Search PubMedSearch

SEARCH · Search PubMed

Results for “reference databases”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 145 records · Page 8Linked to original sources

Three-dimensional lower extremity joint kinetics in normal pediatric gait.

Gait analysis is becoming a more integral part of the decision-making process in treatment of children with neuromuscular problems. A normal reference, however, must be available for comparison when one makes decisions. We wished to develop a normal pediatric database for joint kinematics and kinetics which could then be used as a reference for clinical gait analysis. Thirty-one normal children underwent a complete gait analysis including calculations of three-dimensional joint kinematics and kinetics. The pediatric data were similar to that of normal adults.

Adolescent

Medically significant concentrations of prostate-specific antigen in serum assessed.

We used the method of Rudolph et al. (Clin Chem 1988; 34:2031-8) to find information in the data from correlated determinations of acid phosphatase (PAP, EC 3.1.3.2; DuPont aca) and prostate-specific antigen (PSA, Hybritech). We described there how we assign medical decision limits for two or more correlated variables and convert the database to a binary coded message, allowing separation of a selected disease class with minimum error. The decision point, analogous to a percentile upper limit on the ordered values of each variable in the reference group, satisfies the maximum entropy constraints of reference, producing a minimum entropy for the binary coded patient database. We found maximum entropy decision points at PAP = 0.75 U/L and PSA = 22.8 micrograms/L. Patients with PSA values exceeding 22.8 micrograms/L had no benign prostatic disease except for five patients with benign prostate hyperplasia (BPH) with adjacent colon carcinoma (95.3), BPH with infarction (27.6), BPH (23.4) 28.1), or acute prostatitis (34.6). We consider PSA exceeding 22.8 micrograms/L as indicative of carcinoma of the prostate, stage C or D, in the absence of disconfirming evidence. Another decision value for PSA is 11.3 micrograms/L. This bounds the region between 11.3 and 22.8 micrograms/L, where the frequency of BPH is 1.5 times that for adenocarcinoma. At PSA less than 11.3 micrograms/L there is a high frequency of BPH. PSA concentration is not correlated with prostatic size (mass) or with prostatitis. A metastatic carcinoma is as likely to be nonprostatic as prostatic when the PSA concentration is less than 11.3 micrograms/L.

Acid Phosphatase

Similarity graphing and enzyme-reaction database: methods to detect sequence regions of importance for recognition of chemical structures.

We developed a new method which searches sequence segments responsible for the recognition of a given chemical structure. These segments are detected as those locally conserved among a sequence to be analyzed (target sequence) and a set of sequences (reference sequences). Reference sequences are the sequences of functionally related proteins, ligands of which contain a common chemical substructure in their molecular structures. 'Similarity graphing' cuts target sequences into segments, aligns them with reference sequence pairwise, calculates the degree of similarity for each alignment, and shows graphically cumulative similarity values on target sequence. Any locally conserved regions, short or long in length and weak or strong in similarity, are detected at their optimal conditions by adjusting three parameters. The 'enzyme-reaction database' contains chemical structures and their related enzymes. When a chemical substructure is input into the database, sequences of the enzymes related to the input substructure are systematically searched from the NBRF sequence database and output as reference sequences. Examples of analysis using similarity graphing in combination with the enzyme-reaction database showed a great potentiality in the systematic analysis of the relationships between sequences and molecular recognitions for protein engineering.

Algorithms

BACOMP--database of bioactive compounds for structure-activity relationship.

BACOMP database is presented for structure-activity relationship (SAR) investigations; it was realized on a BK-1300 general purpose microcomputer using the MICRO-SETOR network database management system. Some general considerations of database design are given and the models and facilities for a development of a microcomputer-based SAR oriented database are described. The database contains the following information for the bioactive compounds: chemical structures, biological activities, trade names, reference numbers and information sources. For computer representation of chemical structures SAR oriented language is used. The database software includes: system software, data capture and data editing software, information retrieval and data processing applications. The software development is done in FORTRAN IV and MACRO assembly language. The programs are written in a completely interactive mode. The information retrieval software includes 12 functions giving an information for the database as a whole and for a single compound as well. The data processing software includes 8 functions for finding common structural fragments among compounds with similar biological activity and for estimating a structural similarity between different compounds. The functions are selected from corresponding screen MENUs. The function realization results are framed as appropriate screen formats and the receipt of hardcopies is available. The database can be used to develop predictive methods in respect of the investigated biological activity.

Drug Information Services

Thymosin-ɑ1 for people with chronic hepatitis B.

RATIONALE: Chronic hepatitis B is a global public health concern. It is caused by infection with the hepatitis B virus (HBV). The goal of treating chronic HBV infection is to prevent progression to chronic hepatitis, cirrhosis, hepatic decompensation, liver failure, hepatocellular carcinoma, and death. Individual studies have evaluated various immunomodulatory therapies with inconsistent results. Thymosin-ɑ1 is known to have antiviral effects; however, results of randomised clinical trials on the effects of thymosin-α1 as a potential treatment for people with chronic HBV have been inconsistent. OBJECTIVES: To assess the benefits and harms of thymosin-ɑ1 therapy in people with chronic hepatitis B. SEARCH METHODS: We searched the Cochrane Hepato-Biliary Group Controlled Trials Register, CENTRAL, MEDLINE, four other databases and six trials registers, in addition to reference checking, citation searching, and contacting study authors to identify trials for inclusion. The latest search date was 10 June 2026. ELIGIBILITY CRITERIA: We included randomised controlled trials (RCTs) that evaluated thymosin-α1 at any dose, route of administration, or formulation type, in people with chronic hepatitis B regardless of age, sex, or ethnicity. Thymosin-α1 could have been administered as monotherapy, in combination with an additional drug, or in addition to standard medical treatment and compared with placebo, no intervention, the same additional drug, or the same standard medical treatment. OUTCOMES: Our critical outcomes were all-cause mortality, serious adverse events, and health-related quality of life. Among our important outcomes were HBV-related morbidity, HBV-related mortality, non-serious adverse events, and the proportion of people without histological improvements. RISK OF BIAS: We used the Cochrane Risk of bias 2 tool (RoB 2) to assess risk of bias. SYNTHESIS METHODS: We followed Cochrane methods. We conducted meta-analyses for predefined outcomes using data from the longest follow-up period, irrespective of the risk of bias judgements. We presented dichotomous outcome results as risk ratios (RRs) and continuous outcome results as mean differences, with 95% confidence intervals (CIs) at their longest follow-ups. We used the random-effects model for our primary analyses. We used GRADE to assess the certainty of the evidence for each outcome. INCLUDED STUDIES: We included 10 RCTs conducted in Bangladesh, China, Italy, Korea, Singapore, and Taiwan, with 1349 randomised participants (range: 12 to 690; 1045 (77.5%) were male). Among the trials reporting age, none included participants younger than 17 years (age range: 17 to 75 years). The trials were published between 1991 and 2018, and assessed thymosin-ɑ1 in adults with chronic hepatitis B infection, with or without comorbidities. Only two trials mentioned comorbidities (cirrhosis and acute-on-chronic liver failure). The trials compared thymosin-ɑ1, with or without a cointervention, with placebo or no intervention, or with the same cointervention. The control interventions were placebos in two trials and no intervention in two. The remaining six trials administered co-interventions, such as interferon, pegylated interferon, lamivudine, and standard medical therapy (entecavir or tenofovir), and entecavir. Follow-ups ranged from six months to five years after the end of treatment (median: 12 months). Four trials were funded by industry, five by research grants, and one provided no information. All 10 trials (11 records) provided data on at least one outcome in our review. We identified no ongoing trials. Sixteen studies are awaiting assessment due to incomplete reporting. We received no responses to our enquiries. SYNTHESIS OF RESULTS: Thymosin-ɑ1, compared with the control interventions, may reduce all-cause mortality (RR 0.53, 95% CI 0.29 to 0.96; I² = 0%; 3 studies, 907 participants; very low-certainty evidence), serious adverse events (RR 0.72, 95% CI 0.53 to 0.99; I² = 0%; 5 studies, 1056 participants; low-certainty evidence), HBV-related mortality (RR 0.53, 95% CI 0.29 to 0.96; I² = 0%; 3 studies, 907 participants; very low-certainty evidence), non-serious adverse events (RR 0.47, 95% CI 0.27 to 0.83; I² = 0%; 5 studies, 300 participants; very low-certainty evidence), and may have little to no effect on health-related quality of life (MD 0.70, 95% CI -2.55 to 3.95; I² not applicable; 1 study, 161 participants; very low-certainty evidence; score range: 0 to 100; the higher the score, the better) and on histological improvement (RR 0.51, 95% CI 0.13 to 2.06; I² = 74%; 2 studies, 702 participants; very low-certainty evidence). The evidence is very uncertain about the effect of thymosin-ɑ1 on hepatitis B-related morbidity (RR 0.86, 95% CI 0.54 to 1.40; I² = 3%; 3 studies, 854 participants; very low-certainty evidence). We judged the certainty of evidence to be low for serious adverse events and very low for the remaining outcomes. Reasons for downgrading were mainly due to study limitations, including overall high or some concerns for risk of bias; imprecision of the pooled effect estimates (including wide or very wide confidence intervals crossing the line of no effect, and small participant numbers); and inconsistency due to substantial heterogeneity (I² = 74%). The test for subgroup differences provided no evidence of differences in effect according to thymosin‑α1 administration for any outcome (P ≥ 0.05). AUTHORS' CONCLUSIONS: We assessed the certainty of evidence as very low for all outcomes except for serious adverse events (low). Therefore, we are not sure whether thymosin-α1 monotherapy versus placebo or no intervention, or with the same co-interventions, reduces all-cause mortality, serious adverse events, HBV-related mortality, and non-serious adverse events, nor whether it has any effect on quality of life (based on one trial) and histological improvement. The effect of thymosin-ɑ1 on HBV-related morbidity is very uncertain. We observed no statistically significant differences between trials with and without cointerventions. We found no ongoing trials. FUNDING: This Cochrane review had no dedicated funding. REGISTRATION: Protocol available via DOI: 10.1002/14651858.CD014610.

Humans

A comprehensive bibliography database using a microcomputer.

A system was implemented using a commercial database management program and a microcomputer for computerising references from journals and other sources. In addition to the citation, the user can enter the address of the institution where the study was carried out, a description of the article and of the work, key words, and an abstract. References are added, edited, searched for, displayed on screen, typed on paper, or sent to a text file, using selection criteria entered by the user. When a search is performed the printout will include the abstract of each paper, similar to that obtained from larger bibliographic services. The computer also writes requests for reprints. This program now holds over 30 000 references and has been in use for over three years. Such a system is beneficial for personal study, for writing books, articles, and theses, and for use by institutions, departments, and small libraries.

Bibliographies as Topic

Identification and description of low-molecular weight chemicals inducing hypersensitivity in man.

The purpose of this study is to compose a list of allergenic chemicals. Each chemical is described in a monograph. The objective of such a monograph program is to collect from the international scientific literature available relevant experimental, chemical, and epidemiological data on chemicals to which humans are known to be exposed and sensitized. A list of 721 chemicals, with related synonyms and trade names, that induce allergic responses and hypersensitivities was prepared. The chemicals were selected on the basis of evidence of human exposure and sensitization. Each monograph contains several data considered relevant to the evaluation of the sensitizing hazards of chemical substances. The data are divided in three sections: chemical identity, sensitizing power, and occurrence. All the data contained in the monographs along with the references and the synonyms are stored in a database application computer program. Preliminary results of 308 of 721 monographs analyzed are reported.

Allergens

Detection and elimination of duplicates from multidatabase searches.

A major problem in the review and synthesis of citations resulting from multidatabase searching is overlap in coverage among the databases. The ability to identify and eliminate duplicate references from a multidatabase search provides an important service and significant time savings for the end user. The Upjohn Company's Corporate Technical Library has developed software to detect and eliminate duplicates from literature searches captured in electronic format. Methods for the identification of duplicates and the merging and sorting of unique citations are discussed, together with the library's procedures for electronic data capture.

Information Services

A compendium of reviews in biochemistry and molecular biology published in the second half of 1991.

A compendium of reviews and mini-reviews in biochemistry and molecular biology published in the second half of 1991 is presented. In all 880 titles are listed from 108 different publications. This compendium presents the references by journal name--the most suitable format for a hardcopy of this information. Keywords have been included with each reference to increase the value of the collection. Keyword and author cross-reference indexes are not included but are available in the electronic database from which this version was constructed. Should anyone wish to have this information in electronic form it can be distributed on MS-DOS formatted floppy disks in either Reference Manager or Medline format. The author should be contacted for details of the number of pre-formatted floppy disks required.

Biochemical Phenomena

A compendium of reviews in biochemistry and molecular biology published in the first half of 1992.

1. A compendium of reviews and mini-reviews in Biochemistry and Molecular Biology published in the first half of 1992 is presented. In all 499 titles are listed from 95 different publications. 2. This compendium presents the references by Journal Name. Keywords have been included with each reference to increase the value of the collection. Keyword and author cross-reference indexes are not included but are available in the electronic database from which this version was constructed. Should anyone wish to have this information in electronic form it can be distributed on MS-DOS formatted floppy disks in either Reference Manager or Medline format. The author should be contacted for details of the number of preformatted floppy disks required.

Biochemical Phenomena

Use of monitored CD4 cell counts: predictions of the AIDS epidemic in Scotland: CD4 Collaborative Group.

OBJECTIVE: We describe the CD4 database of the Scottish Immunology Laboratories, and its uses and limitations for making short-term predictions of a CD4 cell count less than or equal to 200 x 10(6)/l (CD4(200)) and of adult AIDS cases in Scotland. DESIGN: The date of the earlier of two consecutive samples (typically 3 months apart) both with CD4 cell counts less than or equal to 200 x 10(6)/l was taken to define when a patient had passed the CD4(200) threshold (referred to as a CD4(200) case). The CD4 database comprises HIV-1-seropositive adults in the four main risk groups [homosexual/bisexual (1), injecting drug users (IDU; 2), heterosexual contact (3), and undetermined (9)] from Scotland's three principal areas of population (Lothian, Tayside and Strathclyde) who have had a CD4 cell count of less than or equal to 500 x 10(6)/l. SETTING: Three hospitals in Scotland, the Communicable Diseases (Scotland Unit) and the Medical Research Council Biostatistics Unit, Cambridge, UK. PATIENTS, PARTICIPANTS: The CD4 database at 31 December 1990 listed 813 patients (of whom 52% were IDU): 390 were CD4(200)/AIDS cases (of whom 44% were IDU) and 192 were AIDS cases (of whom 32% were IDU). RESULTS: Individuals in risk groups 1, 2 and 3 were nearly equally represented among newly diagnosed HIV-1 infections in 1990. However, among patients with moderate immunodeficiency, IDU accounted for 50% of the total number. Co-incidence of first CD4 cell count with CD4(200) diagnosis was recorded for only 28% of IDU, but in over 50% of cases for each of the other exposure groups (57%). There was a highly significant decrease of around 80 x 10(6)/l per calendar-year-of-referral in first CD4 cell counts for patients on the CD4 database; and decreases of around 40 x 10(6)/lper decade of age at referral. Since 1988, median time from CD4(200) to AIDS diagnosis in Scotland has been approximately 2 years. Back-projection was applied to annual CD4(200)/AIDS diagnoses before 31 December 1990 and to AIDS diagnoses. From AIDS diagnoses, the central epidemic scenario underestimated past HIV-1-antibody-positive reports (up to the end of 1985). More dramatic underestimation was occasioned by back-projection from CD4(200)/AIDS diagnoses [319 inferred HIV infections compared with 445 HIV-1-antibody-positive reports to Communicable Diseases (Scotland) Unit]. CONCLUSIONS: First CD4 cell counts should complement new HIV-1 diagnoses. Past referrals for immunological monitoring were not uniform between risk groups in Scotland. Underascertainment of CD4(200) cases is a problem when CD4(200) cases are used as a basis for back-projection. More information concerning the incubation distribution from HIV seroconversion to CD4(200) diagnosis is required. It is likely that there are twice as many CD4(200)/AIDS as there are diagnosed cases of AIDS.

Acquired Immunodeficiency Syndrome

The diagnosis of syndromes by use of a dysmorphology database.

A dysmorphology data base can be useful for the clinician in the task of diagnosing multiple malformation syndromes in children. In this article the database POSSUM is described. Four patients with multiple anomalies referred for diagnostic syndrome evaluation are presented. They serve as examples on how POSSUM efficiently can be applied to obtain a short list of appropriate alternative syndromes, subsequently followed by a discussion on the differential diagnosis in each case. A specific, rare syndrome was diagnosed with the aid of POSSUM in all four cases. POSSUM appears to be useful for the diagnosis of dysmorphic syndromes.

Abnormalities, Multiple

Host-enhanced chemical indexing in technical databases.

Many files that index engineering, physics, or other technical literature contain references to chemical compounds. Complex chemical formulas in the title or abstract often contain special characters, for example, (,), [,], +, -, degrees, and %. Upper and lower case letters often are also included. A search of these formulas and symbols in the basic index is next to impossible because the terms in this field are usually parsed to all alphanumeric characters without sensitivity to case. It is possible for an online host to use a character-recognition algorithm to scan the title and abstract data for special characters or character strings and place them in a separate index field when such files are loaded. Such an algorithm has been designed by Fachinformationszentrun Energie, Physik, Mathematik GmbH in Karlsruhe, West Germany (FIZ Karlsruhe), the European service center of STN International, the scientific and technical information network. This algorithm recognizes and analyzes chemical formulas, material descriptions, alloys, and eutectic systems as well as nuclear reactions and dopings that appear in the title, abstract, or other fields. These character strings are converted into a standardized form and placed in a new field (the element terms field) which is supplied by the online host during the loading process. A checklist of allowed terms (symbols and chemical formulas) is used to prevent irrelevant terms from being mistaken for legitimate chemical symbols. For instance, the algorithm can recognize that CPU (central processing unit) is not a legitimate chemical formula. It is easy to demonstrate the utility this additional index supplies.(ABSTRACT TRUNCATED AT 250 WORDS)

Abstracting and Indexing

A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.

Base Sequence

Survival of elderly men with congestive heart failure.

Congestive heart failure (CHF) is the most common discharge diagnosis for elderly patients. The survival of elderly (age greater than or equal to 75 years) patients with CHF has not recently been reported, especially with reference to left ventricular ejection fraction (LVEF). A patient database was searched for the diagnosis of CHF and then screened for age greater than or equal to 75, Framingham Criteria for CHF and an LVEF evaluation. Ninety-four men fitted all criteria, including a minimum potential follow-up of 3 years. Life-table analysis was employed to compare their survival experience to an expected survival based on a sex- and age-equivalent subset of the 1980 Census data. Causes of death were determined from autopsy, medical records or death certificates. Mean age at onset of CHF was 82.5. Forty-three per cent had an LVEF greater than or equal to 0.45. There was no difference in the prevalence of potential aetiologies between those with LVEF greater than or equal to 0.45 versus LVEF less than 0.45. Life-table analysis revealed that CHF patients had a worse survival than controls for the first 5 years after diagnosis, attributable primarily to a high first-year mortality (28%) for the CHF group. There was no difference in survival between the LVEF greater than or equal to 0.45 and LVEF less than 0.45 groups.

Aged

PEELing: an integrated and user-centric platform for spatially resolved proteomics data analysis.

SUMMARY: Molecular compartmentalization is vital for cellular physiology. Spatially resolved proteomics allows biologists to survey protein composition and dynamics with subcellular resolution. Here, we present PEELing, an integrated package and user-friendly web service for analyzing spatially resolved proteomics data. PEELing assesses data quality using curated or user-defined references, performs cutoff analysis to remove contaminants, connects to databases for functional annotation, and generates data visualizations-providing a streamlined and reproducible workflow to explore spatially resolved proteomics data. AVAILABILITY AND IMPLEMENTATION: PEELing and its tutorial are publicly available at https://peeling.janelia.org/ (Zenodo DOI: 10.5281/zenodo.15692517). A Python package of PEELing is available at https://github.com/JaneliaSciComp/peeling/ (Zenodo DOI: 10.5281/zenodo.15692434).

Proteomics