indeed indicates that the abnormal crossover occurs between sister chromatids. The phenotype associated with our 2q rearrangement led us to narrow the critical region for the Albright-like syndrome to 10 cM in the subterminal 2q region.

Child↗
PubMed2002

The Mre11 complex is required for repair of hairpin-capped double-strand breaks and prevention of chromosome rearrangements.

Inverted repeats (IRs) that can form a hairpin or cruciform structure are common in the human genome and may be sources of instability. An IR involving the human Alu sequence (Alu-IR) has been studied as a model of such structures in yeast. We found that an Alu-IR is a mitotic recombination hotspot requiring MRE11/RAD50/XRS2 and SAE2. Using a newly developed approach for mapping rare double-strand breaks (DSBs), we established that induction of recombination results from breaks that are terminated by hairpins. Failure of the mre11, rad50, xrs2, and sae2 mutants to process the hairpins blocks recombinational repair of the DSBs and leads to generation of chromosome inverted duplications. Our results suggest an additional role for the Mre11 complex in maintaining genome stability.

Chromosome Fragility↗
PubMed1996

Stimulation of mouse osteopontin promoter by v-Src is mediated by a CCAAT box-binding factor.

Osteopontin is an arginine-glycine-aspartic acid-containing cell adhesion protein, which is frequently expressed in transformed cells and is thought to play a role in tumorigenesis. v-Src is a transforming viral oncogene product encoded by Rous sarcoma virus (RSV). We report that v-Src expression in HT1080 fibrosarcoma cells significantly stimulates mouse osteopontin promoter activity. We also determined the v-Src response element in the osteopontin promoter as an inverted CCAAT box located at -53 to -49 from the transcription start site. Mutations of the CCAAT box disrupts protein-DNA interaction and diminishes both v-Src stimulation and basal promoter activity. A CCAAT box-containing fragment corresponding to -155 to -122 of RSV long terminal repeat competed with the -72 to -38 fragment of mouse osteopontin promoter for specific protein binding in the gel shift assay. A polyclonal antibody against CBF, a CCAAT box-binding factor, supershifted in gel shift assays the protein-DNA complex formed by nuclear extract of HT1080 with either the RSV CCAAT box fragment or with the osteopontin -72 to -38 fragment. Moreover, both osteopontin mRNA levels and enhancer activity of CCAAT box-containing -72 to -38 fragment were significantly elevated in v-src-transformed NIH 3T3 cells relative to parental cells. These findings suggest that the elevated osteopontin expression in transformed cells could be due, at least in part, to v-Src stimulation of the osteopontin promoter and that this effect is mediated by a CBF-like factor.

Animals↗
PubMed1990

Independent regulation of mouse VL30 retrotransposon expression in response to serum and oncogenic cell transformation.

The nucleotide sequence of the long terminal repeats (LTRs) of retrovirus-transmissible mouse VL30 cDNA clones, NVL-1 and NVL-2 were determined and compared with that of the prototype NVL-3. Both shared the typical U3 R U5 structure together with unusual features of redundancy in the tRNAgly primer binding site and adjacent inverted repeat. NVL-1 and NVL-2 LTRs were almost identical and differed from the NVL-3 LTR in the U3 domain harbouring transcriptional regulatory determinants. S1 nuclease analysis of cellular and virus-encapsidated RNA suggested that NVL-1/2 and NVL-3 elements retrotranspose with comparable efficiency but that in contrast to transformation-regulated VL30 expression which affects all types of NVL element, only NVL-1/2 elements were found to be serum responsive. Both modes of VL30 regulation were found to be coupled through protein kinase C-independent pathways. Expression of N-ras transactivated U3 enhancer determinants in all classes of LTR. However the same region of NVL-1/2 LTR did not confer serum responsiveness implying that cis regulatory determinants of VL30 elements mediating growth factor responsiveness are at least in part dissociable from those responsible for cell transformation-regulated expression.

Base Sequence↗
PubMed1979

Transposition of the Escherichia coli insertion element gamma generates a five-base-pair repeat.

We have determined DNA sequences surrounding the termini of the Escherichia coli insertion element gamma delta, both at its normal locus on the F (fertility) factor and at three different sites of insertion into the plasmid pBR322. After transposition, a five-base-pair pBR322 sequence is duplicated and appears in direct orientation adjacent to each end of the element. No such duplication flanks the ends of gamma delta in F, and there is no apparent homology between the sequences surrounding gamma delta in F and the five-base-pair duplications generated by insertion. These findings suggest that the duplications are not essential for transposition and that they do not act to direct gamma delta to a homologous site in the target chromosome. In addition, we find that the 35-base-pair inverted repeat that comprises the termini of gamma delta is strikingly similar in sequence to the ends of both the ampicillin-resistance transposon Tn3 and a 200-nucleotide-long sequence on the plasmid pSC101 which has been shown to mediate recombination with phage f1 replicative form. Within the terminal region, there is a specific heptanucleotide sequence common to each of the above elements and to bacteriophage Mu, all of which generate five-base-pair repeats upon insertion.

Base Sequence↗
PubMed1989

The 43 residue DNA binding domain of gamma delta resolvase binds adjacent major and minor grooves of DNA.

The carboxyl-terminal domain of gamma delta resolvase binds to each half of the three resolvase binding sites that constitute the recombination site, res. Ethylation inhibition experiments show that the phosphate contacts made by the C-terminal DNA binding domain are similar to those made by intact resolvase, with the exception of a single phosphate at the inside end of each contact region which is contacted solely by the intact resolvase. The DNA binding domain makes essentially identical contacts to all 6 half sites, whereas the intact resolvase makes slightly different contacts to each binding site. Despite its small size, only 43 amino acid residues, the resolvase C-terminal domain interacts with an unusually large segment of DNA. Phosphate contacts extend across an adjacent major and minor groove of DNA and about one third of the circumference around the helix. The minimal binding segment, determined experimentally, is a 12 bp sequence that includes the 9 base pair inverted repeat (common to all half sites), the adjacent 3 base pairs (towards the center of the intact resolvase binding site), and phosphates at both ends.

Amino Acid Sequence↗
PubMed1995

Localized denaturation of oriT DNA within relaxosomes of the broad-host-range plasmid R1162.

The broad-host-range, multicopy plasmid R1162 is efficiently mobilized during conjugation by the self-transmissible plasmid R751. The relaxosome, a complex of plasmid DNA and R1162-encoded proteins, forms at the origin of transfer (oriT) and is required for mobilization. Transfer is initiated by strand- and site-specific nicking of the DNA within this structure. We show by probing with potassium permanganate that oriT DNA is locally melted within the relaxosome, in the region from the inverted repeat to the site that is nicked. Mutations in this region of oriT, and in genes encoding the protein components of the relaxosome, affect both nicking and melting of the DNA. The nicking protein in the relaxosome is MobA, which also ligates the transferred linear, single strand at the termination of a round of transfer. We propose that there is an underlying similarity in the substrates for these two MobA-dependent, DNA-processing reactions. We also show that MobA has an additional role in transfer, beyond the nicking and resealing of oriT DNA.

Bacterial Proteins↗
PubMed1984

Avian retrovirus pp32 DNA binding protein. Preferential binding to the promoter region of long terminal repeat DNA.

The avian retrovirus pp32 protein possesses DNA endonuclease activity and unique DNA binding properties. An improved purification procedure was developed for pp32, resulting in a severalfold increase in the yield of this virion protein. By use of the nitrocellulose filter binding assay, the protein retains approximately 2-fold more supercoiled (form I) DNA molecules than equivalent linear duplex DNA molecules. Single-stranded DNA is only slightly preferred over double-stranded DNA for pp32 binding. The pp32 DNA binding sites on form I pBR322 DNA which contained an insert of avian retrovirus long terminal repeat (LTR) DNA were determined. A preformed protein-DNA complex was digested with one of several different multicut restriction enzymes and filtered through nitrocellulose filters. Fragments containing viral LTR DNA sequences and plasmid DNA containing promoter sequences for the ampicillin and tetracycline genes, sequences for the "left-end" inverted repeat of transposon 3, and sequences encompassing the carboxyl terminus of the beta-lactamase gene were preferentially retained on the filter by pp32. Partial mapping of pp32 DNA binding sites on LTR DNA was accomplished by generation of deletions in LTR DNA sequences. The pp32 protein preferentially bound viral DNA fragments which contain the viral promoter (TATTTAA) and the adjacent "R" repeat sequences. Computer analysis revealed that three of the four plasmid DNA fragments retained by pp32 contained LTR DNA promoter-like sequences (one mismatch only) which were part of statistically significant and thermodynamically stable hairpin structures.

Animals↗
PubMed1997

Molecular analysis of the cos region of the Lactobacillus casei bacteriophage A2. Gene product 3, gp3, specifically binds to its downstream cos region.

The terminal nucleotide sequence of the Lactobacillus casei bacteriophage A2 DNA revealed a single-stranded extension 13 bases in length (5'-AACGGTCGGCCTC-3') at its 3' termini that defines the packaging initiation nicking site (cosN). The cosN sequence is bisected by an axis of hyphenated twofold rotational symmetry. Directly and inverted repeated sequences located to the left (cosL) and the right (cosR) of the cosN site were observed. Analysis of the 3.4 kb EcoRI DNA sequence surrounding the cos region revealed four complete and one incomplete open reading frames (orfs). Northern blots indicated that all were cotranscribed in a single mRNA molecule in excess of 10 kb that appeared late during infection. Minicell studies indicated that the four orfs were translated into protein. From the ORF3 amino acid sequence DNA-binding and NTP-binding domains can be predicted. The purified ORF3 (predicted molecular mass 16.8 kDa) shows specific binding to the A2 cos region, so it was renamed gp3. Gp3 forms a specific complex with a 369 bp cos DNA segment in the presence of ATP. Gp3 interaction with the intrinsically bent cos DNA segment induces intramolecular ligation in the presence of T4 DNA ligase. The data presented here suggest that gp3 is the small subunit of the terminase enzyme.

Amino Acid Sequence↗
PubMed1983

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.

Amino Acid Sequence↗
PubMed1998

Reverse transcription of a self-primed retrotransposon requires an RNA structure similar to the U5-IR stem-loop of retroviruses.

An inverted repeat (IR) within the U5 region of the Rous sarcoma virus (RSV) mRNA forms a structure composed of a 7-bp stem and a 5-nucleotide (nt) loop. This U5-IR structure has been shown to be required for the initiation of reverse transcription. The mRNA of Tf1, long terminal repeat-containing retrotransposon from fission yeast (Schizosaccharomyces pombe) contains nucleotides with the potential to form a U5-IR stem-loop that is strikingly similar to that of RSV. The putative U5-IR stem-loop of Tf1 consists of a 7-bp stem and a 25-nt loop. Results from mutagenesis studies indicate that the U5-IR stem-loop in the mRNA of Tf1 does form and that it is required for Tf1 transposition. Although the loop is required for transposition, we were surprised that the specific sequence of the nucleotides within the loop was unimportant for function. Additional investigation indicates that the loss of transposition activity due to a reduction in the loop size to 6 nt could be rescued by increasing the GC content of the stem. This result indicates that the large loop in the Tf1 mRNA relative to that of the RSV allows the formation of the relatively weak U5-IR stem. The levels of Tf1 proteins expressed and the amounts of Tf1 RNA packaged into the virus-like particles were not affected by mutations in the U5-IR structure. However, all of the mutations in the U5-IR structure that caused defects in transposition produced low amounts of reverse transcripts. A unique feature in the initiation of Tf1 reverse transcription is that, instead of a tRNA, the first 11 nt of the Tf1 mRNA serve as the minus-strand primer. Analysis of the 5' end of Tf1 mRNA revealed that the mutations in the U5-IR stem-loop that resulted in defects in reverse transcription caused a reduction in the cleavage activity required to generate the Tf1 primer. Our results indicate that the U5-IR stems of Tf1 and RSV are conserved in size, position, and function.

Avian Sarcoma Viruses↗
PubMed1996

Function of 3' non-coding sequences and stop codon usage in expression of the chloroplast psaB gene in Chlamydomonas reinhardtii.

The rate of mRNA decay is an important step in the control of gene expression in prokaryotes, eukaryotes and cellular organelles. Factors that determine the rate of mRNA decay in chloroplasts are not well understood. Chloroplast mRNAs typically contain an inverted repeat sequence within the 3' untranslated region that can potentially fold into a stem-loop structure. These stem-loop structures have been suggested to stabilize the mRNA by preventing degradation by exonuclease activity, although such a function in vivo has not been clearly established. Secondary structures within the translation reading frame may also determine the inherent stability of an mRNA. To test the function of the inverted repeat structures in chloroplast mRNA stability mutants were constructed in the psaB gene that eliminated the 3' flanking sequences of psaB or extended the open reading frame into the 3' inverted repeat. The mutant psaB genes were introduced into the chloroplast genome of Chlamydomonas reinhardtii. Mutants lacking the 3' stem-loop exhibited a 75% reduction in the level of psaB mRNA. The accumulation of photosystem I complexes was also decreased by a corresponding amount indicating that the mRNA level is limiting to PsaB protein synthesis. Pulse-chase labeling of the mRNA showed that the decay rate of the psaB mRNA was significantly increased demonstrating that the stem-loop structure is required for psaB mRNA stability. When the translation reading frame was extended into the 3' inverted repeat the mRNA level was reduced to only 2% of wild-type indicating that ribosome interaction with stem-loop structures destabilizes chloroplast mRNAs. The non-photosynthetic phenotype of the mutant with an extended reading frame allowed us to test whether infrequently used stop codons (UAG and UGA) can terminate translation in vivo. Both UAG and UGA are able to effectively terminate PsaB synthesis although UGA is never used in any of the Chlamydomonas chloroplast genes that have been sequenced.

Amino Acid Sequence↗
PubMed1992

Sequence analysis of an insertion element, IS1131, isolated from the nopaline-type Ti plasmid of Agrobacterium tumefaciens.

Transferred DNA (T-DNA) from several nopaline-type Ti plasmids of Agrobacterium tumefaciens was previously shown to be variable in size due to the insertion of extra DNA segments. We found an insertion sequence (named IS1131) in the T-DNA of the strain PO22 and determined the nucleotide (nt) sequence. IS1131 is 2773 bp long, contains four open reading frames, and is flanked by 12-bp perfect inverted repeats (IR). An 8-bp direct repeat was found immediately outside the IR, and represents a target site of integration. Although the IS1131 nt sequence showed a limited degree of similarity to those of the previously reported IS elements of A. tumefaciens and to the central region of T-DNA, the terminal IR of IS1131 were highly homologous (up to 83%) to those of IS66 and IS866, suggesting that these three IS elements are related to each other. A number of IS1131-related copies were found in several pathogenic, as well as nonpathogenic, nopaline-type strains from different plant sources, and were distributed on both chromosomes and plasmids.

Agrobacterium tumefaciens↗
PubMed1989

Olfactory marker protein gene: its structure and olfactory neuron-specific expression in transgenic mice.

Olfactory marker protein (OMP) genomic clones were isolated from a Charon 4A phage lambda rat genomic library. A 16.5-kilobase (kb) fragment of the rat genome containing the gene was isolated and characterized. Sequence analysis of the gene showed the absence of introns and the lack of CAAT and TATA boxes in the 5' flanking region. The transcription initiation site was mapped, and two sites 55 and 58 base pairs upstream of the ATG were observed. The 5' flanking region is rich in G+C residues and contains a G+C-rich motif as well as direct and inverted repeats. Functional OMP regulatory sequences were demonstrated in transgenic mice. An 11-kb chimeric gene was constructed in which the coding region for OMP was replaced with that for Thy-1.1. In Thy-1.2 mice carrying this transgene, Thy-1.1 was expressed solely by olfactory receptor neurons and their axons and terminals in the olfactory bulb.

Animals↗
PubMed1990

Structural and genetic organization of IS232, a new insertion sequence of Bacillus thuringiensis.

In the Bacillus thuringiensis strains toxic for the lepidopteran larvae, the delta-endotoxin genes cryIA are frequently found within a composite transposonlike structure flanked by two inverted repeat sequences. We report that these elements are true insertion sequences and designate them IS232. IS232 is a 2,184-bp element and is delimited by two imperfect inverted repeats (28 of 37 bp are identical). Two adjacent open reading frames, overlapping for three codons, span almost the entire sequence of IS232. The potential encoded polypeptides of 50 and 30-kDa are homologous to the IstA and IstB proteins of the gram-negative insertion sequence IS21. The N-terminal part of the 50-kDa polypeptide contains a helix-turn-helix DNA-binding motif. The junctions at the insertion sites of three IS232 elements were analyzed. Each case was different, with 0, 4, or 6 bp of the target DNA being duplicated. Transposition of IS232 in Escherichia coli was demonstrated by using a genetic marker inserted upstream of the two open reading frames.

Amino Acid Sequence↗
PubMed1989

The complete nucleotide sequence of the lux regulon of Vibrio fischeri and the luxABN region of Photobacterium leiognathi and the mechanism of control of bacterial bioluminescence.

We have determined the complete nucleotide sequence of a 7622 base pair fragment of DNA from Vibrio fischeri strain ATCC7744 that contains all the information required to confer plasmid-borne, regulated bioluminescence upon strains of Escherichia coli. The lux regulon from V. fischeri consists of two divergently transcribed operons, L (left) and R (right), and at least seven genes, luxR (L operon) and luxICDABE (R operon) and the intervening control region. The luxA and luxB genes encode respectively the alpha and beta subunits of luciferase. The gene order luxCDABE seen in V. fischeri is the same as for V. harveyi. We have determined the sequence of the luxAB and flanking regions from Photobacterium leiognathi and have found upstream sequences homologous with luxC from the Vibrio species, but between luxB and luxE, there is an open reading frame encoding a protein of 227 amino acids (26,229 molecular weight) that is not found in this location in the Vibrio species. The amino terminal amino acid sequence of the encoded protein is nearly identical to that determined by O'Kane and Lee (University of Georgia) for the non-fluorescent flavoprotein from a closely related Photobacterium species (Dr Dennis O'Kane, personal communication). We have therefore designated this gene luxN. There is a 20-base inverted repeat ACCTGTAGGAxTCGTACAGGT, centred between bases 927 and 928 in the region between the two operons of V. fischeri. This region appears to fulfil two functions: it is critical for the LuxR protein to exert its effect and it is a consensus binding site for the E. coli LexA protein, a negative regulatory protein involved with the SOS response. There are sequences within the luxR coding region that appear to function in a cis-acting fashion to repress transcription from both the leftward and rightward promoters in the absence of the respective transcriptional activator proteins, thereby resulting in low basal levels of transcription. It now appears clear that there are multiple levels of control on the lux system allowing for a modulation of the intensity of bioluminescence of over four orders of magnitude.

Amino Acid Sequence↗
PubMed2006

Both conserved and non-conserved regions of Spo11 are essential for meiotic recombination initiation in yeast.

DNA double-strand breaks (DSBs) are the initiators of most meiotic recombination events. In Saccharomyces cerevisiae, at least ten genes are necessary for meiotic DSB formation. However, the molecular roles of these proteins are not clearly understood. The meiosis-specific Spo11 protein, which shows sequence similarity with a subunit of an archaeal topoisomerase, is believed to catalyze the meiotic DSB formation. Spo11 is also required for induction of meiotic DSBs at long inverted repeats and at large trinucleotide repeat tracts. Here we report the isolation and characterization of temperature-sensitive spo11-mutant alleles to better understand how Spo11 functions, and how meiotic DSBs are generated at various recombination hotspots. Analysis of mutation sites of isolated spo11-mutant alleles indicated that both N-terminal and C-terminal non-conserved residues of Spo11 are essential for the protein's function, possibly for interaction with other meiotic DSB enzymes. Several of the mutation sites within the conserved region are predicted to lie on the surface of the protein, suggesting that this region is required for activation of the meiotic initiation complex via protein-protein interaction. In addition to the conditional mutants, we isolated partially recombination-defective mutants; analysis of one of these mutants indicated that Ski8, as observed previously, interacts with Spo11 via the latter's C-terminal residues.

Alleles↗
PubMed1991

Structure and organization of the gas vesicle gene cluster on the Halobacterium halobium plasmid pNRC100.

Halobacterium halobium strain NRC-1 contains intracellular gas-filled vesicles (GVs) that confer buoyancy to the cells. Cloning of the major GV protein (GvpA)-encoding gene, gvpA, and analysis of GV-deficient mutants (Vac-) of H. halobium led to the identification of a region of a 200-kb plasmid, pNRC100, important for GV synthesis. We report here the nucleotide sequence of an 8520-bp region which, including gvpA, contains twelve open reading frames (ORFs) that are organized into two divergent transcription units, gvpAC oriented rightward, and gvpD, E, F, G, H, I, J, K, L, and M located upstream from gvpAC and oriented leftward. Insertions into the gvpA promoter and gvpD and E resulted in the Vac- phenotype. The overall gene organization is highly compact with the end of one ORF overlapping with the beginning of the next in most cases. The gene cluster is bracketed by two ISH8 element copies in inverted orientation, an organization suggestive of a composite transposon. Comparison of predicted amino acid sequences showed homology between GvpA, and the gvpJ and gvpM putative gene products. The putative gvpC gene product contains eight copies of an imperfectly repeated sequence with similarity to repeats in a cyanobacterial GvpC plus a highly acidic C-terminal region not found in the cyanobacterial homologue.

Amino Acid Sequence↗