Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Boxing”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,495 records · Page 83Linked to original sources
PubMed1991

The RNA polymerase I transcription factor xUBF contains 5 tandemly repeated HMG homology boxes.

The RNA polymerase I transcription factor UBF has been identified in human, mouse, rat and Xenopus and the primary structure of the human protein has been determined. Human UBF was shown to contain four tandem homologies to the folding domains of the HMG1 and 2 proteins and hence to belong to a previously unrecognised family of 'HMG-box' transcription factors. Here, cDNA clones encoding the Xenopus laevis UBF (xUBF) have been isolated and sequenced. Northern and Southern blots revealed that in tissue culture cells, xUBF is coded on a single major mRNA size species by a small number of genes. The deduced primary structure of xUBF is highly homologous with the human protein except for a central deletion which removes most of one HMG-box. This explains the major size difference between the X. laevis and human proteins and may well explain their different transcriptional specificities. It is shown that xUBF contains 5 tandemly repeated HMG-boxes and that by analogy the human protein contains 6.

Amino Acid Sequence↗
PubMed1995

The Xenopus 9 bp ribosomal terminator (T3 box) is a pause signal for the RNA polymerase I elongation complex.

In Xenopus, termination by RNA polymerase I (pol I) is mediated by the 9 bp sequence GACTTGCNC and RNA 3'-ends are formed -15-20 nt upstream of this terminator element. Here I show that this 9 bp element, also called the 'T3 box', is a pause signal for the elongating transcription complex. The two major transcripts in the paused complex have 3'-ends mapping to 15 and 21 nt upstream of the T3 box, remain bound to the template in 0.25% Sarkosyl, are subject to pyrophosphorolysis and can be chased into longer transcripts. Mutations that reduce overall termination also affect pausing, indicating that pausing is a limiting step in the termination process. Oligonucleotide competition experiments, furthermore, suggest that pausing requires a DNA binding factor. The data support a model in which the first step leading to transcription termination by pol I in Xenopus is pausing of the elongation complex upstream of the T3 box.

Animals↗
PubMed1998

High expression of the HMG box factor sox-13 in arterial walls during embryonic development.

Members of the Sox gene family of transcription factors are defined by the presence of an 80 amino acid homology domain, the High Mobility Group (HMG) box. Here we report the cloning and initial analysis of murine Sox-13 . The 984 amino acids Sox-13 protein contains a single HMG box, a leucine zipper motif and a glutamine-rich stretch. These characteristics are shared with another member of the Sox gene family, Sox-6. High level embryonic expression of Sox-13 occurs uniquely in the arterial walls of 13.5 days post coitum (dpc) mice and later. Low level expression was observed in the inner ear of 13.5 dpc mice and in a limited number of cells in the thymus of 16.5 dpc mice, from which Sox-13 was originally cloned. At 18.5 dpc, Sox-13 is expressed in the tracheal epithelium below the vocal cord and in the hair follicles. The Sox-13 protein binds to the consensus HMG box motif, AACAAAG, but does not transactivate transcription through a concatamer of this motif. Sox-13, like other members of the Sox family likely plays an important role in development.

Amino Acid Sequence↗
PubMed1999

Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter.

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

5' Untranslated Regions↗
PubMed2000

Evolutionary appearance of genes encoding proteins associated with box H/ACA snoRNAs: cbf5p in Euglena gracilis, an early diverging eukaryote, and candidate Gar1p and Nop10p homologs in archaebacteria.

A reverse transcription-polymerase chain reaction (RT-PCR) approach was used to clone a cDNA encoding the Euglena gracilis homolog of yeast Cbf5p, a protein component of the box H/ACA class of snoRNPs that mediate pseudouridine formation in eukaryotic rRNA. Cbf5p is a putative pseudouridine synthase, and the Euglena homolog is the first full-length Cbf5p sequence to be reported for an early diverging unicellular eukaryote (protist). Phylogenetic analysis of putative pseudouridine synthase sequences confirms that archaebacterial and eukaryotic (including Euglena) Cbf5p proteins are specifically related and are distinct from the TruB/Pus4p clade that is responsible for formation of pseudouridine at position 55 in eubacterial (TruB) and eukaryotic (Pus4p) tRNAs. Using a bioinformatics approach, we also identified archaebacterial genes encoding candidate homologs of yeast Gar1p and Nop10p, two additional proteins known to be associated with eukaryotic box H/ACA snoRNPs. These observations raise the possibility that pseudouridine formation in archaebacterial rRNA may be dependent on analogs of the eukaryotic box H/ACA snoRNPs, whose evolutionary origin may therefore predate the split between Archaea (archaebacteria) and Eucarya (eukaryotes). Database searches further revealed, in archaebacterial and some eukaryotic genomes, two previously unrecognized groups of genes (here designated 'PsuX' and 'PsuY') distantly related to the Cbf5p/TruB gene family.

Amino Acid Sequence↗
PubMed2001

CREB-H: a novel mammalian transcription factor belonging to the CREB/ATF family and functioning via the box-B element with a liver-specific expression.

The expression of liver-specific genes is regulated by unequivocally allocated transcription factors via proper responsible elements within their promoters. We identified a novel transcription factor, CREB-H, and found that its expression was restricted in the liver among 16 human tissues tested. A region of CREB-H exhibited significant homology to the basic leucine zipper (b-Zip) domain of members of the CREB/ATF family: mammalian LZIP and Drosophila BBF-2 that binds to box-B, a Drosophila enhancer modulating the fat-body-specific gene expression. CREB-H contained a hydrophobic region representing a putative transmembrane domain, like LZIP. Constructing a variety of CREB-H fusion proteins with the GAL4 DNA-binding domain disclosed that CREB-H functioned as a transcriptional activator and its N-terminal 149 amino acids accounted for the activation ability. Gel mobility sift assays revealed that CREB-H did not bind to the C/EBP, AP-1 and NF-kappaB elements but specifically bound to CRE and the box-B element. Luciferase reporter assays demonstrated that like BBF-2, CREB-H activated transcription via the box-B element and that a deletion of the putative transmembrane domain increased the activation of reporter expression significantly. Furthermore, a fusion protein of GFP and full-length CREB-H was localized in reticular structures surrounding the nucleus, whereas a fusion protein of GFP and a deletion mutant lacking the putative transmembrane domain was mainly in the nucleus. These findings suggest that CREB-H plays an important role in transcriptional regulation of genes specifically expressed in the liver, and that the putative transmembrane domain may be associated with modulation of its function as the transcriptional activator.

Activating Transcription Factors↗
PubMed2001

Box C/D RNA guides for the ribose methylation of archaeal tRNAs. The tRNATrp intron guides the formation of two ribose-methylated nucleosides in the mature tRNATrp.

Following a search of the Pyrococcus genomes for homologs of eukaryotic methylation guide small nucleolar RNAs, we have experimentally identified in Pyrococcus abyssi four novel box C/D small RNAs predicted to direct 2'-O-ribose methylations onto the first position of the anticodon in tRNALeu(CAA), tRNALeu(UAA), elongator tRNAMet and tRNATrp, respectively. Remarkably, one of them corresponds to the intron of its presumptive target, pre-tRNATrp. This intron is predicted to direct in cis two distinct ribose methylations within the unspliced tRNA precursor, not only onto the first position of the anticodon in the 5' exon but also onto position 39 (universal tRNA numbering) in the 3' exon. The two intramolecular RNA duplexes expected to direct methylation, which both span an exon-intron junction in pre-tRNATrp, are phylogenetically conserved in euryarchaeotes. We have experimentally confirmed the predicted guide function of the box C/D intron in halophile Haloferax volcanii by mutagenesis analysis, using an in vitro splicing/RNA modification assay in which the two cognate ribose methylations of pre-tRNATrp are faithfully reproduced. Euryarchaeal pre-tRNATrp should provide a unique system to further investigate the molecular mechanisms of RNA-guided ribose methylation and gain new insights into the origin and evolution of the complex family of archaeal and eukaryotic box C/D small RNAs.

Base Sequence↗
PubMed2002

A Cajal body-specific pseudouridylation guide RNA is composed of two box H/ACA snoRNA-like domains.

Site-specific post-transcriptional conversion of uridines to pseudouridine in ribosomal RNAs and small nuclear RNAs (snRNAs) is directed by guide RNAs which possess the conserved box H and ACA sequence elements and fold into the consensus 'hairpin-hinge-hairpin-tail' secondary structure. Here, we describe an unusual mammalian pseudouridylation guide RNA, called U93, that is composed of two tandemly arranged box H/ACA RNA domains. The U93 RNA therefore carries two H and two ACA box motifs, all of which are essential for accumulation of the full-length RNA. The human U93 RNA accumulates in Cajal (coiled) bodies and it is predicted to function in pseudouridylation of the U2 spliceosomal snRNA. Our results lend further support to the notion that modification of the RNA polymerase II-transcribed spliceosomal snRNAs takes place in Cajal bodies.

Animals↗
PubMed2003

Inactivation of the nod box distal half-site allows tetrameric NodD to activate nodA transcription in an inducer-independent manner.

In Rhizobium leguminosarum, NodD can activate nodA transcription in response to inducer flavonoids. Here, we show that the inducible nodA promoter contains an intrinsic part through which NodD can activate nodA transcription in an inducer-independent manner. Evidence was provided that NodD binds to target DNA through anchoring the two half-sites of the nod box as a tetramer. An imperfect inverted repeat AT-N10-GAT was found in each half-site and is critical for NodD binding. Mutation of the inverted repeat of the nod box distal half-site allowed NodD to activate nodA transcription in an inducer-independent manner in vivo, and to modulate the DNA bending of the NodD-nod box complex in the absence of inducer in vitro.

Acyltransferases↗
PubMed2004

3'-box-dependent processing of human pre-U1 snRNA requires a combination of RNA and protein co-factors.

Using an in vitro system we have recently shown that the 3' ends of human pre-snRNAs synthesized by RNA polymerase II are produced by RNA processing directed by the snRNA gene-specific 3' box. Towards a complete characterization of this processing reaction we have further investigated the in vitro requirements for proper 3' end formation of pre-U1 snRNA. Here we show that the 5' cap plays a stimulatory role and processing requires creatine phosphate. Our results also indicate that the pre-U1 processing activity is heat sensitive and that an RNA component is required. In addition, the exact sequence adjacent to the 3' box influences the position of the pre-U1 3' end produced in vitro. Interestingly, the processing extract active for 3'-box-dependent processing also contains an activity that converts the 3' end of RNA containing the U1 Sm protein binding site and the 3' terminal stem-loop into the mature form.

Adenosine Triphosphate↗
PubMed2005

Unusual features of fibrillarin cDNA and gene structure in Euglena gracilis: evolutionary conservation of core proteins and structural predictions for methylation-guide box C/D snoRNPs throughout the domain Eucarya.

Box C/D ribonucleoprotein (RNP) particles mediate O2'-methylation of rRNA and other cellular RNA species. In higher eukaryotic taxa, these RNPs are more complex than their archaeal counterparts, containing four core protein components (Snu13p, Nop56p, Nop58p and fibrillarin) compared with three in Archaea. This increase in complexity raises questions about the evolutionary emergence of the eukaryote-specific proteins and structural conservation in these RNPs throughout the eukaryotic domain. In protists, the primarily unicellular organisms comprising the bulk of eukaryotic diversity, the protein composition of box C/D RNPs has not yet been extensively explored. This study describes the complete gene, cDNA and protein sequences of the fibrillarin homolog from the protozoon Euglena gracilis, the first such information to be obtained for a nucleolus-localized protein in this organism. The E.gracilis fibrillarin gene contains a mixture of intron types exhibiting markedly different sizes. In contrast to most other E.gracilis mRNAs characterized to date, the fibrillarin mRNA lacks a spliced leader (SL) sequence. The predicted fibrillarin protein sequence itself is unusual in that it contains a glycine-lysine (GK)-rich domain at its N-terminus rather than the glycine-arginine-rich (GAR) domain found in most other eukaryotic fibrillarins. In an evolutionarily diverse collection of protists that includes E.gracilis, we have also identified putative homologs of the other core protein components of box C/D RNPs, thereby providing evidence that the protein composition seen in the higher eukaryotic complexes was established very early in eukaryotic cell evolution.

Animals↗
PubMed2006

Computer simulation of chaperone effects of Archaeal C/D box sRNA binding on rRNA folding.

Archaeal C/D box small RNAs (sRNAs) are homologues of eukaryotic C/D box small nucleolar RNAs (snoRNAs). Their main function is guiding 2'-O-ribose methylation of nucleotides in rRNAs. The methylation requires the pairing of an sRNA antisense element to an rRNA target site with formation of an RNA-RNA duplex. The temporary formation of such a duplex during rRNA maturation is expected to influence rRNA folding in a chaperone-like way, in particular in thermophilic Archaea, where multiple sRNAs with two binding sites are found. Here we investigate possible mechanisms of chaperone function of Archaeoglobus fulgidus and Pyrococcus abyssi C/D box sRNAs using computer simulations of rRNA secondary structure formation by genetic algorithm. The effects of sRNA binding on rRNA structure are introduced as temporary structural constraints during co-transcriptional folding. Comparisons of the final predictions with simulations without sRNA binding and with phylogenetic structures show that sRNAs with two antisense elements may significantly facilitate the correct formation of long-range interactions in rRNAs, in particular at elevated temperatures. The simulations suggest that the main mechanism of this effect is a transient restriction of folding in rRNA domains where the termini are brought together by binding to double-guide sRNAs.

Archaeoglobus fulgidus↗
PubMed2006

DEAD-box RNA helicases in Escherichia coli.

In spite of their importance in RNA metabolism, the function of DExD/H-box proteins (including DEAD-box proteins) is poorly understood at the molecular level. Here, we present recent progress achieved with the five DEAD-box proteins from Escherichia coli, which have been particularly well studied. These proteins, which have orthologues in many bacteria, participate, in particular, in specific steps of mRNA decay and ribosome assembly. In vitro, they behave as poorly processive RNA helicases, presumably because they only unwind a few base pairs at each cycle so that stable duplexes can reanneal rather than dissociate. Except for one of them (DbpA), these proteins lack RNA specificity in vitro, and specificity in vivo is likely conferred by partners that target them to defined substrates. Interestingly, at least one of them is multifunctional, presumably because it can interact with different partners. Altogether, several aspects of the information gathered with these proteins have become paradigms for our understanding of DEAD-box proteins in general.

Base Sequence↗
PubMed2006

The bipartite architecture of the sRNA in an archaeal box C/D complex is a primary determinant of specificity.

The archaeal box C/D sRNP, the enzyme responsible for 2'-O-methylation of rRNA and tRNA, possesses a nearly perfect axis of symmetry and bipartite structure. This RNP contains two platforms for the assembly of protein factors, the C/D and C'/D' motifs, acting in conjunction with two guide sequences to direct methylation of a specific 2'-hydroxyl group in a target RNA. While this suggests that a functional asymmetric single-site complex complete with guide sequence and a single box C/D motif should be possible, previous work has demonstrated such constructs are not viable. To understand the basis for a bipartite RNP, we have designed and assayed the activity and specificity of a series of synthetic RNPs that represent a systematic reduction of the wild-type RNP to a fully single-site enzyme. This reduced RNP is active and exhibits all of the characteristics of wild-type box C/D RNPs except it is nonspecific with respect to the site of 2'-O-methylation. Our results demonstrate that protein-protein crosstalk through Nop5p dimerization is not required, but that architecture plays a crucial role in directing methylation activity with both C/D and C'/D' motifs being required for specificity.

Archaeal Proteins↗
PubMed2005

A simple method for predicting the functional differentiation of duplicate genes and its application to MIKC-type MADS-box genes.

A simple statistical method for predicting the functional differentiation of duplicate genes was developed. This method is based on the premise that the extent of functional differentiation between duplicate genes is reflected in the difference in evolutionary rate because the functional change of genes is often caused by relaxation or intensification of functional constraints. With this idea in mind, we developed a window analysis of protein sequences to identify the protein regions in which the significant rate difference exists. We applied this method to MIKC-type MADS-box proteins that control flower development in plants. We examined 23 pairs of sequences of floral MADS-box proteins from petunia and found that the rate differences for 14 pairs are significant. The significant rate differences were observed mostly in the K domain, which is important for dimerization between MADS-box proteins. These results indicate that our statistical method may be useful for predicting protein regions that are likely to be functionally differentiated. These regions may be chosen for further experimental studies.

Data Interpretation, Statistical↗
PubMed1997

Transcriptional activation domain of human BTEB2, a GC box-binding factor.

BTEB2 is a GC box-binding transcription factor containing proline-rich and zinc finger domains as transactivation and DNA binding domains, respectively. We have identified a small region in the proline-rich domain indispensable for its transcription-enhancing activity by transfection experiments using various expression plasmids with point mutations or small deletions in the domain. This region comprising about 10 amino acids was relatively hydrophobic and rich in proline and alanine residues. BTEB2 purified from a baculovirus expression system could enhance transcription, depending on the presence of GC boxes in the promoter region of templates in an in vitro transcription assay. BTEB2 deleted of the hydrophobic region, however, lost the transcription-enhancing activity, in confirmation of the above results. Basic transcription factors which possibly interact with BTEB2 were examined. Initiation factors, TFIIB, TFIIE beta, and TFIIF beta as well as the TATA box-binding protein (TBP) were found to interact with BTEB2 when analyzed by in vitro binding experiments, although these interactions could not be attributed to the proline-rich domain. We discussed factors which interact with and transmit the transcriptional activity of the BTEB2 activation domain to basic transcriptional machinery.

Amino Acid Sequence↗
PubMed1995

Analysis of functional domains of a GC box-binding protein, BTEB.

BTEB is a small GC box-binding protein containing three contiguous zinc finger structures in the C-terminal region of the molecule, and activates or represses the transcription of genes with the GC box sequence in the promoter, depending on the repetitiveness of the GC box sequence [Imataka et al. (1992) EMBO J. 11, 3663-3671]. We have analyzed functional domains of BTEB in a transient expression system using Y-1 cells (a mouse adrenal cortex cell line). BTEB contained two regions responsible for the transcriptional activation. These regions showed a sequence similarity to each other and appeared to enhance the transcription independently. The two sequences were rich in hydrophobic amino acids and showed no similarity to the sequences of transactivation domains so far elucidated. The DNA-binding properties of BTEB were also analyzed by means of the gel mobility shift assay. Three contiguous zinc finger motifs were needed for the binding activity. Furthermore, it was revealed that a short basic region immediately N-terminal to the zinc finger motifs was required for the DNA binding.

Amino Acid Sequence↗
PubMed2002

Characterization of tobacco MADS-box genes involved in floral initiation.

MADS-box genes encode regulatory factors that are involved at various stages in plant development. These genes function not only during early floral meristem identity, but also when the fate of floral organ primordia is determined in a later step. Here, we screened a floral bud cDNA library to isolate a tobacco MADS-box gene, NtMADS4, using the rice MADS-box gene, OsMADS1, as a probe. We previously reported that OsMADS1 plays a critical role in flower development in rice. Ectopic expression of NtMADS4 caused phenotypes of extremely early flowering as well as dwarfism. Plant MADS proteins have a K domain that mediates the formation of dimers. This dimerization appears to be an essential step for a functional protein complex. NtMADS11 was isolated as an interacting partner of NtMADS4 by yeast two-hybrid screening. The latter was included in the AGAMOUS-like 2 (AGL2) family whereas the former was categorized in the SQUAMOSA (SQUA) family. While the transcript of NtMADS4 was detectable only in reproductive organs, that of NtMADS11 was seen in both reproductive and vegetative organs. Expression levels were high for both genes during early developmental stages. Ectopic expression of NtMADS11 and OsMADS14 was able to rescue the floral organ defects seen in the strong ap1-1 mutant. Roles of NtMADS4 and NtMADS11 in the floral initiation are discussed.

Amino Acid Sequence↗