Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “sequence diversity”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 145 records · Page 8Linked to original sources
PubMed1998

Sequence diversity of the oprI gene, coding for major outer membrane lipoprotein I, among rRNA group I pseudomonads.

The sequence of oprI, the gene coding for the major outer membrane lipoprotein I, was determined by PCR sequencing for representatives of 17 species of rRNA group I pseudomonads, with a special emphasis on Pseudomonas aeruginosa and Pseudomonas fluorescens. Within the P. aeruginosa species, oprI sequences for 25 independent isolates were found to be identical, except for one silent substitution at position 96. The oprI sequences diverged more for the other rRNA group I pseudomonads (85 to 91% similarity with P. aeruginosa oprI). An accumulation of silent and also (but to a much lesser extent) nonsilent substitutions in the different sequences was found. A clustering according to the respective presence and/or positions of the HaeIII, PvuII, and SphI sites could also be obtained. A sequence cluster analysis showed a rather widespread distribution of P. fluorescens isolates. All other rRNA group I pseudomonads clustered in a manner that was in agreement with other studies, showing that the oprI gene can be useful as a complementary phylogenetic marker for classification of rRNA group I pseudomonads.

Bacterial Proteins↗
PubMed1996

High mitochondrial sequence diversity in linguistic isolates of the Alps.

Segment I of the control region of mtDNA (360 bases) was sequenced in seven samples, each of 10 individuals inhabiting villages in the eastern Italian Alps (South Tyrol and Trentino). Three linguistic groups, German, Italian, and Ladin, were represented by two samples each; the seventh sample comes from an isolated group of German origin, the Mocheni, who are linguistically distinct and geographically separated from the bulk of the German speakers. Seventy-four polymorphic sites were identified, defining 63 different haplotypes. Mocheni and Ladin speakers tend to form two clusters in the evolutionary trees inferred from sequences. Analysis of molecular variance shows significant differentiation within samples, among them, and among linguistic groups. Genetic differences between the Ladins and the other groups are not much smaller than between Europeans and some Africans; variation is large within groups, as well, with the exception of only the Mocheni. In the evolutionary trees where the four alpine groups are compared with other European populations, Mocheni and especially Ladins appear as clear outliers. Romansch-speaking Swiss, who are linguistically related to Ladins, are not genetically similar to them, for this segment of DNA. Because the time elapsed since colonization of the Alps (< or = 12,000 years) is short in mutational terms, the only model accounting for the observed relationships between mtDNA variation and linguistic identity seems one in which a population ancestral to Ladin speakers was already differentiated long before the Alps were settled and the current linguistic affiliations were established. For the Mocheni, the results are consistent with a simpler episode of allele loss, from an original genetic pool common to the ancestors of the current German speakers.

DNA, Mitochondrial↗
PubMed2006

Plasmodium falciparum: worldwide sequence diversity and evolution of the malaria vaccine candidate merozoite surface protein-2 (MSP-2).

We examined patterns and putative mechanisms of sequence diversification in the merozoite surface protein-2 (MSP-2) of Plasmodium falciparum, a major dimorphic malaria vaccine candidate antigen, by analyzing 448 msp-2 alleles from all continents. We describe several nucleotide replacements, insertion and deletion events, frameshift mutations, and proliferations of repeat units that generate the extraordinary diversity found in msp-2 alleles. We discuss the role of positive selection exerted by naturally acquired type- and variant-specific immunity in maintaining the observed levels of polymorphism and suggest that this is the most likely explanation for the significant excess of nonsynonymous nucleotide replacements found in dimorphic msp-2 domains. Hybrid sequences created by meiotic recombination between alleles of different dimorphic types were observed in few (3.1%) isolates, mostly from Africa. We found no evidence for an extremely ancient origin of allelic dimorphism at the msp-2 locus, predating P. falciparum speciation, in contrast with recent findings for other surface malarial antigens.

Alleles↗
PubMed2006

Sequence diversity and rates of molecular evolution between sheep and cattle genes.

Experiments that aim to identify genes of importance in sheep are currently inhibited by a paucity of genomic resources. One approach, therefore, is to exploit the wealth of data and associated capabilities becoming available for the bovine genome. Cross-species application of microarrays and comparative sequencing to identify single nucleotide polymorphisms are two possibilities; however, both are dependant on the level of nucleotide sequence similarity between the two species. This study used 120 gene orthologues consisting of over 60 kb of aligned sequence to estimate the gene diversity between cattle and sheep. Less than 3% of protein-coding nucleotide positions were found to be different, indicating that the prospect for successfully using cross-species strategies is high. Substitution at synonymous sites ranged between 6.9 and 7.7% (+/- 0.3%), and was higher than at non-synonymous sites (1.4-1.7 +/- 0.1%). The relative rate test was used to determine whether the observed mutation rates were constant between the two lineages. While the rate at synonymous sites appeared constant, the rate at non-synonymous sites was significantly higher within the caprinae lineage (sheep) when compared with bovinae (cattle; chi2 = 10.03; d.f. = 1, P < 0.01). This is the first demonstration that variable rates of molecular evolution may be present within the family Bovidae.

Animals↗
PubMed1995

Analysis of matrix protein gene nucleotide sequence diversity among Newcastle disease virus isolates demonstrates that recent disease outbreaks are caused by viruses of psittacine origin.

Nucleotide sequence analysis was completed for isolates of Newcastle disease virus (NDV; avian paramyxovirus 1) from 1992 outbreaks in cormorants and turkeys. These isolates were of the neurotropic velogenic type. The cormorant and turkey NDV isolates had the fusion protein cleavage sequence 109SRGRRQKR/FVG119, as opposed to the consensus sequence 109SGGRRQKR/FIG119 of most known velogenic NDV isolates. The R for G substitution at position 110 may be unique for the cormorant and turkey isolates. For comparative purposes, nucleotide sequencing and analysis of the conserved matrix protein gene coding region were completed for isolates representing all pathotypes. Phylogenetic relationships demonstrated that there are two major groups of NDV isolates. One group includes viruses found in North America and worldwide, such as B1, LaSota, Texas/GB, and Beaudette/C. The second group contains isolates, such as ulster/2C, Australia/Victoria, and Herts/33, considered exotic to North America. Within this second group are viruses of psittacine origin. The viruses from 1992 outbreaks of Newcastle disease in North America, and an isolate thought to have caused the major outbreak in southern California during the 1970s, are most closely related to an NDV isolate of psittacine origin.

Amino Acid Sequence↗
PubMed1994

Sequence diversity of the erythrocyte membrane antigen 1 in various strains of Plasmodium chabaudi.

We have determined the complete genomic sequence of the Plasmodium chabaudi erythrocyte membrane antigen (PcEMA1) in 4 different parasite strains. The gene structure consisted of a short region encoding a signal sequence separated from the main coding region by an intervening sequence. The overall identity of the three P. chabaudi adami deduced protein sequences to their consensus was 100%, 99.8% and 88% for 556KA, DK and DS respectively, with a general pattern of increasing divergence from the N- to the C-terminus. The P. chabaudi chabaudi strain CB was 72% homologous to the P. chabaudi adami consensus sequence. A gene related to PcEMA1, designated PcEMA1-R, has been identified in the genome of P. chabaudi adami but not in P. chabaudi chabaudi. The partial sequence for this gene in P. chabaudi adami strain DS predicts that it could encode a truncated form of PcEMA1, but its status as a pseudogene or an independent, expressed gene has not been resolved.

Amino Acid Sequence↗
PubMed2003

[Sequence diversity of the 3' end genome for Zucchini yellow mosaic virus isolates].

The present study analyzed the 3' end sequence of nine mainland isolates of Zucchini yellow mosaic virus (ZYMV) genome including the coat protein (CP) gene and 3' end un-translated region (UTR). Obtained sequence data was compared with previously reported sequences of 16 ZYMV isolates from other regions of the world. In a certain degree, similarity of nucleic acid sequence for CP gene was found being related with the host origin and geological distribution, but not very obvious. Similarity of the CP amino acid sequences deduced from nucleic acid sequences of the 25 ZYMV isolates reached a higher sequence similarity and a clearer relationship to the host origins than to the geological distributions. According to its variation, the amino acid sequence of ZYMV CP was divided into two parts--"the high variable region" contains about 41 amino acids at its N end, while "the conservative region" includes CP core-region and C termini amino acids. Our results showed that the trend of ZYMV variation for its rapid adoption for fitness of the ecological condition, especially to host interaction by mutation of its genomic RNA.

3' Untranslated Regions↗
PubMed2006

Sequence diversity of O-superfamily conopetides from Conus marmoreus native to Hainan.

The full-length cDNAs of six new O-superfamily conotoxins (CTX) were cloned and sequenced from Conus marmoreus native to Hainan in China South Sea using RT-PCR and 3'-RACE. Six novel conotoxin precursors encoded by these cDNAs consist of three typical regions of signal, pro-peptide and mature peptide. All the six toxin regions share a common O-superfamily cysteine pattern (C-C-CC-C-C, with three disulfide bridges). The predicted precursors are composed of 73-88 amino acids, and the predicted mature peptides consist of 26-34 amino acids. Phylogenetic analysis of new conotoxins from C. marmoreus from the present study and published homologue T-superfamily sequences from other Conus species was performed systematically. Patterns of sequence divergence for three regions of signal, pro-region and mature peptides, as well as Cys codon usage define the major O-superfamily branches and suggest how these separate branches arose. Percent identities of the amino acid sequences of the signal region exhibited high conservation, whereas the sequences of the mature peptides ranged from almost identical to highly divergent between inter- and intra-species. Notably, the diversity of the pro-region was also high with intermediate divergence between that observed in signal and toxin regions. Amino acid sequences and their mode of action (target) of previously identified conotoxins from molluscivorous C. marmoreus for the known conotoxins classes are discussed in detail. The data presented are new and should pave the way for chemical synthesis of these unique conotoxins for to allow determination of the molecular targets of these peptides, and also to provide clues for a better understanding of the phylogeny of these peptides.

Amino Acid Sequence↗
PubMed2004

Purifying selection and demographic expansion affect sequence diversity of the ligand-binding domain of a glutamate-gated chloride channel gene of Haemonchus placei.

Ninety-five genomic sequences of the ligand-binding domain of glutamate-gated chloride channel genes of three populations of the parasitic nematode H. placei were evaluated for patterns of diversity, demography, and selection. These genes code for subunits of ion channels, which are involved in the mode of action of the most commonly used antiparasitic drugs, the macrocyclic lactones. An extremely high frequency of unique segregating sites in exons and introns was observed, with significantly negative neutrality tests in each population for noncoding, synonymous, and nonsynonymous sites. Several tests indicated that support for balancing selection, positive selection, and hitchhiking was lacking. McDonald-Kreitman tests using H. contortus or C. elegans as an outgroup revealed an extreme excess of replacement polymorphism, consistent with weak purifying selection. Although these tests agree that negative selection may explain the excess of replacement changes, an alternative interpretation is required for the significantly negative Fu and Li's D statistics based on silent and noncoding sites. These include homogeneous forces such as background selection and demographic expansion. The lack of population subdivision and the negative values of Tajima's D for this outbreeding parasitic nematode render background selection less likely than demographic expansion. Comparison of D statistics based on different site types using neutral coalescent simulations supported this interpretation. Although this statistic was more negative for nonsynonymous sites than for synonymous sites, most comparisons of the D statistic were not significantly different between mutation classes. A few significant site comparisons were also consistent with demographic expansion, because the observed test statistic ( D(neutral) - D(selected)) were low relative to the neutral expectations. Finally, previous mitochondrial studies also identified a demographic expansion of this parasitic nematode species, which lends further support to a scenario involving both demographic and purifying forces in the ligand-binding domain of H. placei.

Amino Acid Sequence↗
PubMed2002

Ancient DNA analyses reveal high mitochondrial DNA sequence diversity and parallel morphological evolution of late pleistocene cave bears.

Cave bears (Ursus spelaeus) existed in Europe and western Asia until the end of the last glaciation some 10,000 years ago. To investigate the genetic diversity, population history, and relationship among different cave bear populations, we have determined mitochondrial DNA sequences from 12 cave bears that range in age from about 26,500 to at least 49,000 years and originate from nine caves. The samples include one individual from the type specimen population, as well as two small-sized high-Alpine bears. The results show that about 49,000 years ago, the mtDNA diversity among cave bears was about 1.8-fold lower than the current species-wide diversity of brown bears (Ursus arctos). However, the current brown bear mtDNA gene pool consists of three clades, and cave bear mtDNA diversity is similar to the diversity observed within each of these clades. The results also show that geographically separated populations of the high-Alpine cave bear form were polyphyletic with respect to their mtDNA. This suggests that small size may have been an ancestral trait in cave bears and that large size evolved at least twice independently.

Animals↗
PubMed1995

Investigation of the pattern of hepatitis C virus sequence diversity in different geographical regions: implications for virus classification. The International HCV Collaborative Study Group.

Genotypes of hepatitis C virus (HCV) present within 104 samples from HCV-infected individuals from Africa, the Middle East, the Indian subcontinent and South-East Asia were identified by sequence comparisons in the core and NS-5 regions. Relatively short sequences (such as the 222 bp fragment of NS-5) provided effective discrimination of types, subtypes and isolates, and produced equivalent relationships between genotypes as were found upon comparison of longer sequences of NS-5, of the core region, and by comparison of the limited number of complete genomic sequences currently available. Measurement of evolutionary distances in the core and NS-5 regions allowed 79 of the 104 samples to be identified as examples of known genotypes, while 17 of the remainder could be provisionally classified as new subtypes of types 1 (Nigeria), 2 (Gambia), 3 (India, Pakistan and Bangladesh) and 4 (Middle East) on the basis of sequence comparison in core and NS-5 (n = 9) or provisionally using core alone (n = 8). The remaining sequences from Thailand made up two groups showing no close similarity to any of the six major genotypes classified to date, although one corresponded to an as yet unclassified variant of HCV also found in Thailand. However, phylogenetic analysis of the core and NS-5 regions indicated a distant relationship between these sequences with variants found in Vietnam and with type 6a, and collectively they formed a diverse single phylogenetic group. The existence of great diversity within a single genotype was also found amongst type 3 sequences in the Indian subcontinent, amongst type 4 variants in Central Africa and the Middle East, and amongst type variants in Nigeria. These findings may provide clues for understanding the origins and mechanisms of transmission of HCV.

Africa↗
PubMed1996

Recognition of diverse sequences by class I zinc fingers: asymmetries and indirect effects on specificity in the interaction between CF2II and A+T-rich elements.

The Drosophila CF2II protein, which contains zinc fingers of the Cys2His2 type and recognizes an A+T-rich sequence, behaves in cell culture as an activator of a reporter chloramphenicol acetyltransferase gene. This activity depends on C-terminal but not N-terminal zinc fingers, as does in vitro DNA binding. By site-specific mutagenesis and binding site selection, we define the critical amino acid-base interactions. Mutations of single amino acid residues at the leading edge of the recognition helix are rarely neutral: many result in a slight change in affinity for the ideal DNA target site; some cause major loss of affinity; and others change specificity for as many as two bases in the target site. Compared to zinc fingers that recognize G+C-rich DNA, CF2II fingers appear to bind to A+T-rich DNA in a generally similar manner, but with additional flexibility and amino acid-base interactions. The results illustrate how zinc fingers may be evolving to recognize an unusually diverse set of DNA sequences.

Amino Acid Sequence↗
PubMed1998

Sequence diversity in the coat protein coding region of twelve sugarcane mosaic potyvirus isolates from Australia, USA and South Africa.

We have sequenced the coat protein (CP) coding region of 11 field isolates of SCMV from Australia, USA and South Africa. The differences between the nucleotide sequences of the isolates was 0.2 to 4.1% and the encoded amino acid sequences differed by 0.0 to 3.5%. Phylogenetic analysis of the CP coding sequences of the SCMV isolates and the related potyviruses SCMV-MDB, JGMV, SrMV, MDMV-A and PVY showed that the SCMV isolates formed a tightly clustered group, with SCMV-MDB forming a separate branch. This indicated that (i) the SCMV isolates are of one strain (SCMV-A) and not geographically distinct species and (ii) SCMV-MDB is clearly distinct, and may represent another potyvirus species.

Amino Acid Sequence↗
PubMed2002

Partial 16S rRNA gene sequence diversity and numerical taxonomy of slow growing pigeonpea (Cajanus cajan L Millsp) nodulating rhizobia.

An investigation was carried out to determine the diversity of 30 isolates of slow growing pigeonpea nodulating rhizobia based on variations in partial sequences of the 16S rRNA gene and numerical analysis of 80 phenotypic traits. Phylogenetic analysis using molecular sequences of 23 isolates showed that ARPE1 separated from the other isolates at an average distance of >14% divergence level. The other isolates were all within 5% divergence from each other but separated into four main groups, with group 1 containing 16 of the 23 isolates. Comparisons to sequences of reference strains revealed that the group 1 isolates were phylogenetically closely related to the slow growing soybean nodulating rhizobia belonging to Bradyrhizobium elkanii, although only three of these isolates were able to nodulate soybean. Numerical analysis of phenotypic data of 19 isolates showed that 14 isolates clustered together in one branch of the phenogram, which included the group 1, group 2 and group 4 isolates from the phylogenetic analysis. The group 3 isolates were highly variable in the phenogram with similarity levels lower than 50% among these isolates.

Bradyrhizobium↗
PubMed2005

NanA, a neuraminidase from Streptococcus pneumoniae, shows high levels of sequence diversity, at least in part through recombination with Streptococcus oralis.

Streptococcus pneumoniae, an important human pathogen, contains at least two genes, nanA and nanB, that express sialidase activity. NanA is a virulence determinant of pneumococci which is important in animal models of colonization and middle ear infections. The gene encoding NanA was detected in all 106 pneumococcal strains screened that represented 59 restriction profiles. Sequencing confirmed a high level of diversity, up to 17.2% at the nucleotide level and 14.8% at the amino acid level. NanA diversity is due to a number of mechanisms including insertions, point mutations, and recombination generating mosaic genes. The level of nucleotide divergence for each recombinant block is greater than 30% and much higher than the 20% identified within mosaic pbp genes, suggesting that a high selective pressure exists for these alterations. These data indicate that at least one of the four recombinant blocks identified originated from a Streptococcus oralis isolate, demonstrating for the first time that protein virulence determinants of pneumococci have, as identified previously for genes encoding penicillin binding proteins, evolved by recombination with oral streptococci. No amino acid alterations were identified within the aspartic boxes or predicted active site, suggesting that sequence variation may be important in evading the adaptive immune response. Furthermore, this suggests that nanA is an important target of the immune system in the interaction between the pneumococcus and host.

Amino Acid Sequence↗
PubMed2002

Genetic relationship of Chinese ethnic populations revealed by mtDNA sequence diversity.

The origin and demographic history of the ethnic populations of China have not been clearly resolved. In this study, we examined the hypervariable segment I sequences (HVSI) of the mitochondrial DNA control region in 372 individuals from nine Chinese populations and one northern Thai population. A relatively high percentage of individuals was found to share sequences with those from other populations of the same ethnogenesis. In general, the populations of southern or Pai-Yuei tribal origin showed high haplotype diversity and nucleotide diversity compared with the populations of northern or Di-Qiang tribal origin. Mismatch distributions from these populations showed concordant features. All except the northern groups Nu, Lisu, Tibetan, and Mongolian showed typical signatures of ancient population expansions in the mismatch distributions and neutrality tests. Episodes of extreme size reduction in the past are one of the likely explanations for the absence of evidence of expansion in northern populations. Small sample sizes as well as samples from isolated subpopulations contributed to the bumpy mismatch distributions observed. Phylogenetic analysis and haplotype sharing among populations suggest that current mtDNA variation in these ethnic populations could reveal their ethnohistory to some extent, but in general, linguistic and geographic classifications of the populations did not agree well with classification by mtDNA variation.

Adult↗
PubMed2005

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

Animals↗
PubMed1994

Analysing the sequence diversity of the 5' NC-region of HCV-isolates found in southern Germany.

In this study we compared the nucleotide sequence of the 5' NC-region of the HCV genome isolated from seven patients and two blood donors from Southern Germany. We could identify two very distinct groups of isolates: the first very similar to the HCV prototype sequence (HCV1) with homology ranging from 99.5% to 98.7%; the second showing 91.7% homology to the HCV1. Group 1 isolates could be found in five patients and the two blood donors. Group 2 isolates could be found in the two other patients. Finally, we could observe neither nucleotide insertion nor deletion in the isolates described here.

Base Sequence↗