SEARCH · Search PubMed

Results for “DNA Modifications”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,603 records · Page 89Linked to original sources

PubMed2001

15-Deoxy-Delta 12,14-prostaglandin J2 inhibition of NF-kappaB-DNA binding through covalent modification of the p50 subunit.

Cyclopentenone prostaglandins display anti-inflammatory activities and interfere with the signaling pathway that leads to activation of transcription factor NF-kappaB. Here we explore the possibility that the NF-kappaB subunit p50 may be a target for the cyclopentenone 15-deoxy-Delta(12,14)-prostaglandin J(2) (15d-PGJ(2)). This prostaglandin inhibited the DNA binding ability of recombinant p50 in a dose-dependent manner. The inhibition required the cyclopentenone moiety and could be prevented but not reverted by glutathione and dithiothreitol. Moreover, a p50 mutant with a C62S mutation was resistant to inhibition, indicating that the effect of 15d-PGJ(2) was probably due to its interaction with cysteine 62 in p50. The covalent modification of p50 by 15d-PGJ(2) was demonstrated by reverse-phase high pressure liquid chromatography and mass spectrometry analysis that showed an increase in retention time and in the molecular mass of 15d-PGJ(2)-treated p50, respectively. The interaction between p50 and 15d-PGJ(2) was relevant in intact cells. 15d-PGJ(2) effectively inhibited cytokine-elicited NF-kappaB activity in HeLa without reducing IkappaBalpha degradation or nuclear translocation of NF-kappaB subunits. 15d-PGJ(2) reduced NF-kappaB DNA binding activity in isolated nuclear extracts, suggesting a direct effect on NF-kappaB proteins. Finally, treatment of HeLa with biotinylated-15d-PGJ(2) resulted in the formation of a 15d-PGJ(2)-p50 adduct as demonstrated by neutravidin binding and immunoprecipitation. These results clearly show that p50 is a target for covalent modification by 15d-PGJ(2) that results in inhibition of DNA binding.

Base Sequence↗

PubMed1999

Effect of A-ring modifications on the DNA-binding behavior and cytotoxicity of pyrrolo[2,1-c][1,4]benzodiazepines.

Several A-ring-modified analogues of the DNA-binding antitumor agent DC-81 (5) have been synthesized in order to study structure-reactivity/cytotoxicity relationships. For two molecules (23 and 30) the modifications required the addition of a fourth ring to give the novel dioxolo[4,5-h]- and dioxano[5,6-h]pyrrolo[2,1-c][1, 4]benzodiazepin-11-one (PBD) ring systems, respectively. Another three analogues (34, 38, and 48) have the native benzenoid A-ring replaced with pyridine, diazine, or pyrimidine rings to give the novel pyrrolo[2,1-c][1,4]pyridodiazepine, pyrrolo[2,1-c][1, 4]diazinodiazepine, and pyrrolo[2,1-c][1,4]pyrimidinodiazepine systems, respectively. The other new analogues (16a,b) have extended chains at the C8-position of the DC-81 structure. During the synthesis of these compounds, a novel tin-mediated regiospecific cleavage reaction of the dioxole intermediate 18 was discovered, leading to the previously unknown iso-DC-81 (20). In addition, an unusual simultaneous nitration-oxidation reaction of 4-(3-hydroxypropoxy)-3-methoxybenzoic acid (8) was found to produce 3-(4-carboxy-2-methoxy-5-nitrophenoxy)propanoic acid (9), a key intermediate, in high yield. In general, the results of cytotoxicity and DNA-binding studies indicated that none of the changes made to the A-ring of the PBD system significantly improved either binding affinity or cytotoxicity in comparison to DC-81. This result suggests that the superior potency of natural products such as anthramycin (1), tomaymycin (2), and sibiromycin (3) is due entirely to differences in C-ring structure, and in particular exo or endo unsaturation at the C2-position and C2-substituents containing unsaturation. This study also provided information regarding the influence of A-ring substitution pattern on the relative stability of the interconvertible N10-C11 carbinolamine, carbinolamine methyl ether, and imine forms of PBDs.

Animals↗

PubMed1990

Cloning and nucleotide sequence of the genes coding for the Sau96I restriction and modification enzymes.

The genes coding for the GGNCC specific Sau96I restriction and modification enzymes were cloned and expressed in E. coli. The DNA sequence predicts a 430 amino acid protein (Mr: 49,252) for the methyltransferase and a 261 amino acid protein (Mr: 30,486) for the endonuclease. No protein sequence similarity was detected between the Sau96I methyltransferase and endonuclease. The methyltransferase contains the sequence elements characteristic for m5C-methyltransferases. In addition to this, M.Sau96I shows similarity, also in the variable region, with one m5C-methyltransferase (M.SinI) which has closely related recognition specificity (GGA/TCC). M.Sau96I methylates the internal cytosine within the GGNCC recognition sequence. The Sau96I endonuclease appears to act as a monomer.

Amino Acid Sequence↗

PubMed2003

Histone modifications and silencing prior to DNA methylation of a tumor suppressor gene.

We attempted to answer two central questions about epigenetic silencing of the tumor suppressor gene p16(INK4a) in this study: (1) whether the maintenance of associated histone modifications is dependent on DNA methylation and (2) whether such histone modifications can occur prior to DNA methylation. By coupling chromatin immunoprecipitation with gene targeting and the analysis of specific alleles, we found that elimination of DNA methylation from a p16(INK4a) allele resulted in profound changes in surrounding histones. After continued passage of such cells, methylation of histone H3 lysine-9 occurred in conjunction with re-silencing in the absence of DNA methylation. These results have important implications for understanding the biochemical events underlying the silencing of tumor suppressor genes and the resultant growth suppression.

Cell Division↗

PubMed1997

Epirubicin-induced oxidative DNA damage and evidence for its repair in lymphocytes of cancer patients who are undergoing chemotherapy.

Anthracycline derivatives have been widely used in the treatment of several types of human malignancies. Cytotoxicity of these drugs has been attributed to inhibition of topoisomerase II as well as intracellular production of free radicals. In our work we used a gas chromatography/mass spectrometry technique to study free radical-induced DNA base modifications in chromatin isolated from lymphocytes of cancer patients who received chemotherapy with epirubicin (one of anthracycline's antitumor derivatives). The anticancer therapy caused significant increases in the amount of all four DNA base modifications over control levels in the lymphocytes of most of the patients. For the majority of the cases the base products returned to the control value 24 hr after the infusion of the drug, which suggests the removal of these lesions by cellular repair processes. However, some of the modified bases escaped repair. Because part of these modifications may possess premutagenic properties, they may be responsible for secondary cancers induced by chemotherapy.

Adult↗

PubMed2000

Cellular and molecular responses to topoisomerase I poisons. Exploiting synergy for improved radiotherapy.

The efficacy of topoisomerase (Topo) I-active drugs may be improved by better understanding the molecular and cellular responses of tumor compared to normal cells after genotoxic insults. Ionizing radiation (IR) + Topo I-active drugs (e.g., Topotecan) caused synergistic cell killing in various human cancer cells, even in cells from highly radioresistant tumors. Topo I poisons had to be added either during or immediately after IR. Synergy was caused by DNA lesion modification mechanisms as well as by concomitant stimulation of two pathways of cell death: necrosis (IR) + apoptosis (Topo I poisons). Cumulative data favor a mechanism of synergistic cell killing caused by altered DNA lesion modification and enhanced apoptosis. However, alterations in cell cycle regulation may also play a role in the synergy between these two agents in certain human cancers. We recently showed that NF-kappa B, a known anti-apoptotic factor, was activated in various cancer cells after poisoning Topo I using clinically active drugs. NF-kappa B activation was dependent on initial nuclear DNA damage followed by cytoplasmic signaling events. Cytoplasmic signaling leading to NF-kappa B activation after Topo I poisons was diminished in cytoplasts (lacking nuclei) and in CEM/C2 cells that expressed a mutant Topo I protein that did not interact with Topo I-active drugs. NF-kappa B activation was intensified in S-phase and blocked by aphidicolin, suggesting that activation was a result of double-strand break formation due to Topo I poisoning and DNA replication. Dominant-negative I kappa B expression augmented Topo I poison-mediated apoptosis. Elucidation of molecular signal transduction pathways after Topo I drug-IR combinations may lead to improved radiotherapy by blocking anti-apoptotic NF-kappa B responses. Recent data also indicate that synergy caused by IR + Topo I poisons is different from radiosensitization by beta-lapachone (beta-lap), a "reported" Topo I and II-alpha poison in vitro. In fact, beta-lap does not kill cells by poisoning either Topo I or II-alpha in vivo. Instead, the compound is "activated" by an IR (damage)-inducible enzyme, NAD(P)H:quinone oxidoreductase (NQO1), a gene cloned as x-ray-inducible transcript #3, xip3. Unlike the lesion modification pathway induced by IR + Topo I drugs, beta-lap kills cells via NQO1 futile cycle metabolism. Downstream apoptosis caused by beta-lap appears to be noncaspase-mediated, involving calpain or a calpain-like protease. Thus, although Topo I poisons or beta-lap in combination with IR both synergistically kill cancer cells, the mechanisms are very different.

Animals↗

PubMed1986

Intercalator-induced, topoisomerase II-mediated DNA cleavage and its modification by antineoplastic antimetabolites.

Defining specific biochemical targets of active antineoplastic agents could aid in discovering better anticancer therapy and more thoroughly understanding the biochemical basis of malignancy. Through a series of cellular and biochemical studies, we and others have identified the nuclear enzyme topoisomerase II as the target of several active agents, including 4'-(9-acridinylamino) methanesulfon-m-anisidide (m-AMSA). The interference with topoisomerase II produced by m-AMSA can be quantified in whole cells exposed to m-AMSA by using the alkaline elution technique to measure DNA cleavage. Antimetabolites such as ara-C, hydroxyurea, and 5-azacytidine can augment m-AMSA-induced, topoisomerase II-mediated DNA cleavage and, concurrently, m-AMSA-induced cell killing. Studies in proliferating and quiescent human cells and an m-AMSA-sensitive/resistant human leukemia cell pair further support the hypothesis that a connection exists between topoisomerase II-mediated DNA cleavage and the mechanism by which m-AMSA kills cells. Pharmacologic or hormonal modification of specific biochemical processes critical to drug-induced cytotoxicity may enhance the therapeutic index of clinically useful agents.

Aminoacridines↗

PubMed2005

Genomic sequence correction by single-stranded DNA oligonucleotides: role of DNA synthesis and chemical modifications of the oligonucleotide ends.

BACKGROUND: Single-stranded oligonucleotides (ssODN) can induce site-specific genetic alterations in selected mammalian cells, but the involved mechanisms are not known. METHODS: We corroborate the potential of genomic sequence correction by ssODN using chromosomally integrated mutated enhanced green fluorescent protein (mEGFP) reporter genes in CHO cell lines. The role of integration site was studied in a panel of cell clones with randomly integrated reporters and in cell lines with site-specific single copy integration of the mEGFP reporter in opposite orientations. Involvement of end modification was examined on ssODN with unprotected or phosphorothioate (PS) protected ends. Also ssODN containing octyl or hexaethylene glycol (HEG) end blocking groups were tested. The significance of DNA synthesis was investigated by cell cycle analysis and by the DNA polymerases alpha, delta and epsilon inhibitor aphidicolin. RESULTS: Correction rates of up to 5% were observed upon a single transfection of ssODN. Independent of the mEGFP chromosomal integration site and of its orientation towards the replication fork, antisense ssODN were more effective than sense ssODN. When ssODN ends were blocked by either octyl or HEG groups, correction rates were reduced. Finally, we demonstrate a dependence of the process on DNA synthesis. CONCLUSIONS: We show that, on a chromosomal level, the orientation of the replication fork towards the targeted locus is not central in the strand bias of ssODN-based targeted sequence correction. We demonstrate the importance of accessible ssODN ends for sequence alteration. Finally, we provide evidence for the involvement of DNA synthesis in the process.

Animals↗

PubMed1986

Reevaluation of interaction of cis-dichloro(ethylenediamine)platinum(II) with DNA.

Intrastrand cross-links represent the majority of modifications in DNA resulting from interaction with the cancer chemotherapeutic drug cis-diamminedichloroplatinum(II) (cis-DDP). These adducts were recently characterized although several discrepancies remained to be resolved. In these studies, [3H]-cis-dichloro(ethylenediamine)platinum(II) (cis-DEP) was used because of the convenience of the radiolabel; this analogue produces adducts at identical sites in DNA as cis-DDP. Both drugs platinate the following sequences in DNA: GG, 65%; AG, 25%; GNG, 6%. The adduct at AG sequences invariably has adenine on the 5'-terminus of the dimer. The present enzyme digestion protocol included P1 nuclease, which produced complete digestion rather than as previously reported. The frequency of platination at GG was too high to be explained by an initial monofunctional platination at any guanine. However, direct bifunctional attack preferentially at GG was obviated because monofunctional adducts could be trapped with thiourea at short time periods. After short incubations, with cis-DEP and removal of unreacted drug, the monofunctional adducts slowly rearranged to bifunctional adducts. It is suggested that this evolution of adducts may result from the drug "walking" along the double helix, a phenomenon that does not appear to occur in single-stranded DNA.

Animals↗

PubMed1989

Reduction of alkali-induced white blood cell DNA unwinding rate: a potential biomarker of aging.

The modification of DNA with aging or in diabetes mellitus has been proposed as a possible mechanism of cellular senescence. To test this hypothesis, we measured DNA strand breaks in human white blood cells (WBC) by fluorometric analysis of DNA unwinding in alkaline solutions. In a nondiabetic population with an age range 22-80 years, there was a significant negative correlation between the rate of DNA unwinding and the age of the individual with an r of 0.60 (p less than .001). The rate of alkaline digestion of double-stranded DNA (ds DNA) in the elderly diabetics (n = 26, 65-80 yrs) was significantly lower than that in the nondiabetic, age-matched ambulatory elderly. Within the healthy group studied, there was a statistically significant correlation between the rate of DNA unwinding and plasma glucose concentration (p less than .05) or glycosylated hemoglobin A1C levels (p less than .0001). The availability of WBC and the relative ease and rapidity of the technique employed make this a potentially useful biological marker of aging.

Adult↗

PubMed1992

Biophysical analysis of DNA modified by 1,2-diaminocyclohexane platinum(II) complexes.

Modification of DNA and double-stranded deoxyoligonucleotides with antitumour 1,2-diamino-cyclohexanedinitroplatinum(II) (Pt-dach) complexes was investigated with the aid of physico-chemical methods and chemical probes of nucleic acid conformation. The three Pt-dach complexes were used which differed in isomeric forms of the dach nonleaving ligand-Pt(1R,2R-dach), Pt(1S,2S-dach) and Pt(1R,2S-dach) complexes. The latter complex has lower antitumour activity than the other two Pt-dach complexes. Pt(1R,2S-dach) complex exhibits the slowest kinetics of its binding to DNA and of the conversion of monofunctional binding to bifunctional lesions. The anomalously slow electrophoretic mobility of multimers of the platinated and ligated oligomers suggests that bifunctional binding of Pt-dach complexes to a d(GG) site within double-stranded oligonucleotides induces bending of the oligomer. In addition, chemical probing of double-helical deoxyoligonucleotides modified by the Pt-dach complexes at the d(GG) sites reveals that Pt(1R,2S-dach) complex induces more extensive conformational changes in the oligomer than Pt(1R,2R-dach) and Pt(1S,2S-dach) complexes. It is proposed that different effects of the Pt-dach complexes on DNA observed in this work arise mainly from a steric crowding of the axially oriented cyclohexane ring in the DNA adduct of Pt(1R,2S-dach) complex.

Antineoplastic Agents↗

PubMedDate not supplied

[Comparative study of the efficacy of modifying DNA polymerase and DNA matrix by different photoactive groups at the 3'-end of the DNA primer].

The dependence of the modification efficiency of DNA polymerases and DNA template on the nature of photoactivatable group and the length of the linker that joins the group with the heterocyclic base of the primer 3'-terminal nucleotide was studied. The primers that contained the photoreactive groups at their 3'-termini were obtained using the rat DNA polymerase beta or the DNA polymerase from Thermus thermophilus in the presence of one of the dTTP analogues carrying the photoreactive group in position 5 of thymidine residue. After irradiating the reaction mixture with UV light and separating the modification products, the level of covalent binding of the [5'-32P]primer to DNA polymerases and template was determined. The primers containing 4-azido-2,5-difluoro-3-chloropyridyl group were shown to be the most effective in the modification of DNA polymerases.

Autoradiography↗

PubMed2006

Epigenetic therapy--a new development in pharmacology.

Epigenetics, heritable changes in gene expression that do not involve changes in DNA sequence, is known to be involved in disease. Two important epigenetic changes that are known to contribute to disease are abnormal methylation patterns of DNA and modifications of histones in chromatin. This review describes a new development in pharmacology, epigenetic therapy, which attempts to correct these changes. At present two groups of drugs are being developed. One inhibits DNA methyltransferases (DNMTs) resulting in the inhibition of DNA methylation. This group of drugs may prove to be useful in the treatment of cancer where hypermethylation of tumour suppressor genes is known to lead to silencing of these genes. The other group of drugs inhibits histone deacetylases (HDACs) resulting in the accumulation of acetylated histones which are thought to mediate the anticancer effects of these drugs. Both these drug groups have shown promising results in drug trials for the treatment of cancer. Since epigenetic changes are thought to underlie a wide range of diseases, the scope of epigenetic therapy is likely to expand.

Clinical Trials as Topic↗

PubMed2001

Controlled immobilization of DNA molecules using chemical modification of mica surfaces for atomic force microscopy: characterization in air.

Immobilization of biomolecules on surfaces while keeping the maximum conformational flexibility of the molecules is one of the most important techniques for atomic force microscopy imaging. We have developed two methods of controlling adsorption of DNA molecules on mica surfaces. The first method is the use of a mica surface modified with diluted 3-aminopropyltriethoxysilane (APS). Here we named this a "diluted APS-treated mica (AP-mica)" technique. The second method is the use of a mica surface modified with mixed self-assembled monolayers of organosilanes. In both of the techniques, the number of DNA molecules immobilized on a mica surface was controlled. Further, a conformational change of circular DNA, from a supercoiled to a relaxed form was observed for the molecules immobilized on a diluted AP-mica surface, when 254-nm UV light was irradiated. This observation demonstrated that flexibility of circular DNA molecules was kept on a diluted AP-mica surface.

Air↗

PubMed1993

[Features of interaction of Escherichia coli DNA polymerase I and its Klenow fragment with dTTP gamma-p-azidoanilide].

gamma-p-Azidoanilidate of dTTP was used to study the photoaffinity modification of DNA polymerase I and Klenow fragment. The analog was found to be a mixed-type inhibitor with respect to dTTP of the polymerization reaction catalyzed by DNA polymerase I and Klenow fragment. In the absence of the reagent both UV-irradiated enzymes were rapidly inactivated. Substrates (dNTP and template-primer) protected the enzymes from inactivation by UV-light with different efficiency. In the presence of the template-primer UV-irradiation induced activation of DNA polymerase I. The effect of the analog on both enzyme forms under irradiation is different. At concentration of 10(-5)M gamma-p-anilidate of dTTP accelerated the activation of DNA polymerase I initiated by UV-irradiation and at 10(-4)M concentration it inactivated the enzyme by 20-25%. Under such conditions one enzyme molecule covalently bound two molecules of the analog. While the template-complementary substrate (dTTP) protected DNA polymerase I both from inactivation and modification, the non-complementary one (dCTP) worked only against modification. In contrast to DNA polymerase I Klenow fragment was not inactivated when exposed to UV-irradiation and gamma-p-anilidate of dTTP neither modified the protein nor exerted any significant effect on its polymerization activity. The data accumulated suggest the presence on the DNA polymerase I molecule of a regulatory region providing additional dNTP binding sites.

Azides↗

PubMed2002

Proliferating cell nuclear antigen associates with histone deacetylase activity, integrating DNA replication and chromatin modification.

Faithful inheritance of the chromatin structure is essential for maintaining the gene expression integrity of a cell. Histone modification by acetylation and deacetylation is a critical control of chromatin structure. In this study, we test the hypothesis that histone deacetylase 1 (HDAC1) is physically associated with a basic component of the DNA replication machinery as a mechanism of coordinating histone deacetylation and DNA synthesis. Proliferating cell nuclear antigen (PCNA) is a sliding clamp that serves as a loading platform for many proteins involved in DNA replication and DNA repair. We show that PCNA interacts with HDAC1 in human cells and in vitro and that a considerable fraction of PCNA and HDAC1 colocalize in the cell nucleus. PCNA associates with histone deacetylase activity that is completely abolished in the presence of the HDAC inhibitor trichostatin A. Trichostatin A treatment arrests cells at the G(2)-M phase of the cell cycle, which is consistent with the hypothesis that the proper formation of the chromatin after DNA replication may be important in signaling the progression through the cell cycle. Our results strengthen the role of PCNA as a factor coordinating DNA replication and epigenetic inheritance.

Cell Cycle↗

PubMed1993

Functional expression and properties of the tRNA(Lys)-specific core anticodon nuclease encoded by Escherichia coli prrC.

Escherichia coli carrying the optional locus prr harbor a latent, tRNA(Lys)-specific anticodon nuclease, activated by the product of phage T4 stp. Anticodon nuclease latency is ascribed to the masking of prrC, implicated with the enzymatic activity, by flanking, type Ic DNA restriction modification genes (prrA, B&D-hsdM, S&R). Overexpression of plasmid-borne prrC elicited anticodon nuclease activity in uninfected E. coli. In vitro, the prr-C-coded core activity was indifferent to a synthetic Stp polypeptide, GTP, ATP, and endogenous DNA, effectors that synergistically activate the latent enzyme. Several facts suggested that PrrC is highly labile in the absence of the masking proteins. The core activity decayed with t1/2 below 1 min at 30 degrees C, and the PrrC portion of a fusion protein was unstable. Moreover, expression of prrC from its own promoter at low plasmid copy number did not allow detection of core activity. Yet, it sufficed for establishment of a latent, T4-inducible enzyme when complemented by the masking Hsd proteins, which were provided by another replicon. Interaction between the antagonistic components of latent anticodon nuclease was also demonstrated immunochemically. The coupling of anticodon nuclease with a DNA restriction modification system may serve to ward off its inadvertent toxicity and maintain it as an antiviral contingency.

Amino Acid Sequence↗

PubMed1990

Vitamin D-mediated modifications in protein-DNA interactions at two promoter elements of the osteocalcin gene.

By the combined use of DNase I footprinting, electrophoretic mobility-shift assay, and methylation interference analysis, we have identified a series of sequence-specific protein-DNA interactions in the 5' flanking region of the rat osteocalcin gene. Stimulation of osteocalcin gene expression by 1,25-dihydroxyvitamin D3, a physiologic mediator of this bone-specific gene in vitro and in vivo, is associated with modifications in the binding of ROS 17/2.8 cell nuclear factors to two promoter segments that up-regulate transcription. One segment located between -462 and -437 exhibits a vitamin D-dependent increase in sequence-specific binding of nuclear factors. This element (CTGGGTGAATGAGGACATTACTGACC), identified at single nucleotide resolution, contains a region of hyphenated dyad symmetry and shares sequence homology with consensus steroid-responsive elements and with the sequence that has been identified as the vitamin D receptor binding site in the human osteocalcin gene. We have also observed that vitamin D stimulation of osteocalcin gene expression results in a 5-fold increase in protein binding to the region of the osteocalcin box, a 24-nucleotide segment in the proximal promoter with a CCAAT motif as the central core. Our results demonstrate protein-DNA interactions in a vitamin D-responsive element and in a second sequence, the osteocalcin box, both of which are involved in the physiologic regulation of the osteocalcin gene in response to 1,25-dihydroxyvitamin D3.

Animals↗