Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Replication Origin”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,549 records · Page 86Linked to original sources
PubMed1985

A putative origin of replication of plasmids derived from Epstein-Barr virus is composed of two cis-acting components.

A genetic element of Epstein-Barr virus, oriP, when present on recombinant plasmids allows those plasmids to replicate and to be maintained in cells that express the Epstein-Barr virus-encoded nuclear antigen EBNA-1. Here we define the DNA sequences required for oriP activity. Two noncontiguous regions of oriP are required in cis for activity. One consists of approximately 20 tandem, imperfect copies of a 30-base-pair (bp) sequence. The other required region, approximately 1,000 bp away, is at most 114 bp in length and contains a 65-bp region of dyad symmetry. When present together on a plasmid, these two components supported plasmid replication even when the distance between them was varied or their relative orientation was altered, or both. When present alone on a plasmid that expresses a selectable marker, the family of 30-bp repeats efficiently conferred a transient drug-resistant phenotype in human 143 cells that is dependent on the presence of EBNA-1. This result leads us to suggest that EBNA-1 interacts with the 30-bp repeated sequence to activate oriP. To test whether the 30-bp repeats might cause the increased transient expression of drug resistance by enhancing transcription, the family of 30-bp repeats was tested for the ability to activate the simian virus 40 early promoter present in plasmid pA10CAT2 (Laimins, et al., Proc. Natl. Acad. Sci. U.S.A. 79:6453-6457). In this assay, the 30-bp repeats could activate the simian virus 40 early promoter in Raji cells, an EBNA-positive Burkitt's lymphoma cell line, but not detectably an EBNA-positive 143 cells in which oriP also functions.

Acetyltransferases↗
PubMed2005

Interplay between DNA replication and recombination in prokaryotes.

The processes of DNA replication and recombination are intertwined at many different levels. In diverse systems, extensive DNA replication can be triggered by genetic recombination, with assembly of a replication complex onto a D-loop recombination intermediate. This and related pathways of replisome assembly allow the completion of DNA replication when forks initiated at a conventional replication origin fail before completing replication of the genome. In addition, the repair of double-strand breaks or gaps by homologous recombination requires at least limited DNA replication to replace the missing information. An intricate interplay between replication and recombination is also evident during the termination of bacterial DNA replication and during the induction of the bacterial SOS response to DNA damage.

Bacteriophage T4↗
PubMed1990

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures.

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.

Animals↗
PubMed1987

RNA polymerase pauses in vitro within the Escherichia coli origin of replication at the same sites where termination occurs in vivo.

An in vitro transcription system able to distinguish initiation at the 16-kDa promoter from elongation events was used to identify factors that might participate in transcription termination within oriC. Pausing in the oriC region occurs at the same sites where termination occurs in vivo. Ten of these sites overlap RNA:DNA junctions in oriC. The pausing that occurs in vitro was not converted to efficient termination by guanosine 5'-diphosphate 3'-diphosphate, NusA, and Rho alone or in combination, or by DnaA suggesting that in vivo other or additional factors contribute to termination at oriC. Transcription from the 16-kDa promoter was 90% inhibited by the nucleotides guanosine 5'-diphosphate 3'-diphosphate and guanosine 5'-triphosphate 3'-diphosphate in agreement with previous observations that this promoter is stringently regulated.

Bacterial Proteins↗
PubMed1995

E. coli SeqA protein binds oriC in two different methyl-modulated reactions appropriate to its roles in DNA replication initiation and origin sequestration.

The seqA gene negatively modulates replication initiation at the E. coli origin, oriC. seqA is also essential for sequestration, which acts at oriC and the dnaA promoter to ensure that replication initiation occurs exactly once per chromosome per cell cycle. Initiation is promoted by full methylation of GATC sites clustered in oriC; sequestration is specific to the hemimethylated forms generated by replication. SeqA protein purification and DNA binding are described. SeqA interacts with fully methylated oriC strongly and specifically. This reaction requires multiple molecules of SeqA and determinants throughout oriC, including segments involved in open complex formation. SeqA interacts more strongly with hemimethylated DNA; in this case, oriC and non-oriC sequences are bound similarly. Also, binding of hemimethylated oriC by membrane fractions is due to SeqA. Direct interaction of SeqA protein with the replication origin is likely to be involved in both replication initiation and sequestration.

Bacterial Outer Membrane Proteins↗
PubMed1993

How transcription factors regulate origins of DNA replication in eukaryotic cells.

Eukaryotic chromosomes contain a few thousand origins of DNA replication, which are activated in a temporal and spatial order during S phase. One parameter that is strongly implicated in determining the order of replication is transcription. This review focuses on the role of transcription factors in activating origins of replication in eukaryotic cells. Studies of viral and mitochondrial replication origins have revealed several mechanisms by which transcription factors activate origins, but it remains to be seen whether any of these are used to regulate cellular chromosome replication.

Journal Article↗
PubMed1979

Effect of novobiocin on initiation of DNA replication in Bacillus subtilis.

The initiation of DNA replication of small replicons in vitro involves conformational changes in the whole DNA molecule or in the region near to the replication origin. One striking finding has been the role of DNA gyrase (that is, the necessity for supercoiled structure) in the initial stage of ColE1 replication in vitro. However, little is known about the effect of gyrase on the initiation of replication of bacterial chromosomes in vivo. We have constructed a map of cleavage sites of restriction enzymes at the region of the origin of replication of the Bacillus subtilis chromosome (accompanying paper). This has now enabled us to examine the effect of novobiocin, a selective inhibitor of DNA gyrase, on the replication of the specific chromosomal segments near the origin and to seek a possible role for the gyrase in the initiation of chromosomal replication. We have found that only a limited segment of the chromosome at the origin region was replicated in the presence of novobiocin. This effect allowed us to locate the site of the origin of replication to within a DNA fragment of molecular weight 3.4 x 10(6).

Bacillus subtilis↗
PubMed1998

[The mechanisms of human cytomegalovirus DNA replication].

Human cytomegalovirus (HCMV) is a human herpesvirus with a linear double stranded DNA which have the largest genomes, about 230 kbp in length, of any of the herpesviruses. The replication of HCMV DNA initiated from HCMV DNA replication origin (oriLyt) and formed concatemers by rolling circule-type replication. The genome inversions of the L and S components occur within concatemeric DNA and formed four isomeres. Then, the concatemeric DNA is cleaved to a unit length at the termini with the "a" sequence as a cis-acting signal and packaged into preformed capsids in the nucleus. Six HCMV genes common to herpesvirus group encode essential proteins that constitute the replication fork complex. In addition, five viral genes are required for efficient DNA replication as trans-acting factors. Several HCMV genes are HSV homologs involved in nucleotide metabolism and DNA repair.

Capsid↗
PubMed2002

Replicational organization of three weakly expressed loci in Physarum polycephalum.

We previously mapped early-activated replication origins in the promoter regions of five abundantly transcribed genes in the slime mold Physarum polycephalum. This physical linkage between origins and genes is congruent with the preferential early replication of the active genes in mammalian cells. To determine how general this replicational organization is in the synchronous plasmodium of Physarum, we analyzed the replication of three weakly expressed genes. Bromodeoxyuridine (BrdUrd) density-shift and gene dosage experiments indicated that the redB (regulated in development) and redE genes replicate early, whereas redA replicates in mid-S phase. Bi-dimensional gel electrophoresis revealed that redA coincides with an origin that appears to be activated within a large temporal window in S phase so that the replication of the gene is not well defined temporally. The early replication of the redB and redE genes is due to the simultaneous activation of flanking origins at the onset of S phase. As a result, these two genes correspond to termination sites of DNA replication. Our data demonstrate that not all the Physarum promoters are preferred sites of initiation but, so far, all the expressed genes analyzed in detail either coincide with a replication origin or are embedded into a cluster of early firing replicons.

Animals↗
PubMed1994

A mammalian origin of bidirectional DNA replication within the Chinese hamster RPS14 locus.

Two complementary experimental approaches have been used to identify a chromosomal origin of bidirectional DNA replication within or immediately downstream of the Chinese hamster ribosomal protein S14 gene (RPS14). The replication origin, designated oriS14, maps within a 1.6- to 2.0-kbp region of RPS14 that includes the gene's third and fourth introns, exons IV plus V, and approximately 500 bp of proximal downstream flanking DNA. The nucleic acid sequence encoding oriS14 closely resembles the other mammalian chromosomal replication origins whose primary structures are known. It contains DNA binding sites for a large number of transcription factors, replication proteins, and mammalian oncogenes as well as several dinucleotide repeat motifs, an AT-rich region, and a sequence that is likely to bend the DNA. In contrast to the other well-characterized mammalian replication origins, which are autosomal and therefore carried as two copies per somatic cell, oriS14 is encoded by single-copy DNA within a hemizygous segment of chromosome 2q in CHO-K1 cells. Also, other known mammalian replication origins are situated in nontranscribed, intergenic DNA, whereas the DNA sequence encoding oriS14 substantially overlaps the transcribed portion of a constitutively expressed housekeeping gene.

Animals↗
PubMed2006

Minireplicon from pBtoxis of Bacillus thuringiensis subsp. israelensis.

A 2.2-kb fragment containing a replicon from pBtoxis, the large plasmid that encodes the insecticidal endotoxins of Bacillus thuringiensis subsp. israelensis, was identified, cloned, and sequenced. This fragment contains cis elements, including iterons, found in replication origins of other large plasmids and suggests that pBtoxis replicates by a type A theta mechanism. Two genes, pBt156 and pBt157, encoding proteins of 54.4 kDa and 11.8 kDa, respectively, were present in an operon within this minireplicon, and each was shown by deletion analysis to be essential for replication. The deduced amino acid sequences of the 54.4-kDa and 11.8-kDa proteins showed no substantial homology with known replication (Rep) proteins. However, the 54.4-kDa protein contained a conserved FtsZ domain, and the 11.8 kDa protein contained a helix-turn-helix motif. As FtsZ proteins have known functions in bacterial cell division and the helix-turn-helix motif is present in Rep proteins, it is likely that these proteins function in plasmid replication and partitioning. The minireplicon had a copy number of two or three per chromosome equivalent in B. thuringiensis subsp. israelensis but did not replicate in B. cereus, B. megaterium, or B. subtilis. A plasmid constructed to synthesize large quantities of the Cry11A and Cyt1A endotoxins demonstrated that this minireplicon can be used to engineer vectors for cry and cyt gene expression.

Amino Acid Sequence↗
PubMed2005

Regeneration of the replication-associated proteins tandem direct repeat recognition nucleotide sequence at the origin of DNA replication of porcine circovirus type 1.

Four copies of a hexanucleotide (H) sequence are located to the right of the palindrome at the origin of DNA replication of the porcine circovirus type 1 (PCV1) genome. These sequences are organized in two direct tandems, the proximal H1/H2 and the distal H3/H4 repeats, and they have been shown to be binding sites for the essential Rep and Rep' proteins. Previous work demonstrated that infectious PCV1 virion can accommodate a variable number of H sequences at the origin of DNA replication. In this work, mutational analysis was conducted to elucidate the critical core element within the hexanucleotide with respect to self-DNA replication and progeny virus synthesis. It was found that while a single H sequence abutting the palindrome is sufficient for PCV1 viability, a tandem repeat arrangement is the more stable and thus preferred configuration. Within the H sequence, selected nucleotides at specific positions are critical for Rep-associated protein recognition and for viral DNA replication.

Animals↗
PubMed1994

Chromosomal DNA replication initiates at the same origins in meiosis and mitosis.

Autonomously replicating sequence (ARS) elements are identified by their ability to promote high-frequency transformation and extrachromosomal replication of plasmids in the yeast Saccharomyces cerevisiae. Six of the 14 ARS elements present in a 200-kb region of Saccharomyces cerevisiae chromosome III are mitotic chromosomal replication origins. The unexpected observation that eight ARS elements do not function at detectable levels as chromosomal replication origins during mitotic growth suggested that these ARS elements may function as chromosomal origins during premeiotic S phase. Two-dimensional agarose gel electrophoresis was used to map premeiotic replication origins in a 100-kb segment of chromosome III between HML and CEN3. The pattern of origin usage in premeiotic S phase was identical to that in mitotic S phase, with the possible exception of ARS308, which is an inefficient mitotic origin associated with CEN3. CEN3 was found to replicate during premeiotic S phase, demonstrating that the failure of sister chromatids to disjoin during the meiosis I division is not due to unreplicated centromeres. No origins were found in the DNA fragments without ARS function. Thus, in both mitosis and meiosis, chromosomal replication origins are coincident with ARS elements but not all ARS elements have chromosomal origin function. The efficiency of origin use and the patterns of replication termination are similar in meiosis and in mitosis. DNA replication termination occurs over a broad distance between active origins.

Chromosomes, Fungal↗
PubMed2001

Identification of the rhesus macaque rhadinovirus lytic origin of DNA replication.

We have identified a lytic origin of DNA replication (oriLyt) for rhesus macaque rhadinovirus (RRV), the rhesus macaque homolog of human herpesvirus 8 (HHV-8), also known as Kaposi's sarcoma-associated herpesvirus. RRV oriLyt maps to the region of the genome between open reading frame 69 (ORF69) and ORF71 (vFLIP) and is composed of an upstream A+T-rich region followed by a short (300-bp) downstream G+C-rich DNA sequence. A set of overlapping cosmids corresponding to the entire genome of RRV was capable of complementing oriLyt-dependent DNA replication only when additional ORF50 was supplied as an expression plasmid in the transfection mixture, suggesting that the level of ORF50 protein originating from input cosmid DNA was insufficient. The requirement of RRV ORF50 in the cotransfection replication assay may also suggest a direct role for this protein in DNA replication. RRV oriLyt shares a high degree of nucleotide sequence and G+C base distribution with the corresponding loci in HHV-8.

Animals↗
PubMed1998

In vitro chromatin remodelling by chromatin accessibility complex (CHRAC) at the SV40 origin of DNA replication.

DNA replication is initiated by binding of initiation factors to the origin of replication. Nucleosomes are known to inhibit the access of the replication machinery to origin sequences. Recently, nucleosome remodelling factors have been identified that increase the accessibility of nucleosomal DNA to transcription regulators. To test whether the initiation of DNA replication from an origin covered by nucleosomes would also benefit from the action of nucleosome remodelling factors, we reconstituted SV40 DNA into chromatin in Drosophila embryo extracts. In the presence of T-antigen and ATP, a chromatin-associated cofactor allowed efficient replication from a nucleosomal origin in vitro. In search of the energy-dependent cofactor responsible we found that purified 'chromatin accessibility complex' (CHRAC) was able to alter the nucleosomal structure at the origin allowing the binding of T-antigen and efficient initiation of replication. These experiments provide evidence for the involvement of a nucleosome remodelling machine in structural changes at the SV40 origin of DNA replication in vitro.

Animals↗
PubMed1983

Nucleotide sequence of the region encompassing the JC virus origin of DNA replication.

The region of the JC virus (JCV) genome from 0.58 to 0.73 map units was sequenced by the Maxam-Gilbert technique. This segment of DNA specifies several regulatory elements and the amino-terminal portion of the early viral proteins. Comparisons with the analogous regions in the polyomaviruses simian virus 40 (SV40) and BK virus (BKV) confirm the close evolutionary relationship of these three viruses. Similarities include palindromic and symmetrical sequences near their origins of DNA replication, binding sites for their large T proteins, an AT-rich region (the Goldberg-Hogness, or TATA, box), and a large tandem duplication or triplication to the late side of their replication origins (however, these sequences differ). Homology between the sequences coding for the early proteins is also evident (79 and 93 of the first 110 amino acids are shared with SV40 and BKV, respectively). Of greater interest are features of the JCV genome which differ from those of other polyomaviruses. Absent in JCV and BKV are sequences which resemble the third T-antigen binding site of SV40. In addition, a set of sequences present in JCV and BKV DNAs (33 nucleotides in JCV and 22 nucleotides in BKV) and located near a 17-base-pair palindrome shared by all three viruses is missing in SV40 DNA. Another sequence, GGGXGGAG, which is repeated several times in many polyomaviruses and adenoviruses and which is thought to play a role in DNA replication or transcription or both, is not found near the JCV origin of replication. Finally, the tandem repeat of JCV, unlike those of BKV and SV40, includes the Goldberg-Hogness sequence.

Amino Acid Sequence↗
PubMed1999

Two regions of simian virus 40 T antigen determine cooperativity of double-hexamer assembly on the viral origin of DNA replication and promote hexamer interactions during bidirectional origin DNA unwinding.

Phosphorylation of simian virus 40 large tumor (T) antigen on threonine 124 is essential for viral DNA replication. A mutant T antigen (T124A), in which this threonine was replaced by alanine, has helicase activity, assembles double hexamers on viral-origin DNA, and locally distorts the origin DNA structure, but it cannot catalyze origin DNA unwinding. A class of T-antigen mutants with single-amino-acid substitutions in the DNA binding domain (class 4) has remarkably similar properties, although these proteins are phosphorylated on threonine 124, as we show here. By comparing the DNA binding properties of the T124A and class 4 mutant proteins with those of the wild type, we demonstrate that mutant double hexamers bind to viral origin DNA with reduced cooperativity. We report that T124A T-antigen subunits impair the ability of double hexamers containing the wild-type protein to unwind viral origin DNA, suggesting that interactions between hexamers are also required for unwinding. Moreover, the T124A and class 4 mutant T antigens display dominant-negative inhibition of the viral DNA replication activity of the wild-type protein. We propose that interactions between hexamers, mediated through the DNA binding domain and the N-terminal phosphorylated region of T antigen, play a role in double-hexamer assembly and origin DNA unwinding. We speculate that one surface of the DNA binding domain in each subunit of one hexamer may form a docking site that can interact with each subunit in the other hexamer, either directly with the N-terminal phosphorylated region or with another region that is regulated by phosphorylation.

Antigens, Polyomavirus Transforming↗