SEARCH · Search PubMed

Results for “Conformational analysis”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,477 records · Page 82Linked to original sources

PubMed1997

Characterisation of CAH alleles with non-radioactive DNA single strand conformation polymorphism analysis of the CYP21 gene.

The major cause of congenital adrenal hyperplasia (CAH), a common recessive genetic disease, is the deficiency of steroid 21-hydroxylase (21OH), a microsomal enzyme encoded by the CYP21 gene. Although several CAH causing mutations have been identified in the CYP21 gene of patients with 21OH deficiency, genotyping of the 21OH locus is quite complex because of the high frequency of gene conversion and the presence of multiple mutations on single CAH alleles. In order to perform the complete characterisation of the CYP21 gene coding region more simply, we developed a highly sensitive, non-radioactive method allowing DNA single strand conformation polymorphism (DNA-SSCP) analysis. This method was applied to the characterisation of all the exons and intron-exon junctions of the CYP21 gene in five patients affected by the simple virilising form and one affected by the salt wasting form. In all samples showing SSCP signals, direct sequence analysis showed the presence of more than one single sequence variant. In particular, four mutations which are already known to cause the disease, 16 polymorphisms, and one newly identified C to T transition at position 849 were detected. A random sequence analysis, performed on 31 out of 81 exons showing a normal SSCP pattern, shows the method to be highly sensitive: no sequence variant was detected, thus confirming the validity of this non-radioactive DNA-SSCP analysis in characterising the CYP21 gene in patients with steroid 21OH deficiency. Notwithstanding the complete characterisation of all exons and exon/intron junctions of the CYP21 gene, no complete genotype/phenotype correlation was found in the panel of patients analysed, thus suggesting that characterisation of CAH alleles must be extended to outside the coding region of the CYP21 gene, most probably into the promoter region.

Adrenal Hyperplasia, Congenital↗

PubMed1999

Pharmacophore models of group I and group II metabotropic glutamate receptor agonists. Analysis of conformational, steric, and topological parameters affecting potency and selectivity.

A wide variety of conformationally constrained glutamate analogues, active as group I or group II metabotropic glutamate receptor agonists, were employed in a molecular modeling study aimed at the definition of group I and group II agonist pharmacophoric models. The results of this study can be summarized as follows: (i) Recognition sites of both group I and group II mGluRs can adequately be described by five-point pharmacophores. (ii) An extended conformation of glutamate is required for interaction with both group I and group II mGluRs. Group I receptors, however, can also be activated by a more folded conformation if only four pharmacophore points are considered. (iii) Conformational preferences are, however, not sufficient to explain the potency and selectivity of the whole set of ligands. Volume comparison analysis allowed us to define steric environments for group I and group II mGluRs. Group I mGluRs are characterized by a region of allowed volume in proximity of the distal acidic function, whereas group II mGluRs are characterized by a small polar pocket whose occupancy confers high potency and selectivity. Finally, our study points out the necessity of a careful analysis of the energetic requirements needed to attain the putative bioactive conformations and of explicitly considering the conformational mobility of carboxylate groups.

Excitatory Amino Acid Agonists↗

PubMed2000

Single-strand conformation polymorphism analysis to detect the p53 mutation in colon tumor samples by capillary electrophoresis.

The polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) technique is developed for the detection of point mutations in DNA samples, and is very useful in the research of tumors. The traditional SSCP was carried out with slab gel electrophoresis (SGE), but this is time-consuming and labor-intensive, particularly for clinical diagnoses. We have developed a capillary electrophoresis (CE) method for SSCP detection with a linear polyacrylamide gel solution as the sieving matrix. Twenty colon tumor samples were detected with SSCP-CE and the point mutation in exon 7 of the p53 gene was found in six of the samples. Based on the sequencing results, the accuracy of SSCP-CE was better than that of SSCP-SGE. We hope this rapid and convenient method could be applied in the clinical diagnosis of tumors soon.

Base Sequence↗

PubMed1993

Practical application of fluorescence-based image analyzer for PCR single-stranded conformation polymorphism analysis used in detection of multiple point mutations.

We present a practical application of polymerase chain reaction single-strand conformational polymorphism (PCR-SSCP) using a fluorescence-based image analyzer. Fluorescence-labeled primers were used to amplify target sequences. After nondenaturing polyacrylamide gel electrophoresis using a conventional sequencing gel apparatus, the glass plate was directly transferred from the gel box to the image analyzer. High-quality computer storage of the imaging data allowed the image intensity to be quantified over a wide range. Various data bases can be constructed on the basis of this imaging data. This system is suitable for use in clinical examination settings, and its application, to detect ras gene mutations in human pancreatic cancer specimens, is presented.

Base Sequence↗

PubMed1996

Identification and differentiation of the entomopathogenic fungus Beauveria bassiana using polymerase chain reaction and single-strand conformation polymorphism analysis.

A series of genomic DNA probes which exhibit specificity for Beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal DNA (Hegedus and Khachatourians, 1993a). To improve the sensitivity of a DNA-based monitoring system for detection of this entomopathogenic fungus we have developed a PCR-based method. Using sequence information from a region of the B. bassiana-specific probe pBb22, primers P1 (5'AAGCTTCGACATGGTCTG) AND P3 (5GGAGGTGGTGAGGTTCTGTT) were generated. This primer set amplified similar-sized products from several B. Bassiana isolates, Beauveria brongniartii, Beauveria caledonica, and B. densa, but not Tolypocladium nivea, Tolypocladium cylindrospora, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus or migratory grasshoppers and locusts. Hybridization with the probe indicated the presence of DNA homology between the products. Restriction enzyme analysis of the PCR products, however, showed that sequence heterogeneity existed which was confirmed by partial sequencing of the products. Another primer, P5 (5AGGAGAGAGCTCGACGGTCA), was developed to exploit the sequence variations. When the P1-P5 primer set was used, a product was amplified from most B. bassiana isolates, including two which failed to amplify with the P1-P3 set. This amplification was not observed with the other Beauveria species tested. The nature of the sequence variations within the P1-P3 PCR-amplified region suggests the placement of B. densa and B. caledonica outside the species B. bassiana, confirming previous evidence with mitochondrial DNA and DNA probes. PCR with the P1-P3 and P1-P5 primer sets was used to discriminate isolates of B. bassiana found to be infecting a population of the migratory grasshopper, Melanoplus sanguinipes, collected in Saskatchewan. The PCR products derived from the P1-P3 primer set with the various Beauveria spp. could be differentiated by single-strand conformation polymorphisms (SSCP). Thus, analysis of PCR products using restriction enzymes, sequencing, or SSCPs allows positive differentiation of a particular B. bassiana isolate from others. The great sensitivity of these techniques should help the release and monitoring of entomopathogenic fungi in the environment.

Base Sequence↗

PubMed1997

p53 abnormalities in primary prostate cancer: single-strand conformation polymorphism analysis of complementary DNA in comparison with genomic DNA. The Cooperative Prostate Network.

BACKGROUND: The reported frequency of mutation of the p53 tumor suppressor gene (also known as TP53) in human carcinomas of the prostate has varied widely, ranging from 3% to 42%. This variability may be a consequence of tumor heterogeneity and/or the use of different methods of analysis. Since p53 mutation has been associated with clinical outcome for a number of cancer types, determination of its true frequency in primary carcinomas of the prostate is important. PURPOSE: The principal aims of this study were as follows: 1) to validate the utility of detecting p53 gene mutations by means of polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) analysis of complementary DNA (cDNA) (synthesized from prostate tissue RNA and 2) to study the concordance of RNA- and DNA-based PCR-SSCP assays in detecting p53 mutations in individual tumor fragments. METHODS: RNA and genomic DNA were isolated by means of standard techniques from specimens of 19 carcinomas of the prostate, selected on the basis of p53 data obtained in a previous analysis of cDNA (indicating that 14 were mutant and five were wild-type). RNA was converted into cDNA by means of reverse transcription (RT); the cDNA was then amplified by means of nonisotopic (i.e., nonradioactive) PCR, and the PCR products were subjected to SSCP analysis in polyacrylamide gels (RT-PCR-SSCP analysis). Genomic DNA was examined by means of SSCP analysis of isotopically labeled (32PO4) PCR products (DNA-PCR-SSCP analysis). In both approaches, the protein coding region of the p53 gene was divided into multiple, smaller fragments for study. PCR products exhibiting abnormal migration in SSCP gels were subjected to direct nucleotide sequencing or to cloning and sequencing of multiple clones. RESULTS: RT-PCR-SSCP and DNA-PCR-SSCP identified p53 gene abnormalities in 15 of the 19 selected carcinomas, including one previously reported to be wild-type for p53. Overall, PCR-SSCP analysis identified 18 p53 fragments with abnormalities; three carcinomas showed two abnormalities each. Six (33%) of the 18 abnormalities were detected by both RT-PCR-SSCP and DNA-PCR-SSCP, 10 (56%) were detected by RT-PCR-SSCP alone, and two (11%) were detected by DNA-PCR-SSCP alone. The 18 abnormalities were caused by 20 changes in the sequence of the p53 gene; in one carcinoma, double mutations in two individual p53 exons were identified. CONCLUSIONS AND IMPLICATIONS: PCR-SSCP analysis of both RNA and DNA allows the detection of more mutations than the analysis of either alone. Some primary carcinomas of the prostate contain more than one altered p53 gene, consistent with the possibility of intratumoral heterogeneity of mutation of this gene. For comprehensive analysis of p53 mutations in carcinomas of the prostate, and perhaps in other tumor tissues, SSCP analysis of cDNA should be used in combination with SSCP analysis of genomic DNA.

DNA, Complementary↗

PubMed2000

Structure-function analysis of vitamin D and VDR model.

In the first section, the general three-dimensional structure of the ligand-binding domain (LBD) of nuclear receptors (NR) was briefly described on the basis of their x-ray crystal structures. Emphasis was placed on the three major conformations of NR-LBD and their role in the transactivation function. In the second part, the structure-function relationship of vitamin D was analyzed based on the ligand structure, in particular by using systematic conformational analysis as a tool. On the basis of the conformational analysis of the vitamin D side chain and studies using conformationally restricted synthetic vitamin D analogs, we suggested the active space region concept of vitamin D: The vitamin D side-chain region was grouped into five regions (A, G, EA, EG and F). Activity orders, in terms of the spatial region, found by these studies are as follows: Affinity for vitamin D receptor (VDR), EA>A>F>G>EG; Affinity for vitamin D binding protein (DBP), A>>G,EA, EG; Target gene transactivation, EA>F>A>EG G; Cell differentiation, EA>F>A>EG G; Bone calcium mobilization, EA>G A>F EG; Intestinal calcium absorption, EA=A G>>EG. In the third section, homology modeling of VDR-LBD and docking of the natural ligand, 1,25-(OH)2D3, into the ligand binding cavity of the model are described. Amino acid residues forming hydrogen bonds with the biologically important 1alpha- and 25-OH groups were identified: 1alpha-OH forms a pincer-type hydrogen bond with R274 and S237 and 25-OH with H397. This VDR-LBD/1,25-(OH)2D3 docking model was firmly substantiated by mutation analysis. Using this VDR model, the structure-function relationship of highly potent vitamin D analogs was discussed.

Amino Acid Sequence↗

PubMed2003

Optimized polymerase chain reaction-based single-strand conformation polymorphism analysis of p53 gene applied to Bulgarian patients with invasive breast cancer.

During the last few decades a substantial amount of evidence has accumulated proving that the abrogation of the normal p53 pathway is a critical step in the initiation and progression of tumors. Decoding the genetic mechanisms involved in carcinogenesis requires screening for consistent genetic tumor alterations, including those concerning the p53 gene. Thus, practical, efficient, and inexpensive techniques for accurate determination of p53 mutational status are needed. Polymerase chain reaction/single-strand conformation polymorphism (PCR-SSCP) analysis is considered to be a useful tool to investigate the role of the p53 gene in the development and progression of human cancers. The sensitivity of the method can be increased considerably by varying the experimental conditions. Here we demonstrate a scheme of PCR-SSCP optimization for detection of p53 gene mutations of patients with various cancers. Optimal conditions for PCRSSCP of p53 exons 4-9 are reported. Such PCR-SSCP optimization could allow an increase in the sensitivity and reproducibility of the technique and facilitates screening of large series of patients to assess the clinical significance of p53 mutations in human cancers. Using the optimized PCR-SSCP analysis we screened Bulgarian patients with invasive breast cancer for p53 gene mutations and registered a 33.33% frequency of mutations. To date, there are no data concerning the p53 status of Bulgarian breast cancer patients. Screening for p53 gene mutations enables an accurate and routine determination of the p53 status of patients with cancer and may be applied in clinical oncology to cancer diagnosis, prediction of prognosis and response to treatment.

Base Sequence↗

PubMed1993

[New diagnostic aids in automatic perimetry].

The Conformity Analysis is a new procedure for objective recognition of specific defect patterns in automated perimetry. The "Conformity Index," the measure of conformity between the distribution of defect values and several standard defect patterns, is calculated from the ratio of global variance and mean variance in particular regions. Using 68 visual fields from 68 normal persons, we determined normal values and limits of the Conformity Index for seven standard defect patterns: hemifields right-left, hemifields upper-lower, quadrants, sectors, rings with 5 degrees and 10 degrees radius interval and the perimetric nerve fiber bundles of Weber and Ulrich. The evaluation of 148 visual fields (68 normal eyes, 80 eyes with chronic glaucoma and all stages of damage) by both the Conformity Index and two experienced clinicians revealed an identical result in 89%. Using the Conformity Analysis in 37 cases of pituitary adenoma, we could objectively identify quadrants, sectors and hemifields right-left to be the most common defect patterns in this disease. In glaucoma fields with marked damage (n = 46), the most frequent pathological Conformity Index was the index for perimetric nerve fiber bundles.

Adenoma↗

PubMed1995

Point mutation screening for 16 exons of the dystrophin gene by multiplex single-strand conformation polymorphism analysis.

We have developed a rapid and nonradioactive method to screen for point mutations using the Pharmacia PhastSystem. In an SSCP analysis, we applied the two multiplex exon PCR kits, commonly used for the detection of deletions in Duchenne and Becker muscular dystrophy patients. The different exon bands in the multiplex SSCP pattern could be identified by running well-characterised deletion patients in this system. Two common polymorphisms were easily identifiable and are helpful in the haplotype analysis in families. Screening of 70 patients in which no gross rearrangement was detectable with the multiplex PCR and Southern blot, resulted in the identification of 6 patients with a band shift after SSCP analysis. Of these 6 band shifts, 5 were the result of a frame shift or termination mutation. The other band shift was found to be a rare polymorphism unlikely to be the cause of the patient's phenotype. Application of this technique enabled us to improve diagnosis in the families involved and will allow us to extend the search for point mutations in the remaining exons of the dystrophin gene.

Blotting, Southern↗

PubMed1995

A novel HLA-DR13 allele (DRB1*1314) identified by single-strand conformation polymorphism analysis and confirmed by direct sequencing.

A novel variant of the HLA-DR13 group is described. The new allele was found in a DR10, 13 heterozygous patient of Turkish origin, two HLA genotypically identical children of the patient typed as DR11,13, and one child typed as DR13,13. DR13 subtyping of the patient was initially performed by SSCP analysis of PCR-amplified DNA, using the 11th OHWS primers DRBAMP-3 and DRBAMP-B. Due to an unusual SSCP banding pattern, the PCR product was subjected to solid-phase sequencing. The sequence of the new allele, DRB1*1314, is different from that of DRB1*1307 by a single nucleotide substitution in codon 47, with T replacing consensus A. This results in a single amino acid change of tryptophan to phenylalanine in the first domain of the DR beta chain.

Anemia, Sickle Cell↗

PubMed2004

Detection of the major mutation M467T causing cystinuria by single-strand conformation polymorphism analysis using capillary electrophoresis.

We present a fast detection of M467T, the major mutation causing cystinuria, by capillary electrophoresis version of single-strand conformation polymorphism (SSCP). The DNA fragment (317 bp) carrying the point mutation was amplified by polymerase chain reaction (PCR) on the exon 8 of the SLC3A1 gene, which encodes for the transmembrane glycoprotein rBAT, a part of the active cystine and dibasic amino acids transporter. The complementary strands of the fragment were labeled by fluorescein and TAMRA, respectively. Thus, the electromigration of both strands was recorded independently as a laser-induced fluorescence (LIF) signal, what enabled an effective optimization of separation conditions. The injected sample was denatured by immersing the inlet of the separation capillary into a vial with 0.1 M solution of NaOH prior to analysis. Under optimum conditions, the SSCP analysis in poly(vinyl alcohol) (PVA)-coated silica-fused capillary of an effective length of 15 cm, filled with 4% linear polyacrylamide (LPA) solution, was accomplished in approximately 6 min. The experimentally observed mobility shifts of single-stranded DNA (ssDNA) fragments were compared to the appearance of their calculated two-dimensional conformations using Version 3.0 of MFOLD software. The number of nucleotides involved in the duplex regions of theoretical structures correlates well with their real migration order in the sieving medium.

Amino Acid Transport Systems, Basic↗

PubMed1992

A single base pair polymorphism in the WT1 gene detected by single-strand conformation polymorphism analysis.

The Wilms' tumor predisposition gene, WT1, was analysed exon-by-exon in a variety of tumours using the single-strand conformation polymorphism (SSCP) technique. A consistent variation in the usual band pattern for exon 7 was detected in this survey. On sequencing, a silent mutation was noted in codon 313 resulting in an A-->G transition in an arginine codon. The A-->G transition destroys an AflIII restriction enzyme recognition site, which provides a rapid means of identifying heterozygotes at this locus. Analysis of the segregation of this polymorphism in families demonstrated a co-dominant inheritance pattern. In an analysis of 21 randomly selected individuals 25% were heterozygous at this locus, which makes this polymorphism useful in a variety of genetic analyses.

Base Sequence↗

PubMed1996

Fluorescence-based mutation detection. Single-strand conformation polymorphism analysis (F-SSCP).

Conventional SSCP analysis of DNA amplified by polymerase chain reaction (PCR-SSCP) is one of the simplest and most reliable tools for identifying point mutations, and small insertions or deletions. The sensitivity of the technique is increased by using the Applied Biosystems (ABI) semiautomated DNA sequencer equipped with GENESCAN 672 software for F-SSCP. The four-dye ABI system permits a red dye-labeled internal lane standard to be run in the same lanes as the DNA being examined, leaving three dye colors for labeling DNA of interest. The internal lane standard is used to normalize gels or correct for minor differences in apparent electrophoretic mobility between lanes. Correction for these lane-dependent differences in migration and the capability to stack data from two different lanes on the computer screen makes it possible to detect sequence variants that produce very small mobility shifts. Coelectrophoresis of control and unknown DNA in the same lane, using different dye labels for each, is also helpful for detecting sequence variants that produce small mobility changes. Multiplexing multiple F-SSCP targets in the same lane increases sample throughput.

DNA Primers↗

PubMed2000

Matched-pair analysis of conformal high-dose-rate brachytherapy boost versus external-beam radiation therapy alone for locally advanced prostate cancer.

PURPOSE: We performed a matched-pair analysis to compare our institution's experience in treating locally advanced prostate cancer with external-beam radiation therapy (EBRT) alone to EBRT in combination with conformal interstitial high-dose-rate (HDR) brachytherapy boosts (EBRT + HDR). MATERIALS AND METHODS: From 1991 to 1998, 161 patients with locally advanced prostate cancer were prospectively treated with EBRT + HDR at William Beaumont Hospital, Royal Oak, Michigan. Patients with any of the following characteristics were eligible for study entry: pretreatment prostate-specific antigen (PSA) level of >/= 10.0 ng/mL, Gleason score >/= 7, or clinical stage T2b to T3c. Pelvic EBRT (46.0 Gy) was supplemented with three (1991 through 1995) or two (1995 through 1998) ultrasound-guided transperineal interstitial iridium-192 HDR implants. The brachytherapy dose was escalated from 5.50 to 10.50 Gy per implant. Each of the 161 EBRT + HDR patients was randomly matched with a unique EBRT-alone patient. Patients were matched according to PSA level, Gleason score, T stage, and follow-up duration. The median PSA follow-up was 2.5 years for both EBRT + HDR and EBRT alone. RESULTS: EBRT + HDR patients demonstrated significantly lower PSA nadir levels (median, 0.4 ng/mL) compared with those receiving EBRT alone (median, 1.1 ng/mL). The 5-year biochemical control rates for EBRT + HDR versus EBRT-alone patients were 67% versus 44%, respectively (P <.001). On multivariate analyses, pretreatment PSA, Gleason score, T stage, and the use of EBRT alone were significantly associated with biochemical failure. Those patients in both treatment groups who experienced biochemical failure had a lower 5-year cause-specific survival rate than patients who were biochemically controlled (84% v 100%; P <.001). CONCLUSION: Locally advanced prostate cancer patients treated with EBRT + HDR demonstrate improved biochemical control compared with those who are treated with conventional doses of EBRT alone.

Aged↗

PubMed1998

Interspecific, intraspecific and interoperonic variability in the 16S rRNA gene of methanogens revealed by length and single-strand conformation polymorphism analysis.

Thirty-seven strains of mesophilic and thermophilic methanogenic Archaea, belonging to 30 species, were analyzed by length polymorphism (LP) and single-strand conformation polymorphism (SSCP) of an amplified 300-bp fragment of the 16S rRNA gene (Escherichia coli positions 9-331) including the variable regions V1 and V2, LPs and SSCPs were detected between species and between strains of the same species (Methanobacterium formicicum). LPs were found in Mb. formicicum DSMZ 3637, Mb. ivanovii DSMZ 2611, Mb. wolfei DSMZ 2970, Methanosarcina barkeri DSMZ 800, and Methanosaeta concilii DSMZ 3671, suggesting the presence of polymorphic 16S rRNA genes in the genome. We propose that LP and SSCP analysis of the 16S rRNA gene could be of practical help for strain identification.

DNA, Archaeal↗

PubMed1997

Nonradioactive single-strand conformation polymorphism analysis for detection of fluoroquinolone resistance in mycobacteria.

A simple, rapid, and nonradioactive method for routine detection of fluoroquinolone resistance in mycobacteria is described. A single-strand conformation polymorphism (SSCP) methodology, based on the use of mini-gels and silver staining of DNA, was optimized for the analysis of denatured DNA products obtained by polymerase chain reaction (PCR) from the gyrA gene involved in fluoroquinolone resistance in mycobacteria. The method was successfully applied to fluoroquinolone-susceptible and -resistant laboratory strains of Mycobacterium smegmatis and to clinical strains of Mycobacterium tuberculosis isolated from patients who developed resistance during the course of fluoroquinolone treatment.

Anti-Infective Agents↗

PubMed2005

Capillary electrophoresis single-strand conformation polymorphism analysis for monitoring soil bacteria.

The ability to effectively monitor a microbial community is necessary to design and implement remediation strategies for contaminated soil. Single-strand conformation polymorphism (SSCP), a technique which separates DNA fragments based on their sequence, was used to analyze amplified 16S rRNA gene fragments of 12 common soil bacteria. Separation was performed using capillary electrophoresis (CE), as opposed to other common gel techniques, to eliminate the need for band analysis on gel matrices. Four different universal bacterial primer sets were used for DNA amplification: 341-534, P11-P13, Er10-Er11, and Er14-Er15 corresponding to the V3, V8, V2, and V4 regions, respectively. The forward strand of each primer was labeled with 6-carboxy fluorescein fluorescent dye. Analyses were performed on the Applied Biosystems 310 genetic analyzer using GeneScan Analysis Software version 3.5. The best results were obtained using primer 341-534, in which 6 of the 12 bacteria could be distinguished. By combining primer sets 341-534 and Er10-Er11, all 12 of the bacteria could be separated, indicating various degrees of polymorphism within the selected primer regions. When performing simultaneous amplification and analysis of all 12 species some preferential amplification occurred, as not all peaks could be observed. However, SSCP profiles obtained for pure bacterial cultures show the potential of CE-SSCP for bacterial community analysis.

DNA, Bacterial↗