Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “CALORIMETRY”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,603 records · Page 89Linked to original sources
PubMed1989

Resting energy expenditure in Gaucher's disease type 1: effect of Gaucher's cell burden on energy requirements.

The resting energy expenditure (REE; kcal/d) of 25 patients with Gaucher's disease type 1 was determined by indirect calorimetry. The average observed REE for the group was approximately 44% greater (P less than .01) than that predicted (predicted REE) for these patient's age, sex, height, and weight. The increased caloric requirements of these patients was manifested by a height-for-age less than or equal to the fifth percentile in seven of nine growing children and a muscle mass of less than the fifth percentile in 15 of 19 patients studied. The excess REE (observed REE--predicted REE) for individual Gaucher's disease type 1 patients was directly related to their liver volume as estimated from radionuclide scans and to the mass of the spleen as measured at splenectomy. The relationship between spleen mass and excess REE was demonstrated by an average 22.0% decrease in REE following splenectomy in five patients. Based on these data, the metabolic rate of the splenic tissue removed from the patients was calculated to be 96.8 kcal/d/kg, about twofold to threefold less than that of normal splenic tissue. These findings indicate that the elevated REE observed in these patients resulted from the large mass of Gaucher's cells, which although individually hypometabolic, were cumulatively an excessive metabolic burden. Furthermore, they suggest that indirect calorimetry may be a quantitative tool for measuring disease progression and the effect of therapeutic intervention in Gaucher's disease type 1.

Adolescent↗
PubMed1993

Effects of colonic fermentation on respiratory gas exchanges following a glucose load in man.

Colonic fermentation produces short-chain fatty acids (SCFA). In humans, the amount of energy produced from the oxidation of these compounds is unknown and could modify the metabolic utilization of energetic fuels (eg, carbohydrates and lipids). If it were so, the equations used to evaluate the oxidation of nutrients from indirect calorimetry data should include the contribution of SCFA, which is not usually the case. Indeed, this fermentation process is usually considered as a minor and neglected energetic pathway. In this study, we have addressed the reliability of this assumption. Six normal subjects received orally either 50 g glucose or 50 g glucose plus 20 g lactulose. Their respiratory gas exchanges, breath hydrogen, methane, and 13CO2 concentrations, and plasma glucose, insulin, and free fatty acid (FFA) concentrations were monitored for 8 hours. CO2 production and breath hydrogen concentration were significantly greater with lactulose. No differences in oxygen consumption, breath 13CO2 production, or plasma concentrations of blood glucose, FFA, and insulin could be found between the two experiments. This suggests that the fermentation process induced by lactulose generates extra fuels going through an oxidation pathway. Therefore, the classic equations used to calculate carbohydrate and lipid oxidation and energy expenditure (EE) from indirect calorimetry data are probably not valid when fermentation is taking place. Indeed, in this experiment we could have overestimated glucose oxidation (12.5%) if the fermentation process were not considered. In conclusion, colonic fermentation in humans of nondigestible carbohydrates produces energetic substrates that could be used and oxidized as energetic fuels.(ABSTRACT TRUNCATED AT 250 WORDS)

Adolescent↗
PubMed1990

Water sorption and mechanical properties of dental composites.

The physical properties of four commercial dental composites were investigated through differential scanning calorimetry, water sorption and desorption measurements and flexural mechanical properties tests. The differential scanning calorimetry curves of samples as prepared and after different times of ageing in water indicated that the small residual monomer reactivity, present in the as prepared samples, disappeared after immersion in water, which probably acts as a plasticizer and facilitates a further crosslinking reaction of the material and the residual monomer desorption. Consistently, water causes the embrittlement of the material, as detected from the flexural mechanical properties. Water sorption and desorption kinetics were measured at different temperatures, the water diffusion coefficients were calculated and the activation energies of the diffusion process were determined. The SEM analysis of the fracture surfaces and the decrease of the water uptake on the temperature indicated the existence of a good filler/matrix adhesion.

Adsorption↗
PubMed1976

Thermodynamic investigations of proteins. I. Standard functions for proteins with lysozyme as an example.

A direct method is proposed for obtaining thermodynamic standard functions for native and denatured proteins using experimental data from scanning calorimetry, isothermal calorimetry and potentiometric titrations. The possibility of this approach is demonstrated on the example of lysozyme in the range of pH 1.5-7.0 and temperature 0-100 degrees C. Tests for the validity of the obtained functions of enthalpy and entropy are presented in the form of cyclic processes using experimental data obtained from thermodynamically different pathways. The Gibbs function is checked by comparison with results of an independent method. The methodic problems in determining and checking standard functions for proteins are discussed in detail.

Calorimetry↗
PubMed1978

Base stacking in the dinucleoside phosphate rapa.

The pH-induced unstacking of rRpA has been investigated by batch calorimetry and uv spectroscopy. Equilibrium uv melting curves confirmed that the adenine bases in rApA are stacked at pH7 but unstacked at pH 1.5. The enthalpy change accompanying this pH-induced unstacking is +2.65 kcal (mole of A-A stack)-1 as measured by batch calorimetry. This represents the first direct determination of this important parameter for a dinucleoside phosphate. It is noted that the calorimetrically determined value reported here is considerably lower than published van't Hoff enthalpies but is consistent with values that can be derived from calorimetric data on polymers.

Base Sequence↗
PubMed1989

Calorimetric and circular dichroic studies of the thermal denaturation of beta-lactoglobulin.

The thermal denaturation of beta-lactoglobulin in aqueous solutions at pH 5.5 and 2.0 was investigated by differential scanning calorimetry (DSC) and circular dichroic (CD) measurements. By calorimetry, the denaturation temperatures (Td), denaturation enthalpies, and specific heat capacity changes for thermal denaturation in the temperature range scanned, i.e., 20-100 degrees C. The unfolding process was found to be only partially reversible. Analysis of the far-ultraviolet CD spectra reveals that with increasing temperature the mean residue ellipticity [( theta]) becomes less negative, which reflects unfolding of the native protein. At the highest temperature of CD measurements, i.e., 80 degrees C, conformational changes are to a large extent reversible.

Calorimetry, Differential Scanning↗
PubMed1996

Metabolic rate, organ mass, and mitochondrial proton leak variations in lean and obese rats.

The purpose of this study was to determine if differences in metabolic rate between lean and obese strains of rats were associated with differences in proton leak across the inner mitochondrial membrane. Metabolic rates were determined for each of five obese Zucker, Sprague-Dawley, and Fisher 344 rats and three lean Zucker rats by 24-hour indirect respiration calorimetry measurements. Feed intakes were different (P < 0.05) among all strains, with the obese Zucker rats having the greatest intakes. Adjusted to a common dietary intake, the obese Zucker rats had at least 21% lower heat productions than the lean strains of rats. Following the calorimetry measurements, the rats were sacrificed, internal organs were removed and weighed and mitochondria were isolated from the liver. Internal organs composed a larger proportion of lean body mass in obese compared to lean rats. Respiration rates and membrane potentials of the mitochondria were then determined. Proton leak kinetics were visualized by plotting proton leak (calculated from respiration rate) against membrane potential. The lean rats had a 2-3-fold higher proton leak rate than the obese Zucker rats at the same membrane potential. A low mitochondrial proton leak rate may explain part of the abnormal heat productions and bioenergetic efficiencies in the obese Zucker rat.

Animals↗
PubMed1995

A multi-sample denaturation temperature tester for collagenous biomaterials.

The temperature at which collagen denatures from a triple helix to a random coil structure is a useful measure of the degree of crosslinking. A new multi-sample denaturation temperature tester (DTT) has been constructed for rapid determination of the collagen denaturation temperature of natural tissues and collagenous biomaterials. To validate the system, the denaturation temperatures measured for the DTT are compared with results from differential scanning calorimetry (DSC). Data are presented for bovine pericardium in three states with denaturation temperatures ranging from 68 to 85 degrees C: fresh, or crosslinked with glutaraldehyde or the epoxide reagent Denacol EX-512 poly (glycidyl ether). Denaturation temperatures measured by DTT were not significantly different from those measured by differential scanning calorimetry (DSC); however, DSC onset systematically occurred at a slightly lower temperature than that measured by DTT. This result, seen only for fresh tissue is in agreement with earlier experiments using hydrothermal isometric tension (HIT) testing. By contrast, DTT and DSC onset were identical for the exogenously crosslinked materials. Since the measured transition temperature was independent of initial load, this variable may be chosen to yield sharper force-temperature transitions with a given sample geometry. This instrument allows accurate assessment of collagen denaturation temperatures for multiple samples in a fraction of the time required by other methods.

Animals↗
PubMed1996

Mechanism of denaturation of bovine serum albumin by dodecyl trimethylammonium bromide.

Bovine serum albumin (BSA) denaturation has been extensively studied by different anionic and cationic surfactant. Dodecyl trimethylammonium bromide (DTAB) is a cationic surfactant, and it is suggested that it binds to the C-terminal section of BSA. In the present study, the thermodynamical denaturation of BSA by dodecyl trimethylammonium bromide (DTAB) has been studied with various experimental techniques. Equilibrium dialysis, thermal denaturation, gel electrophoresis, titration microcalorimetry at pH 7, I = 0.005, and different temperatures were all performed. The enthalpy obtained from the van't Hoff relation and calorimetry method as well as electrophoresis results were utilized to explain the BSA tranistion state. Major findings included: the binding isotherm shifts at a low free concentrations of DTAB and at a higher temperature suggest endothermicity for enthalpy of interaction; the calorimetry enthalpy (delta Hcal) of interaction was smaller than the van't Hoff enthalpy (delta HvH) for BSA-DTAB interaction; and the aggregation of BSA increased with increasing DTAB concentration. This study suggests that BSA unfolding induced by DTAB follows a multistate transition model and does not follow the two-state mechanism assumed for most single subunit proteins.

Animals↗
PubMed2006

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques.

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.

Amidines↗
PubMed2006

Spectroscopic and thermodynamic measurements of nucleotide-induced changes in the human 70-kDa heat shock cognate protein.

Hsp70 alternates between an ATP-bound state in which the affinity for substrate is low and an ADP-bound state in which the affinity for substrate is high, as a result Hsp70 assists the protein folding process through nucleotide-controlled cycles of substrate binding and release. In this work, we describe the cloning and purification of the human 70-kDa heat shock cognate protein, Hsc70, and the use of circular dichroism, intrinsic emission fluorescence, and isothermal titration calorimetry to characterize conformational changes induced by ADP and ATP binding. Binding of either ADP or ATP were not accompanied by a net change in secondary structure suggesting that the conformational rearrangement caused by nucleotide binding is localized. MgADP or MgATP had a greater effect in the stability at stress temperatures than ADP or ATP did. Isothermal titration calorimetry data pointed out that Hsc70 had a lower affinity for ATP (KD=710 nM) than for ADP (KD=260 nM).

Adenosine Diphosphate↗
PubMed2005

Herbicide binding and thermal stability of photosystem II isolated from Thermosynechococcus elongatus.

Binding of herbicides to photosystem II inhibits the electron transfer from Q(A) to Q(B) due to competition of herbicides with plastoquinone bound at the Q(B) site. We investigated herbicide binding to monomeric and dimeric photosystem II core complexes (PSIIcc) isolated from Thermosynechococcus elongatus by a combination of different methods (isothermal titration and differential scanning calorimetry, CD spectroscopy and measurements of the oxygen evolution) yielding binding constants, enthalpies and stoichiometries for various herbicides as well as information regarding stabilization/destabilization of the complex. Herbicide binding to detergent-solubilized PSIIcc can be described by a model of single independent binding sites present on this important membrane protein. Interestingly, binding stoichiometries herbicide:PSIIcc are lower than 1:1 and vary depending on the herbicide under study. Strong binding herbicides such as terbutryn stabilize PSIIcc in thermal unfolding experiments and endothermically binding herbicides like ioxynil probably cause large structural changes accompanied with the binding process as shown by differential scanning calorimetry experiments of the unfolding reaction of PSIIcc monomer in the presence of ioxynil. In addition we studied the occupancy of the Q(B) sites with plastoquinone (PQ9) by measuring flash induced fluorescence relaxation yielding a possible explanation for the deviations of herbicide binding from a 1:1 herbicide/binding site model.

Binding Sites↗
PubMed2005

Antimicrobial activity and membrane selective interactions of a synthetic lipopeptide MSI-843.

Lipopeptide MSI-843 consisting of the nonstandard amino acid ornithine (Oct-OOLLOOLOOL-NH2) was designed with an objective towards generating non-lytic short antimicrobial peptides, which can have significant pharmaceutical applications. Octanoic acid was coupled to the N-terminus of the peptide to increase the overall hydrophobicity of the peptide. MSI-843 shows activity against bacteria and fungi at micromolar concentrations. It permeabilizes the outer membrane of Gram-negative bacterium and a model membrane mimicking bacterial inner membrane. Circular dichroism investigations demonstrate that the peptide adopts alpha-helical conformation upon binding to lipid membranes. Isothermal titration calorimetry studies suggest that the peptide binding to membranes results in exothermic heat of reaction, which arises from helix formation and membrane insertion of the peptide. 2H NMR of deuterated-POPC multilamellar vesicles shows the peptide-induced disorder in the hydrophobic core of bilayers. 31P NMR data indicate changes in the lipid head group orientation of POPC, POPG and Escherichia colitotal lipid bilayers upon peptide binding. Results from 31P NMR and dye leakage experiments suggest that the peptide selectively interacts with anionic bilayers at low concentrations (up to 5 mol%). Differential scanning calorimetry experiments on DiPOPE bilayers and 31P NMR data from E.coli total lipid multilamellar vesicles indicate that MSI-843 increases the fluid lamellar to inverted hexagonal phase transition temperature of bilayers by inducing positive curvature strain. Combination of all these data suggests the formation of a lipid-peptide complex resulting in a transient pore as a plausible mechanism for the membrane permeabilization and antimicrobial activity of the lipopeptide MSI-843.

Anti-Bacterial Agents↗
PubMed2006

Complexation of phosphocholine liposomes with polylysine. Stabilization by surface coverage versus aggregation.

Complexation between linear poly-L-lysine (PLL) and negatively charged phosphocholine unilamellar liposomes has been investigated by means of dynamic light scattering, microelectrophoresis, and differential scanning calorimetry. It is found that complexation results in charge inversion (vesicle coating/stabilization) or vesicle aggregation depending on various experimental conditions. Complexation in dependence on PLL concentration and molecular mass, lipid phase state, rate and order of liposome and PLL mixing and time evolution of complexes are investigated and discussed. Aggregation profiles are determined and size distribution of the aggregates formed is studied, leading to the possibility of aggregation control. The time evolution of vesicle aggregation shows particle enlargement consisting in particle growth up to the irreversible formation of thermodynamically stable aggregates of about 2 microm in diameter. The formation of stable aggregates is in agreement with theoretical predictions of colloid particles aggregation by an interplay of long range electrostatic repulsion and short range attraction. Differential scanning calorimetry reveals that physical adsorption occurs exclusively on the vesicle surface and the lipidic organization is not significantly disturbed. The present study describes multivariable aspects of the complexation process between liposomes and polyions which results in the formation of a new class of still poorly defined colloids. These results allow establishing and optimization of a procedure for fabrication of polycation-stabilized vesicles to be used for various applications such as drug delivery.

Calorimetry, Differential Scanning↗
PubMed2005

Ligand-induced thermostability in proteins: thermodynamic analysis of ANS-albumin interaction.

A comparative thermodynamic study of the interaction of anilinonaphthalene sulfonate (ANS) derivatives with bovine serum albumin (BSA) was performed by using differential scanning calorimetry (DSC) and isothermal titration calorimetry (ITC). The chemically related ligands, 1,8-ANS and 2,6-ANS, present a similar affinity for BSA with different binding energetics. The analysis of the binding driving forces suggests that not only hydrophobic effect but also electrostatic interactions are relevant, even though they have been extensively used as probes for non-polar domains in proteins. Ligand association leads to an increase in protein thermostability, indicating that both dyes interact mainly with native BSA. ITC data show that 1,8-ANS and 2,6-ANS have a moderate affinity for BSA, with an association constant of around 1-9x10(5) M(-1) for the high-affinity site. Ligand binding is disfavoured by conformational entropy. The theoretical model used to simulate DSC data satisfactorily reproduces experimental thermograms, validating this approach as one which provides new insights into the interaction between one or more ligands with a protein. By comparison with 1,8-ANS, 2,6-ANS appears as a more "inert" probe to assess processes which involve conformational changes in proteins.

Anilino Naphthalenesulfonates↗
PubMed2006

Proton exchange coupled to the specific binding of alkylsulfonates to serum albumins.

We have applied isothermal titration calorimetry to investigate the linkage between ligand binding and the uptake or release of protons by human serum albumin (HSA) and bovine serum albumin (BSA). The ligands were sodium decyl sulfate (SDeS) and sodium dodecyl sulfate (SDS). Within a certain temperature range, the binding isotherm could be clearly resolved into two classes of sites (high affinity and low affinity) and modeled assuming independence and thermodynamic equivalence of the sites within each class. Measurements at pH 7.0 in different buffer systems revealed that the binding of SDS to the high affinity sites did not couple to any exchange of protons in either of the proteins. Saturation of the 6-8 low affinity sites for SDS, on the other hand, brought about the release of two protons from both HSA and BSA. In addition to elucidating the pH dependence of ligand binding, this analysis stressed that binding enthalpies for the low affinity sites measured by calorimetry must be corrected for effects due to the concomitant protonation of the buffer. The shorter ligand SDeS bound to HSA with a comparable stoichiometry but with four times lower affinity. Interestingly, no proton linkage was observed for the binding of SDeS. An empirical structural analysis suggested that His 242 in site 7 (of HSA) is a likely candidate for one of the proton donors.

Algorithms↗
PubMed2005

Cholesteryl oligoethyleneglycol glycosides: fluidizing effect of their embedment into phospholipid bilayers.

Glycosides of cholesteryl oligoethyleneglycols have been synthesized and embedded in liposome bilayers. Several methods as steady-state fluorescence polarization, differential scanning calorimetry, zeta potential, and agglutination have been used to describe the physicochemical outcome of the incorporation of these synthetic glycolipids within phospholipid layers. From calorimetry and fluorescence experiments, it is apparent that the glycolipids decrease the transition temperature of the bilayers in a more important extent than cholesterol. Furthermore, the thickness of the aqueous layer fixed around the liposome is independent of the presence of glycolipids, suggesting that their hydrophilic parts (tetraethyleneglycol spacer and sugar moiety) are not completely extended towards the aqueous phase. Nevertheless, an important and specific interaction has been observed between such glycosylated liposomes and vegetal lectins.

Calorimetry, Differential Scanning↗
PubMed2005

Effects of small heat shock proteins on the thermal denaturation and aggregation of F-actin.

Effect of recombinant chicken small heat shock protein with molecular mass 24 kDa (Hsp24) and recombinant human small heat shock protein with molecular mass 27 kDa (Hsp27) on the heat-induced denaturation and aggregation of skeletal F-actin was analyzed by means of differential scanning calorimetry and light scattering. All small heat shock proteins did not affect thermal unfolding of F-actin measured by differential scanning calorimetry, but effectively prevented aggregation of thermally denatured actin. Small heat shock protein formed stable complexes with denatured (but not with intact) F-actin. The size of these highly soluble complexes was smaller than the size of intact F-actin filaments. It is supposed that protective effect of small heat shock proteins on the cytoskeleton is at least partly due to prevention of aggregation of denatured actin.

Actins↗